Skip to content

oicr-gsi/ichorCNA

Repository files navigation

ichorCNA

Workflow for estimating the fraction of tumor in cell-free DNA from sWGS (shallow Whole Genome Sequencing). ichorCNA can be used to inform the presence or absence of tumor-derived DNA and to guide the decision to perform whole exome or deeper whole genome sequencing. Furthermore, the quantitative estimate of tumor fraction can we used to calibrate the desired depth of sequencing to reach statistical power for identifying mutations in cell-free DNA. Finally, ichorCNA can be use to detect large-scale copy number alterations from large cohorts by taking advantage of the cost-effective approach of ultra-low-pass sequencing.

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run ichorCNA.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter Value Description
outputFileNamePrefix String Output prefix to prefix output file names with.
windowSize Int The size of non-overlapping windows.
minimumMappingQuality Int Mapping quality value below which reads are ignored.
chromosomesToAnalyze String Chromosomes in the bam reference file.
provisionBam Boolean Boolean, to provision out bam file and coverage metrics
inputType String one of either fastq or bam
reference String The genome reference build. for example: hg19, hg38
bamQC.bamQCMetrics_workflowVersion String Workflow version string
bamQC.bamQCMetrics_refSizesBed String Path to human genome BED reference with chromosome sizes
bamQC.bamQCMetrics_refFasta String Path to human genome FASTA reference
bamQC.metadata Map[String,String] JSON file containing metadata

Optional workflow parameters:

Parameter Value Default Description
inputGroups Array[InputGroup]? None Array of fastq files and their read groups (optional).
inputBam Array[File]? None Array of one or multiple bam files (optional).

Optional task parameters:

Parameter Value Default Description
bwaMem.adapterTrimmingLog_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
bwaMem.indexBam_timeout Int 48 Hours before task timeout
bwaMem.indexBam_modules String "samtools/1.9" Modules for running indexing job
bwaMem.indexBam_jobMemory Int 12 Memory allocated indexing job
bwaMem.bamMerge_timeout Int 72 Hours before task timeout
bwaMem.bamMerge_modules String "samtools/1.9" Required environment modules
bwaMem.bamMerge_jobMemory Int 32 Memory allocated indexing job
bwaMem.runBwaMem_timeout Int 96 Hours before task timeout
bwaMem.runBwaMem_jobMemory Int 32 Memory allocated for this job
bwaMem.runBwaMem_threads Int 8 Requested CPU threads
bwaMem.runBwaMem_addParam String? None Additional BWA parameters
bwaMem.adapterTrimming_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimming_jobMemory Int 16 Memory allocated for this job
bwaMem.adapterTrimming_addParam String? None Additional cutadapt parameters
bwaMem.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
bwaMem.slicerR2_timeout Int 48 Hours before task timeout
bwaMem.slicerR2_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR2_modules String "slicer/0.3.0" Required environment modules
bwaMem.slicerR1_timeout Int 48 Hours before task timeout
bwaMem.slicerR1_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR1_modules String "slicer/0.3.0" Required environment modules
bwaMem.countChunkSize_timeout Int 48 Hours before task timeout
bwaMem.countChunkSize_jobMemory Int 16 Memory allocated for this job
bwaMem.numChunk Int 1 number of chunks to split fastq file [1, no splitting]
bwaMem.trimMinLength Int 1 minimum length of reads to keep [1]
bwaMem.trimMinQuality Int 0 minimum quality of read ends to keep [0]
bwaMem.adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" adapter sequence to trim from read 1 [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
bwaMem.adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" adapter sequence to trim from read 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]
preMergeBamMetricsFastqInput.jobMemory Int 8 Memory (in GB) to allocate to the job.
preMergeBamMetricsFastqInput.modules String "samtools/1.14" Environment module name and version to load (space separated) before command execution.
preMergeBamMetricsFastqInput.timeout Int 12 Maximum amount of time (in hours) the task can run for.
bamMerge.jobMemory Int 32 Memory allocated indexing job
bamMerge.modules String "samtools/1.14" Required environment modules
bamMerge.timeout Int 72 Hours before task timeout
preMergeBamMetrics.jobMemory Int 8 Memory (in GB) to allocate to the job.
preMergeBamMetrics.modules String "samtools/1.14" Environment module name and version to load (space separated) before command execution.
preMergeBamMetrics.timeout Int 12 Maximum amount of time (in hours) the task can run for.
inputBamMerge.jobMemory Int 32 Memory allocated indexing job
inputBamMerge.modules String "samtools/1.14" Required environment modules
inputBamMerge.timeout Int 72 Hours before task timeout
indexBam.jobMemory Int 8 Memory (in GB) to allocate to the job.
indexBam.modules String "samtools/1.14" Environment module name and version to load (space separated) before command execution.
indexBam.timeout Int 12 Maximum amount of time (in hours) the task can run for.
runReadCounter.mem Int 8 Memory (in GB) to allocate to the job.
runReadCounter.modules String "samtools/1.14 hmmcopy-utils/0.1.1" Environment module name and version to load (space separated) before command execution.
runReadCounter.timeout Int 12 Maximum amount of time (in hours) the task can run for.
runIchorCNA.normalWig File? None Normal WIG file. Default: [NULL].
runIchorCNA.exonsBed String? None Bed file containing exon regions. Default: [NULL].
runIchorCNA.minMapScore Float? None Include bins with a minimum mappability score of this value. Default: [0.9].
runIchorCNA.rmCentromereFlankLength Int? None Length of region flanking centromere to remove. Default: [1e+05].
runIchorCNA.normal String ""c(0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9)"" Initial normal contamination; can be more than one value if additional normal initializations are desired. Default: [0.5]
runIchorCNA.scStates String ""c(1, 3)"" Subclonal states to consider.
runIchorCNA.coverage String? None PICARD sequencing coverage.
runIchorCNA.lambda String? None Initial Student's t precision; must contain 4 values (e.g. c(1500,1500,1500,1500)); if not provided then will automatically use based on variance of data.
runIchorCNA.lambdaScaleHyperParam Int? None Hyperparameter (scale) for Gamma prior on Student's-t precision. Default: [3].
runIchorCNA.ploidy String ""c(2,3)"" Initial tumour ploidy; can be more than one value if additional ploidy initializations are desired. Default: [2]
runIchorCNA.maxCN Int 5 Total clonal CN states.
runIchorCNA.estimateNormal Boolean true Estimate normal?
runIchorCNA.estimateScPrevalence Boolean true Estimate subclonal prevalence?
runIchorCNA.estimatePloidy Boolean true Estimate tumour ploidy?
runIchorCNA.maxFracCNASubclone Float? None Exclude solutions with fraction of subclonal events greater than this value. Default: [0.7].
runIchorCNA.maxFracGenomeSubclone Float? None Exclude solutions with subclonal genome fraction greater than this value. Default: [0.5].
runIchorCNA.minSegmentBins String? None Minimum number of bins for largest segment threshold required to estimate tumor fraction; if below this threshold, then will be assigned zero tumor fraction.
runIchorCNA.altFracThreshold Float? None Minimum proportion of bins altered required to estimate tumor fraction; if below this threshold, then will be assigned zero tumor fraction. Default: [0.05].
runIchorCNA.chrNormalize String? None Specify chromosomes to normalize GC/mappability biases. Default: [c(1:22)].
runIchorCNA.chrTrain String ""c(1:22)"" Specify chromosomes to estimate params. Default: [c(1:22)].
runIchorCNA.genomeStyle String? None NCBI or UCSC chromosome naming convention; use UCSC if desired output is to have "chr" string. [Default: NCBI].
runIchorCNA.normalizeMaleX Boolean? None If male, then normalize chrX by median. Default: [TRUE].
runIchorCNA.fracReadsInChrYForMale Float? None Threshold for fraction of reads in chrY to assign as male. Default: [0.001].
runIchorCNA.includeHOMD Boolean true If FALSE, then exclude HOMD state. Useful when using large bins (e.g. 1Mb). Default: [FALSE].
runIchorCNA.txnE Float 0.9999 Self-transition probability. Increase to decrease number of segments. Default: [0.9999999]
runIchorCNA.txnStrength Int 10000 Transition pseudo-counts. Exponent should be the same as the number of decimal places of --txnE. Default: [1e+07].
runIchorCNA.plotFileType String? None File format for output plots. Default: [pdf].
runIchorCNA.plotYLim String? None ylim to use for chromosome plots. Default: [c(-2,2)].
runIchorCNA.outDir String "./" Output Directory. Default: [./].
runIchorCNA.libdir String? None Script library path.
runIchorCNA.modules String "ichorcna/0.2" Environment module name and version to load (space separated) before command execution.
runIchorCNA.mem Int 8 Memory (in GB) to allocate to the job.
runIchorCNA.timeout Int 12 Maximum amount of time (in hours) the task can run for.
bamQC.collateResults_timeout Int 1 hours before task timeout
bamQC.collateResults_threads Int 4 Requested CPU threads
bamQC.collateResults_jobMemory Int 8 Memory allocated for this job
bamQC.collateResults_modules String "python/3.6" required environment modules
bamQC.cumulativeDistToHistogram_timeout Int 1 hours before task timeout
bamQC.cumulativeDistToHistogram_threads Int 4 Requested CPU threads
bamQC.cumulativeDistToHistogram_jobMemory Int 8 Memory allocated for this job
bamQC.cumulativeDistToHistogram_modules String "python/3.6" required environment modules
bamQC.runMosdepth_timeout Int 4 hours before task timeout
bamQC.runMosdepth_threads Int 4 Requested CPU threads
bamQC.runMosdepth_jobMemory Int 16 Memory allocated for this job
bamQC.runMosdepth_modules String "mosdepth/0.2.9" required environment modules
bamQC.bamQCMetrics_timeout Int 4 hours before task timeout
bamQC.bamQCMetrics_threads Int 4 Requested CPU threads
bamQC.bamQCMetrics_jobMemory Int 16 Memory allocated for this job
bamQC.bamQCMetrics_modules String "bam-qc-metrics/0.2.5" required environment modules
bamQC.bamQCMetrics_normalInsertMax Int 1500 Maximum of expected insert size range
bamQC.markDuplicates_timeout Int 4 hours before task timeout
bamQC.markDuplicates_threads Int 4 Requested CPU threads
bamQC.markDuplicates_jobMemory Int 16 Memory allocated for this job
bamQC.markDuplicates_modules String "picard/2.21.2" required environment modules
bamQC.markDuplicates_picardMaxMemMb Int 6000 Memory requirement in MB for running Picard JAR
bamQC.markDuplicates_opticalDuplicatePixelDistance Int 100 Maximum offset between optical duplicate clusters
bamQC.downsampleRegion_timeout Int 4 hours before task timeout
bamQC.downsampleRegion_threads Int 4 Requested CPU threads
bamQC.downsampleRegion_jobMemory Int 16 Memory allocated for this job
bamQC.downsampleRegion_modules String "samtools/1.9" required environment modules
bamQC.downsample_timeout Int 4 hours before task timeout
bamQC.downsample_threads Int 4 Requested CPU threads
bamQC.downsample_jobMemory Int 16 Memory allocated for this job
bamQC.downsample_modules String "samtools/1.9" required environment modules
bamQC.downsample_randomSeed Int 42 Random seed for pre-downsampling (if any)
bamQC.downsample_downsampleSuffix String "downsampled.bam" Suffix for output file
bamQC.findDownsampleParamsMarkDup_timeout Int 4 hours before task timeout
bamQC.findDownsampleParamsMarkDup_threads Int 4 Requested CPU threads
bamQC.findDownsampleParamsMarkDup_jobMemory Int 16 Memory allocated for this job
bamQC.findDownsampleParamsMarkDup_modules String "python/3.6" required environment modules
bamQC.findDownsampleParamsMarkDup_customRegions String "" Custom downsample regions; overrides chromosome and interval parameters
bamQC.findDownsampleParamsMarkDup_intervalStart Int 100000 Start of interval in each chromosome, for very large BAMs
bamQC.findDownsampleParamsMarkDup_baseInterval Int 15000 Base width of interval in each chromosome, for very large BAMs
bamQC.findDownsampleParamsMarkDup_chromosomes Array[String] ["chr12", "chr13", "chrXII", "chrXIII"] Array of chromosome identifiers for downsampled subset
bamQC.findDownsampleParamsMarkDup_threshold Int 10000000 Minimum number of reads to conduct downsampling
bamQC.findDownsampleParams_timeout Int 4 hours before task timeout
bamQC.findDownsampleParams_threads Int 4 Requested CPU threads
bamQC.findDownsampleParams_jobMemory Int 16 Memory allocated for this job
bamQC.findDownsampleParams_modules String "python/3.6" required environment modules
bamQC.findDownsampleParams_preDSMultiplier Float 1.5 Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
bamQC.findDownsampleParams_precision Int 8 Number of decimal places in fraction for pre-downsampling
bamQC.findDownsampleParams_minReadsRelative Int 2 Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
bamQC.findDownsampleParams_minReadsAbsolute Int 10000 Minimum value of targetReads to allow pre-downsampling
bamQC.findDownsampleParams_targetReads Int 100000 Desired number of reads in downsampled output
bamQC.indexBamFile_timeout Int 4 hours before task timeout
bamQC.indexBamFile_threads Int 4 Requested CPU threads
bamQC.indexBamFile_jobMemory Int 16 Memory allocated for this job
bamQC.indexBamFile_modules String "samtools/1.9" required environment modules
bamQC.countInputReads_timeout Int 4 hours before task timeout
bamQC.countInputReads_threads Int 4 Requested CPU threads
bamQC.countInputReads_jobMemory Int 16 Memory allocated for this job
bamQC.countInputReads_modules String "samtools/1.9" required environment modules
bamQC.updateMetadata_timeout Int 4 hours before task timeout
bamQC.updateMetadata_threads Int 4 Requested CPU threads
bamQC.updateMetadata_jobMemory Int 16 Memory allocated for this job
bamQC.updateMetadata_modules String "python/3.6" required environment modules
bamQC.filter_timeout Int 4 hours before task timeout
bamQC.filter_threads Int 4 Requested CPU threads
bamQC.filter_jobMemory Int 16 Memory allocated for this job
bamQC.filter_modules String "samtools/1.9" required environment modules
bamQC.filter_minQuality Int 30 Minimum alignment quality to pass filter
getMetrics.jobMemory Int 8 Memory (in GB) to allocate to the job.
getMetrics.modules String "samtools/1.14" Environment module name and version to load (space separated) before command execution.
getMetrics.timeout Int 12 Maximum amount of time (in hours) the task can run for.
createJson.jobMemory Int 8 Memory (in GB) to allocate to the job.
createJson.modules String "pandas/1.4.2" Environment module name and version to load (space separated) before command execution.
createJson.timeout Int 12 Maximum amount of time (in hours) the task can run for.

Outputs

Output Type Description Labels
genomeWideAll Pair[File,Map[String,String]] Genome wide plots for each solution
genomeWide Pair[File,Map[String,String]] Genome wide plots for the selected solution
bam File? Bam file used as input to ichorCNA (only produced when provisionBam is True) vidarr_label: bam
bamIndex File? Bam index for bam file used as input to ichorCNA (only produced when provisionBam is True) vidarr_label: bamIndex
jsonMetrics File Report on bam coverage, read counts and ichorCNA metrics. vidarr_label: jsonMetrics
segments File Segments called by the Viterbi algorithm. Format is compatible with IGV. vidarr_label: segments
segmentsWithSubclonalStatus File Same as segments but also includes subclonal status of segments (0=clonal, 1=subclonal). Format not compatible with IGV. vidarr_label: segmentsWithSubclonalStatus
estimatedCopyNumber File Estimated copy number, log ratio, and subclone status for each bin/window. vidarr_label: estimatedCopyNumber
convergedParameters File Final converged parameters for optimal solution. Also contains table of converged parameters for all solutions. vidarr_label: convergedParameters
correctedDepth File Log2 ratio of each bin/window after correction for GC and mappability biases. vidarr_label: correctedDepth
rData File Saved R image after ichorCNA has finished. Results for all solutions will be included. vidarr_label: rData
plots File Archived directory of plots. vidarr_label: plots
bamQCresult File bamQC report. vidarr_label: bamQCresult

Commands

This section lists command(s) run by ichorCNA workflow

  • Running ichorCNA

IchorCNA allows for quantification of tumor content in cfDNA. The input for this workflow is an array of fastq pairs with their read group information. This ichorCNA workflow first calls bwaMem for an alignment to the specified reference genome; then if multiple fastq pairs are specified the bam files are merged using samtools. The next step prepares the data for ichorCNA which is the final step in the workflow.

MERGE BAMS

       set -euo pipefail
       samtools merge \
       -c \
       ~{resultMergedBam} \
       ~{sep=" " bams}

COLLECT PRE-MERGE BAM METRICS

   set -euo pipefail
 
   echo run,read_count > ~{outputFileNamePrefix}_pre_merge_bam_metrics.csv
   for file in ~{sep=' ' bam}
   do
     run=$(samtools view -H "${file}" | grep '^@RG' | cut -f 2 | cut -f 2 -d ":" | cut -f 1 -d "-")
     read_count=$(samtools stats "${file}" | grep ^SN | grep "raw total sequences" | cut -f 3)
     echo $run,$read_count >> ~{outputFileNamePrefix}_pre_merge_bam_metrics.csv
   done;
 

INDEX BAM

   samtools index ~{inputbam} ~{resultBai}

READCOUNTER

     set -euo pipefail
 
     samtools index ~{bam}
 
     # calculate chromosomes to analyze (with reads) from input data
     CHROMOSOMES_WITH_READS=$(samtools idxstats ~{bam} | awk '$3 > 0' - | cut -f1 | grep {chromosomesToAnalyze} | paste -s -d, -)
 
     # write out a chromosomes with reads for ichorCNA
     # split onto new lines (for wdl read_lines), exclude chrY, remove chr prefix, wrap in single quotes for ichorCNA
     echo "${CHROMOSOMES_WITH_READS}" | tr ',' '\n' | grep -v chrY | sed "s/chr//g" | sed -e "s/\(.*\)/'\1'/" > ichorCNAchrs.txt
 
     # convert
     readCounter \
     --window ~{windowSize} \
     --quality ~{minimumMappingQuality} \
     --chromosome "${CHROMOSOMES_WITH_READS}" \
     ~{bam} | sed "s/chrom=chr/chrom=/" > ~{outputFileNamePrefix}.wig

RUN ICHORCNA

     set -euo pipefail
 
     runIchorCNA \
     --WIG ~{wig} \
     ~{"--NORMWIG " + normalWig} \
     --gcWig ~{gcWig} \
     ~{"--mapWig " + mapWig} \
     ~{"--normalPanel " + normalPanel} \
     ~{"--exons.bed " + exonsBed} \
     --id ~{outputFileNamePrefix} \
     ~{"--centromere " + centromere} \
     ~{"--minMapScore " + minMapScore} \
     ~{"--rmCentromereFlankLength " + rmCentromereFlankLength} \
     ~{"--normal " + normal} \
     ~{"--scStates " + scStates} \
     ~{"--coverage " + coverage} \
     ~{"--lambda " + lambda} \
     ~{"--lambdaScaleHyperParam " + lambdaScaleHyperParam} \
     ~{"--ploidy " + ploidy} \
     ~{"--maxCN " + maxCN} \
     ~{true="--estimateNormal True" false="--estimateNormal False" estimateNormal} \
     ~{true="--estimateScPrevalence True" false="--estimateScPrevalence  False" estimateScPrevalence} \
     ~{true="--estimatePloidy True" false="--estimatePloidy False" estimatePloidy} \
     ~{"--maxFracCNASubclone " + maxFracCNASubclone} \
     ~{"--maxFracGenomeSubclone " + maxFracGenomeSubclone} \
     ~{"--minSegmentBins " + minSegmentBins} \
     ~{"--altFracThreshold " + altFracThreshold} \
     ~{"--chrNormalize " + chrNormalize} \
     ~{"--chrTrain " + chrTrain} \
     --chrs "c(~{sep="," chrs})" \
     ~{"--genomeBuild " + genomeBuild} \
     ~{"--genomeStyle " + genomeStyle} \
     ~{true="--normalizeMaleX True" false="--normalizeMaleX False" normalizeMaleX} \
     ~{"--fracReadsInChrYForMale " + fracReadsInChrYForMale} \
     ~{true="--includeHOMD True" false="--includeHOMD False" includeHOMD} \
     ~{"--txnE " + txnE} \
     ~{"--txnStrength " + txnStrength} \
     ~{"--plotFileType " + plotFileType} \
     ~{"--plotYLim " + plotYLim} \
     ~{"--libdir " + libdir} \
     --outDir ~{outDir}
 
     # compress directory of plots
     tar -zcvf "~{outputFileNamePrefix}_plots.tar.gz" "~{outputFileNamePrefix}"
 
     #create txt file with plot full path
     ls $PWD/~{outputFileNamePrefix}/*genomeWide_all_sols.pdf > "~{outputFileNamePrefix}"_plots.txt
     ls $PWD/~{outputFileNamePrefix}/*genomeWide.pdf >> "~{outputFileNamePrefix}"_plots.txt

COLLECT FINAL BAM AND ICHORCNA METRICS

   set -euo pipefail
 
   echo coverage,read_count,tumor_fraction,ploidy > ~{outputFileNamePrefix}_bam_metrics.csv
   coverage=$(samtools coverage ~{inputbam} | grep -P "^chr\d+\t|^chrX\t|^chrY\t" | awk '{ space += ($3-$2)+1; bases += $7*($3-$2);} END { print bases/space }')
   read_count=$(samtools stats ~{inputbam} | grep ^SN | grep "raw total sequences" | cut -f 3)
   tumor_fraction=$(cat ~{params} | head -n 2 | tail -n 1 | cut -f 2)
   ploidy=$(cat ~{params} | head -n 2 | tail -n 1 | cut -f 3)
   echo $coverage,$read_count,$tumor_fraction,$ploidy >> ~{outputFileNamePrefix}_bam_metrics.csv
   cat ~{params} | tail -n 17 > ~{outputFileNamePrefix}_all_sols_metrics.csv

CREATE JSON WITH METRICS COLLECTED

     set -euo pipefail
 
     python3 <<CODE
     import csv, json
     import pandas as pd
 
     ### create json file with all metrics
 
     bam_metric = pd.read_csv("~{bamMetrics}")
     pre_metric = pd.read_csv("~{preBamMetrics}")
     all_sols = pd.read_csv("~{allSolsMetrics}", sep="\t")
     all_sols["tumor_fraction"] = round(1 - all_sols["n_est"],3)
     all_sols["solution"] = all_sols["init"]
     pre_metric_dict = pre_metric.to_dict('index')
     bam_metric_dict = bam_metric.to_dict('records')[0]
     with open("~{plotsFile}") as f:
       lines = f.readlines()
 
     #reorganize lane sequencing data
     lanes = []
     for lane in pre_metric_dict:
       lanes.append(pre_metric_dict[lane])
 
     #find selected solution
     selected_sol = ""
     for index, row in all_sols.iterrows():
       if round(row["tumor_fraction"],2) == round(bam_metric_dict["tumor_fraction"],2) and row["phi_est"] == bam_metric_dict["ploidy"]:
         selected_sol = row["init"]
 
     #selecting metrics from all solutions
     all_sols_metrics = {}
     for index, row in all_sols.iterrows():
       all_sols_metrics[row["solution"]] = {"tumor_fraction":row["tumor_fraction"],
                                            "ploidy":row["phi_est"],
                                            "loglik":row["loglik"]}
 
     metrics_dict = {"mean_coverage": bam_metric_dict["coverage"],
                     "total_reads": bam_metric_dict["read_count"],
                     "lanes_sequenced": len(pre_metric_dict),
                     "reads_per_lane":lanes,
                     "best_solution": selected_sol,
                     "tumor_fraction": bam_metric_dict["tumor_fraction"],
                     "ploidy": bam_metric_dict["ploidy"],
                     "solutions": all_sols_metrics}
 
     with open("~{outputFileNamePrefix}_metrics.json", "w") as outfile:
       json.dump(metrics_dict, outfile)
 
     ### create json output file for annotations
     output_list = []
     for line in lines:
       pdf_dict = {}
       line = line.strip()
       pdf_dict["left"] = line
       pdf_dict["right"] = {}
       pdf_dict["right"]["tumor_fraction"] = bam_metric_dict["tumor_fraction"]
       pdf_dict["right"]["ploidy"] = bam_metric_dict["ploidy"]
       output_list.append(pdf_dict)
     output_dict = {}
     output_dict["pdfs"] = output_list
 
     with open("~{outputFileNamePrefix}_outputs.json", "w") as outPdfJson:
         json.dump(output_dict, outPdfJson)
 
     CODE

Support

For support, please file an issue on the Github project or send an email to [email protected] .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

About

workflow for estimating the fraction of tumour in cell-free DNA from sWGS

Topics

Resources

Stars

Watchers

Forks

Packages

No packages published

Contributors 8