Skip to content

jyesselm/rna_lib_design

Repository files navigation

rna_lib_design

formatting: black install with conda

This is package is the library design tool for the Yesselman Lab (https://yesselmanlab.com/). This tool takes a set of RNA sequences and finalizes them so they can be ordered from IDT, agilent or Twist or others. There are options to add unique barcodes to increase the diversity of libraries. There are also several checks to stop ordering libraries that will not work.

All libraries are assumed to be RNA and a T7 promoter (TTCTAATACGACTCACTA) will be added to the 5' end of each sequence. So that the library will be able to be transcribed into RNA

how to install

It is highly recommended to install with requirements in a conda environment

conda create --name py3 python=3.8
conda activate py3 

This package is not meant to be on pypi atm so the option is local install

git clone https://github.com/jyesselm/rna_lib_design.git
cd rna_lib_design
pip install .

This will create a executable in your path called rld

how to use

the rld command line tool has 5 sub commands. list barcode barcode2 add-common and edit-distance

rld --help

Usage: rld [OPTIONS] COMMAND [ARGS]...

  This is a simple tool to generate barcodes for a library of RNAs to be ordered
  as an DNA oligo library.

Options:
  --help  Show this message and exit.

Commands:
  add-common     add common p5/p3 sequences
  barcode        adds a single barcode
  barcode2       adds two barcodes
  edit-distance  compute edit distance of library
  list           lists resources available

list displays the available barcodes and common sequences that can be used in the other sub commands edit-distance will compute the edit distance of the library

The other sub commands are different methods of finalizing RNA libraries so they can be ordered as DNA oligo pools.

understanding input

All libraries should be supplied as csvs. Lets start with a simple example such as

$ cat test/resources/libs/simple.csv

sequence
GGGGGGAAAACCCCCC
CCAAAACCCCUUUUGG

understanding the parameter file

All parameters to be used by each sub command is are stored in parameter files. You can see all of these files in the rna_lib_design/resources/presets directory. The parameters are stored in a yaml file. These parameters are validated by the jsonschema package. The schema for the parameters is stored in rna_lib_design/resources/schemas/.

Here is a breakdown of the parameters.

build_str

The build string defines what segments of RNA are we going to add to each sequence. For example.

build_str: P5-P5EXT-SOI-P3EXT-P3

Each build string MUST contain SOI or sequence of interest. All other are optional but if they appear in the build string they must also be included in segments which we will discuss in a second. The position of each segment in the build string is important. The order of the segments will be the order they are added to the sequence of interest. So for this build string the segment of P5EXT will be added immediately to the 5' end of SOI and P3EXT will be added immediately to the 3' end of SOI. P5 will be added to the 5' end after P5EXT and etc.

segments

Each named segment in the build_str must be defined in another section called segments here each name must have its own parameters defined. There are many possibilites. using the name option defines a set sequence that will be added to each sequence of interest in the library. You can see the corresponding values foreahc name in the rna_lib_design/resources/named_eqs directory.

segments:
  P5:
    name: "uucg_p5_rev_primer"
  P3:
    name: "rt_tail"
  P3EXT:
    sequence: "AC"
    structure: ".."
  P5EXT:
    sequence: ""
    structure: ""

We will use this file as an example for the rest of the documentation.

adding commmon sequences

The add-common sub command will add 5' and 3' sequences to each sequence in a csv file.

rld add-common --help

Usage: rld add-common [OPTIONS] CSV

  add common p5/p3 sequences

Main options:
  These are the main options for generating a library
  -t, --btype TEXT             what type of barcode to use see full list in
                               resources/presets
  --param-file PATH            supply a new param file to override specific
                               present or to manuallydetermine each option
  -o, --output TEXT            the path to save results to
  -p, --num-processes INTEGER  number of processes to run simultaneously
  --debug                      turn on debug logging for the application
  --skip-edit-dist             skip the edit distance calculation
  --trim-p5 INTEGER            trim sequence at 5' end by this length
  --trim-p3 INTEGER            trim sequence at 3' end by this length

Other options:
  --help                       Show this message and exit.

examples

Lets add the standard p5/p3 sequences to our simple library. If no additional options are supplied the standard preset will be used. The standard preset is defined in rna_lib_design/resources/presets/add_common_standard.yml and can be overridden with the --param-file option.

All the parameters are displayed in the log output. Every single one can be changed. The parameters are stored in a yaml file and can be edited by hand. The parameters are also stored in the results directory for future reference.

$ rld add-common test/resources/libs/simple.csv 

INFO     RLD.CLI      Using csv: test/resources/libs/simple.csv
INFO     RLD.CLI      Using output dir: results
INFO     RLD.CLI      Copying test/resources/libs/simple.csv to results/input.csv
INFO     RLD.CLI      csv has 2 sequences
INFO     RLD.CLI      Writing parameters to results/params.yml
INFO     RLD.CLI      No preset or param file supplied, using standard preset
INFO     RLD.CLI      Using parameters:
{
    "build_str": "P5-P5EXT-SOI-P3EXT-P3",
    "segments": {
        "P5": {
            "name": "uucg_p5_rev_primer"
        },
        "P3": {
            "name": "rt_tail"
        },
        "P3EXT": {
            "sequence": "AC",
            "structure": ".."
        },
        "P5EXT": {
            "sequence": "",
            "structure": ""
        }
    },
    "design_opts": {
        "increase_ens_defect": 2.0,
        "max_ens_defect": 5.0,
        "max_attempts": 10,
        "max_solutions": 10,
        "score_method": "increase",
        "allowed_ss_mismatch": 2,
        "allowed_ss_mismatch_barcodes": 2
    }
}
INFO     RLD.DESIGN   starting design
INFO     RLD.DESIGN   no 'name' column was in dataframe - adding one
INFO     RLD.DESIGN   running on single core
INFO     RLD.DESIGN   no 'structure' column folding it now
INFO     RLD.SSET     P5 is using a named sequence/structure: uucg_p5_rev_primer
INFO     RLD.SSET     P5 -> SequenceStructure(sequence='GGAACAGCACUUCGGUGCAAA', structure='......((((....))))...')
INFO     RLD.SSET     P3 is using a named sequence/structure: rt_tail
INFO     RLD.SSET     P3 -> SequenceStructure(sequence='AAAGAAACAACAACAACAAC', structure='....................')
INFO     RLD.CLI      no sequences discarded
INFO     RLD.DESIGN   results/results-all.csv contains all information generated from run
INFO     RLD.DESIGN   results/results-rna.csv contains only information related to the RNA sequence
INFO     RLD.DESIGN   p5 seq -> SequenceInfo(name='uucg_p5_rev_primer', sequence='GGAACAGCACUUCGGUGCAAA', code='P0058')
INFO     RLD.CLI      the edit distance of lib is: 12.0

things todo

get docker working for automated testing allow vienna rna to be installed from source so it works on all operating systems new types of barcodes? triple barcoding? double barcodes with single strands?

About

No description, website, or topics provided.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published