-
Notifications
You must be signed in to change notification settings - Fork 3
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #11 from ressy/release-0.0.5
Release 0.0.5
- Loading branch information
Showing
17 changed files
with
1,215 additions
and
40 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1 +1,4 @@ | ||
__pycache__/ | ||
build/ | ||
dist/ | ||
vquest.egg-info/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,28 @@ | ||
# Changelog | ||
|
||
## 0.0.5 - 2021-03-10 | ||
|
||
### Added | ||
|
||
* `--align` argument (via `airr_to_fasta` function) for exraction of sequence | ||
alignment FASTA from AIRR results ([#1]) | ||
* Error messages sent by the server are now raised as an exception containing | ||
the server-provided message(s) ([#7]) | ||
|
||
### Changed | ||
|
||
* Reorganized and expanded test code as its own package ([#6]) | ||
* Added basic test of command-line usage ([#10]) | ||
* Clarified wording on required options ([#8]) | ||
|
||
### Fixed | ||
|
||
* Parse command-line options that should be integers from a finite list of | ||
options as integers instead of strings ([#5]) | ||
|
||
[#10]: https://github.com/ressy/vquest/pull/10 | ||
[#8]: https://github.com/ressy/vquest/pull/8 | ||
[#7]: https://github.com/ressy/vquest/pull/7 | ||
[#6]: https://github.com/ressy/vquest/pull/6 | ||
[#5]: https://github.com/ressy/vquest/pull/5 | ||
[#1]: https://github.com/ressy/vquest/pull/1 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,3 +1,4 @@ | ||
biopython | ||
requests | ||
requests-html | ||
PyYAML |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,9 @@ | ||
species: rhesus-monkey | ||
receptorOrLocusType: IG | ||
v_regionsearchindel: true | ||
sequences: | | ||
>IGKV2-ACR*02 | ||
GACATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCAGCCTCCATCTCCTGCAGGTCTAGTCA | ||
GAGCCTCTTGGATAGTGACGGGTACACCTGTTTGGACTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCT | ||
ATGAGGTTTCCAACCGGGTCTCTGGAGTCCCTGACAGGTTCAGTGGCAGTGGGTCAGNCACTGATTTCACACTGAAAATC | ||
AGCCGGGTGGAAGCTGAGGATGTTGGGGTGTATTACTGTATGCAAAGTATAGAGTTTCCTCC |
File renamed without changes.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
Content-Type text/html |
Oops, something went wrong.