dnaSeqQC

Calls the bwaMem-bamQC alignment as a single step.

Overview

Dependencies

• bwa 0.7.12
• samtools 1.9
• cutadapt 1.8.3
• slicer 0.3.0
• picard 2.21.2
• python 3.6
• bam-qc-metrics 0.2.5
• mosdepth 0.2.9

Usage

Cromwell

java -jar cromwell.jar run dnaSeqQC.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter	Value	Description
fastqR1	File	fastq file for read 1
fastqR2	File	fastq file for read 2
reference	String	Reference Assembly id
bwamem2.runBwamem2_readGroups	String	The readgroup information to be injected into the bam header
bamQC.bamQCMetrics_workflowVersion	String	Workflow version string
bamQC.bamQCMetrics_refSizesBed	String	Path to human genome BED reference with chromosome sizes
bamQC.bamQCMetrics_refFasta	String	Path to human genome FASTA reference
bamQC.metadata	Map[String,String]	JSON file containing metadata
bamQC.mode	String	running mode for the workflow, only allow value 'lane_level' and 'call_ready'

Optional workflow parameters:

Parameter	Value	Default	Description
outputFileNamePrefix	String	basename(fastqR1)	Optional output prefix for the output

Optional task parameters:

Parameter	Value	Default	Description
bwamem2.adapterTrimmingLog_timeout	Int	48	Hours before task timeout
bwamem2.adapterTrimmingLog_jobMemory	Int	12	Memory allocated indexing job
bwamem2.indexBam_timeout	Int	48	Hours before task timeout
bwamem2.indexBam_modules	String	"samtools/1.9"	Modules for running indexing job
bwamem2.indexBam_jobMemory	Int	12	Memory allocated indexing job
bwamem2.bamMerge_timeout	Int	72	Hours before task timeout
bwamem2.bamMerge_modules	String	"samtools/1.9"	Required environment modules
bwamem2.bamMerge_jobMemory	Int	32	Memory allocated indexing job
bwamem2.runBwamem2_timeout	Int	96	Hours before task timeout
bwamem2.runBwamem2_jobMemory	Int	32	Memory allocated for this job
bwamem2.runBwamem2_threads	Int	8	Requested CPU threads
bwamem2.runBwamem2_addParam	String?	None	Additional BWA parameters
bwamem2.adapterTrimming_timeout	Int	48	Hours before task timeout
bwamem2.adapterTrimming_jobMemory	Int	16	Memory allocated for this job
bwamem2.adapterTrimming_addParam	String?	None	Additional cutadapt parameters
bwamem2.adapterTrimming_adapter2	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	Adapter sequence to trim from read 2
bwamem2.adapterTrimming_adapter1	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	Adapter sequence to trim from read 1
bwamem2.adapterTrimming_trimMinQuality	Int	0	Minimum quality of read ends to keep
bwamem2.adapterTrimming_trimMinLength	Int	1	Minimum length of reads to keep
bwamem2.adapterTrimming_umiLength	Int	5	The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
bwamem2.adapterTrimming_doUMItrim	Boolean	false	If true, do umi trimming
bwamem2.adapterTrimming_modules	String	"cutadapt/1.8.3"	Required environment modules
bwamem2.extractUMIs_timeout	Int	12	Time in hours before task timeout
bwamem2.extractUMIs_jobMemory	Int	24	Memory allocated for this job
bwamem2.extractUMIs_modules	String	"barcodex-rs/0.1.2 rust/1.45.1"	Required environment modules
bwamem2.extractUMIs_pattern2	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
bwamem2.extractUMIs_pattern1	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
bwamem2.extractUMIs_outputPrefix	String	"extractUMIs_output"	Specifies the start of the output files
bwamem2.extractUMIs_umiList	String	"umiList"	Reference file with valid UMIs
bwamem2.slicerR2_timeout	Int	48	Hours before task timeout
bwamem2.slicerR2_jobMemory	Int	16	Memory allocated for this job
bwamem2.slicerR2_modules	String	"slicer/0.3.0"	Required environment modules
bwamem2.slicerR1_timeout	Int	48	Hours before task timeout
bwamem2.slicerR1_jobMemory	Int	16	Memory allocated for this job
bwamem2.slicerR1_modules	String	"slicer/0.3.0"	Required environment modules
bwamem2.countChunkSize_timeout	Int	48	Hours before task timeout
bwamem2.countChunkSize_jobMemory	Int	16	Memory allocated for this job
bwamem2.countChunkSize_modules	String	"python/3.7"	Required environment modules
bwamem2.numChunk	Int	1	Number of chunks to split fastq file [1, no splitting]
bwamem2.doUMIextract	Boolean	false	If true, UMI will be extracted before alignment [false]
bwamem2.doTrim	Boolean	false	If true, adapters will be trimmed before alignment [false]
bwamem2.numReads	Int?	None	Number of reads
bamQC.collateResults_timeout	Int	1	hours before task timeout
bamQC.collateResults_threads	Int	4	Requested CPU threads
bamQC.collateResults_jobMemory	Int	8	Memory allocated for this job
bamQC.collateResults_modules	String	"python/3.6"	required environment modules
bamQC.cumulativeDistToHistogram_timeout	Int	1	hours before task timeout
bamQC.cumulativeDistToHistogram_threads	Int	4	Requested CPU threads
bamQC.cumulativeDistToHistogram_jobMemory	Int	8	Memory allocated for this job
bamQC.cumulativeDistToHistogram_modules	String	"python/3.6"	required environment modules
bamQC.runMosdepth_timeout	Int	4	hours before task timeout
bamQC.runMosdepth_threads	Int	4	Requested CPU threads
bamQC.runMosdepth_jobMemory	Int	16	Memory allocated for this job
bamQC.runMosdepth_modules	String	"mosdepth/0.2.9"	required environment modules
bamQC.bamQCMetrics_timeout	Int	4	hours before task timeout
bamQC.bamQCMetrics_threads	Int	4	Requested CPU threads
bamQC.bamQCMetrics_jobMemory	Int	16	Memory allocated for this job
bamQC.bamQCMetrics_modules	String	"bam-qc-metrics/0.2.5"	required environment modules
bamQC.bamQCMetrics_normalInsertMax	Int	1500	Maximum of expected insert size range
bamQC.markDuplicates_timeout	Int	4	hours before task timeout
bamQC.markDuplicates_threads	Int	4	Requested CPU threads
bamQC.markDuplicates_jobMemory	Int	16	Memory allocated for this job
bamQC.markDuplicates_modules	String	"picard/2.21.2"	required environment modules
bamQC.markDuplicates_picardMaxMemMb	Int	6000	Memory requirement in MB for running Picard JAR
bamQC.markDuplicates_opticalDuplicatePixelDistance	Int	100	Maximum offset between optical duplicate clusters
bamQC.downsampleRegion_timeout	Int	4	hours before task timeout
bamQC.downsampleRegion_threads	Int	4	Requested CPU threads
bamQC.downsampleRegion_jobMemory	Int	16	Memory allocated for this job
bamQC.downsampleRegion_modules	String	"samtools/1.14"	required environment modules
bamQC.downsample_timeout	Int	4	hours before task timeout
bamQC.downsample_threads	Int	4	Requested CPU threads
bamQC.downsample_jobMemory	Int	16	Memory allocated for this job
bamQC.downsample_modules	String	"samtools/1.14"	required environment modules
bamQC.downsample_randomSeed	Int	42	Random seed for pre-downsampling (if any)
bamQC.downsample_downsampleSuffix	String	"downsampled.bam"	Suffix for output file
bamQC.findDownsampleParamsMarkDup_timeout	Int	4	hours before task timeout
bamQC.findDownsampleParamsMarkDup_threads	Int	4	Requested CPU threads
bamQC.findDownsampleParamsMarkDup_jobMemory	Int	16	Memory allocated for this job
bamQC.findDownsampleParamsMarkDup_modules	String	"python/3.6"	required environment modules
bamQC.findDownsampleParamsMarkDup_customRegions	String	""	Custom downsample regions; overrides chromosome and interval parameters
bamQC.findDownsampleParamsMarkDup_intervalStart	Int	100000	Start of interval in each chromosome, for very large BAMs
bamQC.findDownsampleParamsMarkDup_baseInterval	Int	15000	Base width of interval in each chromosome, for very large BAMs
bamQC.findDownsampleParamsMarkDup_chromosomes	Array[String]	["chr12", "chr13", "chrXII", "chrXIII"]	Array of chromosome identifiers for downsampled subset
bamQC.findDownsampleParamsMarkDup_threshold	Int	10000000	Minimum number of reads to conduct downsampling
bamQC.findDownsampleParams_timeout	Int	4	hours before task timeout
bamQC.findDownsampleParams_threads	Int	4	Requested CPU threads
bamQC.findDownsampleParams_jobMemory	Int	16	Memory allocated for this job
bamQC.findDownsampleParams_modules	String	"python/3.6"	required environment modules
bamQC.findDownsampleParams_preDSMultiplier	Float	1.5	Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
bamQC.findDownsampleParams_precision	Int	8	Number of decimal places in fraction for pre-downsampling
bamQC.findDownsampleParams_minReadsRelative	Int	2	Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
bamQC.findDownsampleParams_minReadsAbsolute	Int	10000	Minimum value of targetReads to allow pre-downsampling
bamQC.findDownsampleParams_targetReads	Int	100000	Desired number of reads in downsampled output
bamQC.updateMetadata_timeout	Int	4	hours before task timeout
bamQC.updateMetadata_threads	Int	4	Requested CPU threads
bamQC.updateMetadata_jobMemory	Int	16	Memory allocated for this job
bamQC.updateMetadata_modules	String	"python/3.6"	required environment modules
bamQC.filter_timeout	Int	4	hours before task timeout
bamQC.filter_threads	Int	4	Requested CPU threads
bamQC.filter_jobMemory	Int	16	Memory allocated for this job
bamQC.filter_modules	String	"samtools/1.14"	required environment modules
bamQC.filter_minQuality	Int	30	Minimum alignment quality to pass filter
bamQC.mergeFiles_modules	String	"gatk/4.1.6.0"	Environment module name and version to load (space separated) before command execution.
bamQC.mergeFiles_timeout	Int	24	Maximum amount of time (in hours) the task can run for.
bamQC.mergeFiles_cores	Int	1	The number of cores to allocate to the job.
bamQC.mergeFiles_overhead	Int	6	Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamQC.mergeFiles_jobMemory	Int	24	Memory allocated to job (in GB).
bamQC.mergeFiles_suffix	String	".merge"	suffix to use for merged bam
bamQC.mergeSplitByIntervalFiles_modules	String	"gatk/4.1.6.0"	Environment module name and version to load (space separated) before command execution.
bamQC.mergeSplitByIntervalFiles_timeout	Int	24	Maximum amount of time (in hours) the task can run for.
bamQC.mergeSplitByIntervalFiles_cores	Int	1	The number of cores to allocate to the job.
bamQC.mergeSplitByIntervalFiles_overhead	Int	6	Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
bamQC.mergeSplitByIntervalFiles_jobMemory	Int	24	Memory allocated to job (in GB).
bamQC.mergeSplitByIntervalFiles_suffix	String	".merge"	suffix to use for merged bam
bamQC.preFilter_timeout	Int	4	hours before task timeout
bamQC.preFilter_threads	Int	4	Requested CPU threads
bamQC.preFilter_minMemory	Int	2	Minimum amount of RAM allocated to the task
bamQC.preFilter_jobMemory	Int	6	Memory allocated for this job
bamQC.preFilter_modules	String	"samtools/1.14"	required environment modules
bamQC.preFilter_filterAdditionalParams	String?	None	Additional parameters to pass to samtools.
bamQC.preFilter_minMapQuality	Int?	None	Minimum alignment quality to pass filter
bamQC.preFilter_filterFlags	Int	260	Samtools filter flags to apply.
bamQC.getChrCoefficient_modules	String	"samtools/1.14"	Names and versions of modules to load
bamQC.getChrCoefficient_timeout	Int	1	Hours before task timeout
bamQC.getChrCoefficient_memory	Int	2	Memory allocated for this job
bamQC.splitStringToArray_modules	String	""	Environment module name and version to load (space separated) before command execution.
bamQC.splitStringToArray_timeout	Int	1	Maximum amount of time (in hours) the task can run for.
bamQC.splitStringToArray_cores	Int	1	The number of cores to allocate to the job.
bamQC.splitStringToArray_jobMemory	Int	1	Memory allocated to job (in GB).
bamQC.splitStringToArray_recordSeparator	String	"+"	Record separator - a delimiter for joining records
bamQC.splitStringToArray_lineSeparator	String	","	Interval group separator - these are the intervals to split by.
bamQC.intervalsToParallelizeByString	String	"chr1,chr2,chr3,chr4,chr5,chr6,chr7,chr8,chr9,chr10,chr11,chr12,chr13,chr14,chr15,chr16,chr17,chr18,chr19,chr20,chr21,chr22,chrX,chrY,chrM"	Comma separated list of intervals to split by (e.g. chr1,chr2,chr3,chr4).

Outputs

Output	Type	Description	Labels
log	File?	log file for bwaMem task	vidarr_label: log
cutAdaptAllLogs	File?	log file for cutadapt task	vidarr_label: cutAdaptAllLogs
result	File	bamQC report	vidarr_label: result

Commands

This section lists command(s) run by dnaseqQC workflow

• Running dnaseqQC

This workflow imports two other workflows, bwaMem and bamQC. See the commands in README files for these workflows.

Support

For support, please file an issue on the Github project or send an email to [email protected] .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)