Skip to content

Commit

Permalink
Wrap filepaths of test directories in quotes to resolve problematic s…
Browse files Browse the repository at this point in the history 
…paces
  • Loading branch information
@croots
croots committed Jul 1, 2021
1 parent a561847 commit f7bb1cc
Showing 1 changed file with 15 additions and 11 deletions.
26 changes: 15 additions & 11 deletions tests/test_ostir.py
View file
Original file line number Diff line number Diff line change
Expand Up @@ -14,33 +14,37 @@

def csv_are_identical(csv_file_path_1, csv_file_path_2):
'Utility function for comparing output, Returns whether files are identical as bool'
failed = False
try:
with open(csv_file_path_1) as csv1:
reader = csv.reader(csv1)
csv_1_contents = [row for row in reader]
except:
print(f'Failed to open {str(csv_file_path_1)}')
return False
failed = True

try:
with open(csv_file_path_2) as csv2:
reader = csv.reader(csv2)
csv_2_contents = [row for row in reader]
except:
print(f'Failed to open {str(csv_file_path_2)}')
return False
failed = True

if len(csv_1_contents) != len(csv_2_contents):
print(f'CSVs are different lengths')
return False
failed = True

for i in range(0, len(csv_1_contents)):
if csv_1_contents[i] != csv_2_contents[i]:
# print(csv_1_rows[i], "\n!=\n",csv_1_rows[i])
print(f'CSVs have different values at row {i}')
return False
failed = True

return True
if failed == True:
return False
else:
return True


##############################################################################################
Expand Down Expand Up @@ -164,7 +168,7 @@ def test_integration_command_line_FASTA_input(self):
input_path = os.path.join(THIS_DIR, 'input', 'command_line_FASTA_input.fa')
output_path = os.path.join(THIS_DIR, 'output', 'command_line_FASTA_input.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'command_line_FASTA_input.csv')
the_command = f"ostir -j 4 -i {input_path} -o {output_path}"
the_command = f'ostir -j 4 -i "{input_path}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand All @@ -175,7 +179,7 @@ def test_integration_command_line_string_input(self):
output_path = os.path.join(THIS_DIR, 'output', 'command_line_string_input.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'command_line_string_input.csv')
input_sequence = "TTCTAGAAAAAAAATAAGGAGGTAAAATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATG"
the_command = f"ostir -j 4 -p -i {input_sequence} -o {output_path}"
the_command = f'ostir -j 4 -p -i "{input_sequence}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand All @@ -186,7 +190,7 @@ def test_integration_command_line_CSV_input(self):
input_path = os.path.join(THIS_DIR, 'input', 'command_line_CSV_input.csv')
output_path = os.path.join(THIS_DIR, 'output', 'command_line_CSV_input.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'command_line_CSV_input.csv')
the_command = f"ostir -j 4 -i {input_path} -o {output_path}"
the_command = f'ostir -j 4 -i "{input_path}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand All @@ -197,7 +201,7 @@ def test_integration_command_line_CSV_input(self):
input_path = os.path.join(THIS_DIR, 'input', 'command_line_CSV_input_alternate_columns_and_defaults.csv')
output_path = os.path.join(THIS_DIR, 'output', 'command_line_CSV_input_alternate_columns_and_defaults.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'command_line_CSV_input_alternate_columns_and_defaults.csv')
the_command = f"ostir -j 4 -a TCTGAAGAC -p -q -i {input_path} -o {output_path}"
the_command = f'ostir -j 4 -a TCTGAAGAC -p -q -i "{input_path}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand All @@ -212,7 +216,7 @@ def test_integration_Salis2009(self):
input_path = os.path.join(THIS_DIR, 'input', 'Salis2009.csv')
output_path = os.path.join(THIS_DIR, 'output', 'Salis2009.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'Salis2009.csv')
the_command = f"ostir -j 8 -p -i {input_path} -o {output_path}"
the_command = f'ostir -j 8 -p -i "{input_path}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand All @@ -227,7 +231,7 @@ def test_integration_T7_genome(self):
input_path = os.path.join(THIS_DIR, 'input', 'T7_genome.fasta')
output_path = os.path.join(THIS_DIR, 'output', 'T7_genome.csv')
expected_path = os.path.join(THIS_DIR, 'expected', 'T7_genome.csv')
the_command = f"ostir -j 8 -i {input_path} -o {output_path}"
the_command = f'ostir -j 8 -i "{input_path}" -o "{output_path}"'
print("\n" + the_command)
subprocess.call(the_command, shell=True)
self.assertEqual(True, csv_are_identical(output_path, expected_path))
Expand Down

0 comments on commit f7bb1cc

Please sign in to comment.