Merge pull request #436 from VerisimilitudeX/deepsource-transform-03b…

…747b7

style: format code with Autopep8 and Google Java Format

src/main/java/DNAnalyzer/core/ApiKeyService.java

@@ -5,10 +5,7 @@
 import org.springframework.beans.factory.annotation.Value;
 import org.springframework.stereotype.Service;
 
-/**
- * The purpose of this service is to handle all operations concerning the OpenAI
- * API key.
- */
+/** The purpose of this service is to handle all operations concerning the OpenAI API key. */
 @Service
 public class ApiKeyService implements GetApiKeyUseCase, SetApiKeyUseCase {
 

src/main/java/DNAnalyzer/core/DNAAnalysis.java

@@ -27,8 +27,8 @@
 /**
  * Provides functionality to analyze the DNA
  *
- * @param dna       the DNA to be analyzed
- * @param protein   the DNA sequence
+ * @param dna the DNA to be analyzed
+ * @param protein the DNA sequence
  * @param aminoAcid name of amino acid
  */
 public record DNAAnalysis(DNATools dna, String protein, String aminoAcid) {
@@ -80,7 +80,8 @@ public DNAAnalysis printHighCoverageRegions(PrintStream out) {
   public void configureReadingFrames(final int minCount, final int maxCount, PrintStream out) {
     final short READING_FRAME = 1;
     final String dna = this.dna.getDna();
-    final ReadingFrames aap = new ReadingFrames(new CodonFrame(dna, READING_FRAME, minCount, maxCount));
+    final ReadingFrames aap =
+        new ReadingFrames(new CodonFrame(dna, READING_FRAME, minCount, maxCount));
     out.print("\n");
     aap.printCodonCounts(out);
   }
@@ -118,19 +119,13 @@ private List<String> getProteins(final String aminoAcid) {
   }
 
   /**
-   * countBasePairsStream returns total counts of each DNA base pair found in the
-   * provided String.
+   * countBasePairsStream returns total counts of each DNA base pair found in the provided String.
    *
-   * @param dnaString String of DNA bases. Accepts lowercase and uppercase
-   *                  Strings.
-   * @return returns an array of long(primitive type). long[0] = count of ADENINE
-   *         bases long[1] =
-   *         count of THYMINE bases long[2] = count of GUANINE bases long[3] =
-   *         count of CYTOSINE bases
-   *         <p>
-   *         Constants for the indices can be found in public static class
-   *         {@link BasePairIndex} for
-   *         convenience/consistency.
+   * @param dnaString String of DNA bases. Accepts lowercase and uppercase Strings.
+   * @return returns an array of long(primitive type). long[0] = count of ADENINE bases long[1] =
+   *     count of THYMINE bases long[2] = count of GUANINE bases long[3] = count of CYTOSINE bases
+   *     <p>Constants for the indices can be found in public static class {@link BasePairIndex} for
+   *     convenience/consistency.
    */
   public static long[] countBasePairs(String dnaString) {
     return new BasePairCounter(dnaString)
@@ -156,8 +151,7 @@ public static class BasePairIndex {
   }
 
   /**
-   * Constants to obtain the corresponding ASCII int values for letters used to
-   * represent DNA bases.
+   * Constants to obtain the corresponding ASCII int values for letters used to represent DNA bases.
    */
   public static class AsciiInt {
 

src/main/java/DNAnalyzer/core/Properties.java

@@ -43,7 +43,7 @@ public static String getVersion() {
    * Prints the list of proteins found in the DNA.
    *
    * @param proteinList The list of proteins to be printed
-   * @param aminoAcid   The amino acid to be searched for {@code @category} Output
+   * @param aminoAcid The amino acid to be searched for {@code @category} Output
    */
   public static void printProteinList(
       final List<String> proteinList, final String aminoAcid, PrintStream out) {
@@ -68,12 +68,11 @@ public static void printProteinList(
    * @return The GC content of the DNA sequence
    * @category Properties
    * @see
-   *      "https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/gc-content"
+   *     "https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/gc-content"
    */
   public static float getGCContent(String dna) {
     float gcContent = 0;
-    if (dna.length() == 0)
-      return gcContent;
+    if (dna.length() == 0) return gcContent;
 
     dna = dna.toLowerCase();
     float gcLen = (float) calculateLengthOfCG(dna);
@@ -83,8 +82,7 @@ public static float getGCContent(String dna) {
   }
 
   /**
-   * Calculate the total number of characters that are 'g' or 'c' of a given DNA
-   * String
+   * Calculate the total number of characters that are 'g' or 'c' of a given DNA String
    *
    * @param dna The DNA sequence that was analyzed
    * @category Property
@@ -162,25 +160,26 @@ public static void printNucleotideCount(final String dna, PrintStream out) {
    * Checks if the DNA sequence is random or not.
    *
    * @param dna The DNA sequence that was analyzed
-   * @return Whether the DNA sequence is random or not {@code @category}
-   *         Properties
+   * @return Whether the DNA sequence is random or not {@code @category} Properties
    */
   public static boolean isRandomDNA(final String dna) {
     long[] nucleotideCount = countBasePairs(dna);
-    int[] percentages = Arrays.stream(nucleotideCount).mapToInt(c -> nucleotidePercentage(c, dna)).toArray();
+    int[] percentages =
+        Arrays.stream(nucleotideCount).mapToInt(c -> nucleotidePercentage(c, dna)).toArray();
 
     int a = percentages[BasePairIndex.ADENINE];
     int t = percentages[BasePairIndex.THYMINE];
     int g = percentages[BasePairIndex.GUANINE];
     int c = percentages[BasePairIndex.CYTOSINE];
 
-    IntStream diffs = IntStream.of(
-        Math.abs(a - t),
-        Math.abs(a - g),
-        Math.abs(a - c),
-        Math.abs(t - g),
-        Math.abs(t - c),
-        Math.abs(g - c));
+    IntStream diffs =
+        IntStream.of(
+            Math.abs(a - t),
+            Math.abs(a - g),
+            Math.abs(a - c),
+            Math.abs(t - g),
+            Math.abs(t - c),
+            Math.abs(g - c));
 
     return diffs.allMatch(diff -> diff <= 2);
   }
@@ -189,7 +188,7 @@ public static boolean isRandomDNA(final String dna) {
    * Calculates the percentage of given amount of nucleotide in the dna sequence/
    *
    * @param nucleotideCount Number of nucleotides (int)
-   * @param dna             DNA sequence
+   * @param dna DNA sequence
    * @return the percentage of nucleotides in that DNA sequence
    */
   private static int nucleotidePercentage(final long nucleotideCount, final String dna) {

src/main/java/DNAnalyzer/data/Parser.java

@@ -21,8 +21,7 @@ private static String parseFasta(File file) throws IOException {
     StringBuilder dna = new StringBuilder();
     while (true) {
       String line = rd.readLine();
-      if (line == null)
-        break;
+      if (line == null) break;
 
       // Extra info
       if (line.startsWith(">")) { // File descriptor
@@ -41,8 +40,7 @@ private static String parseFasta(File file) throws IOException {
       }
       line = line.toLowerCase();
       dna.append(line);
-      if (stop)
-        break;
+      if (stop) break;
     }
 
     rd.close();

src/main/java/DNAnalyzer/data/aminoAcid/AminoAcid.java

@@ -14,8 +14,7 @@
 import java.util.List;
 
 /**
- * AminoAcid enum that represent the amino acid values. Each value can be
- * searched by several
+ * AminoAcid enum that represent the amino acid values. Each value can be searched by several
  * abbreviations.
  */
 public enum AminoAcid {
@@ -55,10 +54,9 @@ public enum AminoAcid {
   private final List<String> codonData;
 
   /**
-   * Constructs an instance of an AminoAcid enum, setting its name and list of
-   * abbreviations.
+   * Constructs an instance of an AminoAcid enum, setting its name and list of abbreviations.
    *
-   * @param fullName      full name of the amino acid.
+   * @param fullName full name of the amino acid.
    * @param abbreviations a list of abbreviations that an acid can be searched by.
    */
   AminoAcid(final String fullName, final List<String> abbreviations, final List<String> codonData) {

src/main/java/DNAnalyzer/data/aminoAcid/AminoAcidFactory.java

@@ -17,8 +17,7 @@
 public class AminoAcidFactory {
 
   /**
-   * Searches for an amino acid by its name or abbreviation passed as the
-   * argument.
+   * Searches for an amino acid by its name or abbreviation passed as the argument.
    *
    * @param aminoAcid amino acid name to search by.
    * @return a {@link AminoAcid} value.

src/main/java/DNAnalyzer/data/codon/CodonDataConstants.java

@@ -23,8 +23,7 @@
  */
 public class CodonDataConstants {
   /** Private CodonDataConstants class constructor to avoid initialization */
-  private CodonDataConstants() {
-  }
+  private CodonDataConstants() {}
 
   // Declares the stop codon data for the 20 amino acids. Note that the stop
   // codons are the same for all amino acids.
@@ -33,7 +32,8 @@ private CodonDataConstants() {
   // Block to put all AminoAcidNames and their respective codon data into an enum
   // map for faster
   // retrieval
-  protected static EnumMap<AminoAcid, List<String>> codonDataAcidMap = new EnumMap<>(AminoAcid.class);
+  protected static EnumMap<AminoAcid, List<String>> codonDataAcidMap =
+      new EnumMap<>(AminoAcid.class);
 
   static {
     for (AminoAcid aminoAcid : AminoAcid.values()) {

src/main/java/DNAnalyzer/data/codon/CodonDataUtils.java

@@ -35,14 +35,12 @@ public static List<String> getAminoAcid(final String name) {
   }
 
   /**
-   * Given a dna string and the index that corresponds to first character of a
-   * codon of interest
-   * within that string, this returns the corresponding string. For example, given
-   * dnaString
+   * Given a dna string and the index that corresponds to first character of a codon of interest
+   * within that string, this returns the corresponding string. For example, given dnaString
    * "gggggaggtggcgaggaagatgac" and index 3, the string "gga" is returned.
    *
    * @param dnaString DNA data
-   * @param index     Index of the first character of the codon
+   * @param index Index of the first character of the codon
    * @return Codon data with first character at index in the dnaString
    */
   public static String returnSubstring(String dnaString, int index) {

src/main/java/DNAnalyzer/data/codon/CodonFrame.java

@@ -65,10 +65,11 @@ public boolean equals(final Object o) {
     if (this == o) {
       result = true;
     } else if (o instanceof final CodonFrame inputFrame) {
-      result = getReadingFrame() == inputFrame.getReadingFrame()
-          && getMin() == inputFrame.getMin()
-          && getMax() == inputFrame.getMax()
-          && getDna().equals(inputFrame.getDna());
+      result =
+          getReadingFrame() == inputFrame.getReadingFrame()
+              && getMin() == inputFrame.getMin()
+              && getMax() == inputFrame.getMax()
+              && getDna().equals(inputFrame.getDna());
     }
     return result;
   }

src/main/java/DNAnalyzer/ui/cli/CmdArgs.java

@@ -30,45 +30,65 @@
  * @author Nishant Vikramaditya (@Nv7-GitHub)
  * @version 1.2.1
  */
-@Command(name = "DNAnalyzer", mixinStandardHelpOptions = true, description = "A program to analyze DNA sequences.")
+@Command(
+    name = "DNAnalyzer",
+    mixinStandardHelpOptions = true,
+    description = "A program to analyze DNA sequences.")
 public class CmdArgs implements Runnable {
-  @Option(names = { "--gui" }, description = "Start in GUI mode")
+  @Option(
+      names = {"--gui"},
+      description = "Start in GUI mode")
   Boolean startGUI = false;
 
-  @Option(names = { "--amino" }, description = "The amino acid representing the start of a gene.")
+  @Option(
+      names = {"--amino"},
+      description = "The amino acid representing the start of a gene.")
   String aminoAcid;
 
-  @Option(names = { "--min" }, description = "The minimum count of the reading frame.")
+  @Option(
+      names = {"--min"},
+      description = "The minimum count of the reading frame.")
   int minCount = 0;
 
-  @Option(names = { "--max" }, description = "The maximum count of the reading frame.")
+  @Option(
+      names = {"--max"},
+      description = "The maximum count of the reading frame.")
   int maxCount = 0;
 
   @Parameters(paramLabel = "DNA", description = "The FASTA file to be analyzed.")
   File dnaFile;
 
-  @Option(names = { "--find" }, description = "The DNA sequence to be found within the FASTA file.")
+  @Option(
+      names = {"--find"},
+      description = "The DNA sequence to be found within the FASTA file.")
   File proteinFile;
 
-  @Option(names = { "--reverse", "-r" }, description = "Reverse the DNA sequence before processing.")
+  @Option(
+      names = {"--reverse", "-r"},
+      description = "Reverse the DNA sequence before processing.")
   boolean reverse;
 
-  @Option(names = { "--help", "-h" }, description = "Prints this help message and exits.", help = true)
+  @Option(
+      names = {"--help", "-h"},
+      description = "Prints this help message and exits.",
+      help = true)
   boolean help;
 
-  @Option(names = { "--version", "-v" }, description = "Prints version information and exits.")
+  @Option(
+      names = {"--version", "-v"},
+      description = "Prints version information and exits.")
   boolean version;
 
-  @Option(names = { "--rcomplement" }, description = "Prints the complement of the DNA sequence.")
+  @Option(
+      names = {"--rcomplement"},
+      description = "Prints the complement of the DNA sequence.")
   boolean rcomplement;
 
   /**
-   * Output a list of proteins, GC content, Nucleotide content, and other
-   * information found in a DNA
+   * Output a list of proteins, GC content, Nucleotide content, and other information found in a DNA
    * sequence.
    *
-   * @throws IllegalArgumentException when the DNA FASTA file contains an invalid
-   *                                  DNA sequence
+   * @throws IllegalArgumentException when the DNA FASTA file contains an invalid DNA sequence
    */
   @Override
   public void run() {
@@ -105,9 +125,8 @@ public void run() {
 
   /**
    * @param aminoAcid representing the start of the gene
-   * @return DnaAnalyzer which provides functions to analyze the dnaFile, protein
-   *         file and supplied
-   *         aminoAcid
+   * @return DnaAnalyzer which provides functions to analyze the dnaFile, protein file and supplied
+   *     aminoAcid
    */
   private DNAAnalysis dnaAnalyzer(final String aminoAcid) {
     try {

src/main/java/DNAnalyzer/ui/gui/DNAnalyzerGUI.java

@@ -29,7 +29,8 @@ public class DNAnalyzerGUI extends Application {
    */
   public void start(Stage stage) throws Exception {
     // Parent root = FXMLLoader.load(getClass().getResource("DNAnalyzerGUI.fxml"));
-    Parent root = FXMLLoader.load(DNAnalyzerGUI.class.getResource("/DNAnalyzer/gui/fxml/DNAnalyzerGUI.fxml"));
+    Parent root =
+        FXMLLoader.load(DNAnalyzerGUI.class.getResource("/DNAnalyzer/gui/fxml/DNAnalyzerGUI.fxml"));
     Scene scene = new Scene(root);
     // scene.getStylesheets().add(getClass().getResource("styles.css").toExternalForm());