Skip to content

issues Search Results · repo:lh3/bwa language:C

Filter by

313 results
 (61 ms)

313 results

inlh3/bwa (press backspace or delete to remove)

lh3/bwa
Error: cannot execute binary file

Hi all, I am new to bioinformatics and to this community so I apologise in the advance if the way I write things are vague/not clear or if I miss out on some important details. (or if I ask naive/stupid ...
  • ftwtp1
  • 1
  • Opened 
    3 days ago
  • #443

lh3/bwa
BWA header output doesn't put `@HD` on first line

According to the SAM spec the @HD record should, if present, be on the first line of the SAM file. BWA SAM output has this line, but outputs it after the @SQ lines. @HD File-level metadata. Optional. ...
  • veldsla
  • 5
  • Opened 
    17 days ago
  • #442

lh3/bwa
How to set penalty score for specific mismatching?

When there are mismatchs for C to G and T to A, I want to set the penalty score as zero. In other words, I dont want to penalize mismatchings of C to G and T to A. Is it possible to do this with BWA?
  • lzj1769
  • 1
  • Opened 
    17 days ago
  • #441

lh3/bwa
[E::bwa_idx_load_from_disk] fail to locate the index files

Hello! May I have a question about bwa mem. After running: $ bwa index -p G3ai assembly.fasta I run: $ bwa mem -t 12 index read_1.fq.gz read_2fq.gz 3ai.sam There is an error: [E::bwa_idx_load_from_disk] ...
  • Lucy0309
  • Opened 
    on Jan 25
  • #440

lh3/bwa
BWA-MEM2 for repetitive regions

Hi, I have 150 PE Illumina reads that I d like to map to whole yeast genome including repetitive subtelomere regions. Would you suggest I use BWA-MEM2 or minimap2 for such applications? Thanks
  • rmayang28
  • 1
  • Opened 
    on Dec 3, 2024
  • #437

lh3/bwa
bwa index of 300GB multifasta fails at bwt2sa stage without error

I have downloaded several thousand genomes from RefSeq into a multifasta file and I want to index it. The file is ~300GB. When I run nohup bwa index -b 100000000 combined_sequences.fna bwa_indexing.log ...
  • hazmup
  • 3
  • Opened 
    on Oct 10, 2024
  • #436

lh3/bwa
one end of paired end reads disappeared in the aligned BAM file

Hi, I use bwa to align paired-end reads to the reference genome. There are some cases, when the reads are labeled as paired alignment, and in the BAM file, only one end of the read can be found. When ...
  • sotuamax
  • 1
  • Opened 
    on Oct 4, 2024
  • #435

lh3/bwa
After running make，I did not see ref.fa

After running make, there were no errors, but I did not see ref.fa. Do I need to download ref.fa from somewhere else? [root@localhost bwa]# make gcc -c -g -Wall -Wno-unused-function -O2 -DHAVE_PTHREAD ...
  • tudousiZzz
  • 1
  • Opened 
    on Sep 16, 2024
  • #434

lh3/bwa
Sequence mapping only when complement

Version: 0.7.18-r1243-dirty I am having a mysterious issue at hand. Have a sequence that only mapps when complemented: @norm TTCCATTGTACACGTTGTGGTTACAGACATGGGTTAACTCAACTCAT + JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ ...
  • 7PintsOfCherryGarcia
  • Opened 
    on Sep 11, 2024
  • #433

lh3/bwa
No matching manifest for linux/arm64/v8 in the manifest list entries

Dear developer I using macbook pro M1. I instaled Docker and pull bwa with command docker pull staphb/bwa . So in terminal showed: no matching manifest for linux/arm64/v8 in the manifest list entries ...
  • DrDinhLuong
  • 1
  • Opened 
    on Aug 28, 2024
  • #432
Issue origami icon

Learn how you can use GitHub Issues to plan and track your work.

Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub Issues
ProTip! 
Restrict your search to the title by using the in:title qualifier.
Issue origami icon

Learn how you can use GitHub Issues to plan and track your work.

Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub Issues
ProTip! 
Restrict your search to the title by using the in:title qualifier.
Issue search results · GitHub