V1.1.0, ViennaRNA python wrapper (#7)

* Refactor for functional programming, Introduced some cython * Native package implementation of viennarna MFE * Native subopt, fix standby precision issue * Native subopt part 2 * RNAeval native implementation * Circular input support * Version=1.1.0, Remove cython, add constraints * Updated documentation, fix reference * Fix constraints, benchmarking script * Some cleanup for release
barricklab · Nov 8, 2022 · ddd7507 · ddd7507
1 parent d1fd653
commit ddd7507
Show file tree

Hide file tree

Showing 12 changed files with 1,175 additions and 1,039 deletions.
diff --git a/README.md b/README.md
@@ -55,7 +55,7 @@ More options and examples are described in the [Wiki Documentation](https://gith
 Run OSTIR on a sequence inside of a Python script:
 
 ```python3
-from ostir.ostir import run_ostir
+from ostir import run_ostir
 
 seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU"
 results = run_ostir(seq, name="my_sequence", threads=8)