update mirna analysis

doc/source/mirna_annotation.rst

@@ -42,6 +42,109 @@ You can map the miRNAs with.
 
      java -jar miraligner.jar -sub 1 -trim 3 -add 3 -s hsa -i test.fa -db DB  -o output_prefix 
 
-You can read more about the output here in the `wiki`_
+**Analyze with R**
 
-.. _wiki: https://github.com/lpantano/seqbuster/wiki/miraligner
+Use the outputs to do differential expression, clustering and descriptive analysis with this package: `isomiRs <https://github.com/lpantano/isomiRs>`_
+
+**Cite**
+
+SeqBuster is a bioinformatic tool for the processing and analysis of small RNAs datasets, reveals ubiquitous miRNA modifications in human embryonic cells. Pantano L, Estivill X, Martí E. *Nucleic Acids Res. 2010 Mar;38(5):e34. Epub 2009 Dec 11.*
+
+**MANUAL**
+
+***options***
+
+Add `-freq` if you have your fasta/fastq file with this format and you want a third column with the frequency (normally value after x character)::
+
+
+    >seq_1_x4
+    CACCGCTGTCGGGGAACCGCGCCAATTT
+
+
+Add `-pre` if you want also sequences that map to the precursor but outside the mature miRNA
+
+
+* Parameter `-sub`: mismatches allowed (0/1)
+* Parameter `-trim`: nucleotides allowed for trimming (max 3)
+* Parameter `-add`: nucleotides allowed for addition (max 3)
+* Parameter `-s`: species (3 letter, human=>hsa)
+* Parameter `-i`: fasta file
+* Parameter `-db`: folder where miRBase files are(one copy at miraligner-1.0/DB folder)
+* Parameter `-o`: prefix for the output files
+* Parameter `-freq`: add frequency of the sequence to the output (just where input is fasta file with name matching this patter: >seq_3_x67)
+* Parameter `-pre`: add sequences mapping to precursors as well
+
+***input***
+
+A fasta/fastq file reads::
+
+    >seq
+    CACCGCTGTCGGGGAACCGCGCCAATTT
+
+or tabular file with counts information::
+
+CACCGCTGTCGGGGAACCGCGCCAATTT 45
+
+***output***
+
+Track file *.mirna.opt: information about the process
+
+Non mapped sequences will be on *.nomap
+
+Header of the *.mirna.out file:
+
+* seq: sequence
+* freq/name: depending on the input this column contains counts (tabular input file) or name (fasta file)
+* mir: miRNA name
+* start: start of the sequence at the precursor
+* end: end of the sequence at the precursor
+* mism: nucleotide substitution position-nucleotide at sequence-nucleotide at precursor
+* addition: nucleotides at 3 end added::
+
+
+    precursor         => cctgtggttagctggttgcatatcc
+    annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
+    sequence add: qTT =>   TGTGGTTAGCTGGTTGCATATTT
+
+
+* tr5: nucleotides at 5 end different from the annonated sequence in miRBase::
+
+
+	precursor 	      => cctgtggttagctggttgcatatcc
+	annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
+	sequence tr5: qCC => CCTGTGGTTAGCTGGTTGCATAT
+	sequence tr5: tTG =>     TGGTTAGCTGGTTGCATAT
+
+
+* tr3: nucleotides at 3 end different from the annotated sequence in miRBase::
+
+
+    precursor         => cctgtggttagctggttgcatatcc
+    annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
+    sequence tr3: qCC =>   TGTGGTTAGCTGGTTGCATATCC
+    sequence tr3: tAT =>   TGTGGTTAGCTGGTTGCAT
+
+* s5: offset nucleotides at the begining of the annotated miRNAs::
+
+
+    precursor         => agcctgtggttagctggttgcatatcc
+    annotated miRNA   =>     TGTGGTTAGCTGGTTGCATAT
+    s5                => AGCCTGTG
+
+
+* s3:offset nucleotides at the ending of the annotated miRNAs::
+ 
+
+    precursor         =>  cctgtggttagctggttgcatatccgc
+    annotated miRNA   =>    TGTGGTTAGCTGGTTGCATAT
+    s3                =>                     ATATCCGC
+
+
+* type: mapped on precursor or miRNA sequences
+* ambiguity: number of different detected precursors
+
+Example::
+
+    seq			miRNA		start	end	mism	tr5	tr3	add	s5	s3	DB amb
+    TGGCTCAGTTCAGCAGGACC    hsa-mir-24-2    50      67      0       qCC     0       0       0       0       precursor 1
+    ACTGCCCTAAGTGCTCCTTCTG  hsa-miR-18a*    47      68      0       0       0       tG      ATCTACTG        CTGGCA  miRNA 1