pyViKO

A Python tool to generate viral knockouts.

What is Pyviko?

pyviko stands for Python viral knockouts. pyviko is a tool for designing molecular cloning protocols in complex viruses or other organisms with overlapping genes. Our manuscript has details and worked examples: Taylor LJ, Strebel K. Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes. BMC Microbiol. 2017 Jan 7;17(1):12..

What is an “overprinted gene”?

An overprinted gene is defined as the extension of one gene's open reading frame into the reading frame of a second gene. A single DNA sequence can code for multiple proteins in different reading frames or by reading in different directions. For more information, see the Wikipedia article on reading frames or this (open access) paper on origins of overprinted genes.

How do I install Pyviko?

Using the python package manager:

pip install pyviko

Otherwise, you can install it directly using setup.py:

python `setup.py` install

(What is setup.py?)

Web interface

The basic workflow is available as a web-based JavaScript user interface. See the Quick-start guide (pdf) for more information on using the web interface.

How do I use Pyviko?

Here's a simple example:

>>> from pyviko import mutation
>>> m = mutation.Mutant(        "ATGCATCCCTCAAGTGACTAA")
>>> m.set_over_gene(over_seq = "ATGTATGCATCCCTCAAGTGA")
>>> m.find_mutants()
[(0, 'ACG'), (3, 'TAA'), (3, 'TGA')]

Sample scripts and scripts used in the manuscript can be found in scripts/. Documentation for pyviko is also available.