snakemake-bacterial-riboseq

---

A Snakemake workflow for the analysis of bacterial riboseq data.

• snakemake-bacterial-riboseq
  • Usage
  • Workflow overview
  • Installation
  • Running the workflow
    • Input data
      • Reference genome
      • Read data
    • Execution
    • Parameters
  • Authors
  • References

Usage

The usage of this workflow is described in the Snakemake Workflow Catalog.

If you use this workflow in a paper, don't forget to give credits to the authors by citing the URL of this (original) repository and its DOI (see above).

Workflow overview

---

This workflow is a best-practice workflow for the analysis of ribosome footprint sequencing (Ribo-Seq) data. The workflow is built using snakemake and consists of the following steps:

1. Obtain genome database in fasta and gff format (python, NCBI Datasets)
   1. Using automatic download from NCBI with a RefSeq ID
   2. Using user-supplied files
2. Check quality of input sequencing data (FastQC)
3. Cut adapters and filter by length and/or sequencing quality score (cutadapt)
4. Deduplicate reads by unique molecular identifier (UMI, umi_tools)
5. Map reads to the reference genome (STAR aligner)
6. Sort and index for aligned seq data (samtools)
7. Filter reads by feature type (bedtools)
8. Generate summary report for all processing steps (MultiQC)
9. Shift ribo-seq reads according to the ribosome's P-site alignment (R, ORFik)
10. Calculate basic gene-wise statistics such as RPKM (R, ORFik)
11. Return report as HTML and PDF files (R markdown, weasyprint)

If you want to contribute, report issues, or suggest features, please get in touch on github.

Installation

Step 1: Clone this repository

git clone https://github.com/MPUSP/snakemake-bacterial-riboseq.git
cd snakemake-bacterial-riboseq

Step 2: Install dependencies

It is recommended to install snakemake and run the workflow with conda or mamba. Miniforge is the preferred conda-forge installer and includes conda, mamba and their dependencies.

Step 3: Create snakemake environment

This step creates a new conda environment called snakemake-bacterial-riboseq.

# create new environment with dependencies & activate it
mamba create -c conda-forge -c bioconda -n snakemake-bacterial-riboseq snakemake pandas
conda activate snakemake-bacterial-riboseq

Note:

All other dependencies for the workflow are automatically pulled as conda environments by snakemake, when running the workflow with the --use-conda parameter (recommended).

Running the workflow

Input data

Reference genome

An NCBI Refseq ID, e.g. GCF_000006945.2. Find your genome assembly and corresponding ID on NCBI genomes. Alternatively use a custom pair of *.fasta file and *.gff file that describe the genome of choice.

Important requirements when using custom *.fasta and *.gff files:

• *.gff genome annotation must have the same chromosome/region name as the *.fasta file (example: NC_003197.2)
• *.gff genome annotation must have gene and CDS type annotation that is automatically parsed to extract transcripts
• all chromosomes/regions in the *.gff genome annotation must be present in the *.fasta sequence
• but not all sequences in the *.fasta file need to have annotated genes in the *.gff file

Read data

Ribosome footprint sequencing data in *.fastq.gz format. The currently supported input data are single-end, strand-specific reads. Input data files are supplied via a mandatory table, whose location is indicated in the config.yml file (default: samples.tsv). The sample sheet has the following layout:

sample	condition	replicate	data_folder	fq1
RPF-RTP1	RPF-RTP	1	data	RPF-RTP1_R1_001.fastq.gz
RPF-RTP2	RPF-RTP	2	data	RPF-RTP2_R1_001.fastq.gz

Some configuration parameters of the pipeline may be specific for your data and library preparation protocol. The options should be adjusted in the config.yml file. For example:

• Minimum and maximum read length after adapter removal (see option cutadapt: default). Here, the test data has a minimum read length of 15 + 7 = 22 (2 nt on 5'end + 5 nt on 3'end), and a maximum of 45 + 7 = 52.
• Unique molecular identifiers (UMIs). For example, the protocol by McGlincy & Ingolia, 2017 creates a UMI that is located on both the 5'-end (2 nt) and the 3'-end (5 nt). These UMIs are extracted with umi_tools (see options umi_extraction: method and pattern).

Example configuration files for different sequencing protocols can be found in resources/protocols/.

Execution

To run the workflow from command line, change the working directory.

cd path/to/snakemake-bacterial-riboseq

Adjust options in the default config file config/config.yml. Before running the entire workflow, you can perform a dry run using:

snakemake --dry-run

To run the complete workflow with test files using conda, execute the following command. The definition of the number of compute cores is mandatory.

snakemake --cores 10 --sdm conda --directory .test

To run the workflow with singularity / apptainer, use:

snakemake --cores 10 --sdm conda apptainer --directory .test

Parameters

This table lists all parameters that can be used to run the workflow.

parameter	type	details	default
samplesheet
path	str	path to samplesheet, mandatory	"config/samples.tsv"
get_genome
database	str	one of manual, ncbi	ncbi
assembly	str	RefSeq ID	GCF_000006785.2
fasta	str	optional path to fasta file	Null
gff	str	optional path to gff file	Null
gff_source_type	str	list of name/value pairs for GFF source	see config file
cutadapt
fivep_adapter	str	sequence of the 5' adapter	Null
threep_adapter	str	sequence of the 3' adapter	ATCGTAGATCGGAAGAGCACACGTCTGAA
default	str	additional options passed to cutadapt	[-q 10 , -m 22 , -M 52, --overlap=3]
umi_extraction
method	str	one of string or regex, see manual	regex
pattern	str	string or regular expression	^(?P<umi_0>.{5}).*(?P<umi_1>.{2})$
umi_dedup
options	str	default options for deduplication	see config file
star
index	str	location of genome index; if Null, is made	Null
genomeSAindexNbases	num	length of pre-indexing string, see STAR man	9
multi	num	max number of loci read is allowed to map	10
sam_multi	num	max number of alignments reported for read	1
intron_max	num	max length of intron; 0 = automatic choice	1
default	str	default options for STAR aligner	see config file
extract_features
biotypes	str	biotypes to exclude from mapping	[rRNA, tRNA]
CDS	str	CDS type to include for mapping	[protein_coding]
bedtools_intersect
defaults	str	remove hits, sense strand, min overlap 20%	[-v , -s , -f 0.2]
annotate_orfs
window_size	num	size of 5'-UTR added to CDS	30
shift_reads
window_size	num	start codon window to determine shift	30
read_length	num	size range of reads to use for shifting	[27, 45]
end_alignment	str	end used for alignment of RiboSeq reads	3prime
shift_table	str	optional table with offsets per read length	Null
export_bigwig	str	export shifted reads as bam file	True
export_ofst	str	export shifted reads as ofst file	False
skip_shifting	str	skip read shifting entirely	False
skip_length_filter	str	skip filtering reads by length	False
multiqc
config	str	path to multiqc config	config/multiqc_config.yml
report
export_figures	bool	export figures as .svg and .png	True
export_dir	str	sub-directory for figure export	figures/
figure_width	num	standard figure width in px	875
figure_height	num	standard figure height in px	500
figure_resolution	num	standard figure resolution in dpi	125

Authors

• Dr. Rina Ahmed-Begrich
  • Affiliation: Max-Planck-Unit for the Science of Pathogens (MPUSP), Berlin, Germany
  • ORCID profile: https://orcid.org/0000-0002-0656-1795
• Dr. Michael Jahn
  • Affiliation: Max-Planck-Unit for the Science of Pathogens (MPUSP), Berlin, Germany
  • ORCID profile: https://orcid.org/0000-0002-3913-153X
  • github page: https://github.com/m-jahn

Visit the MPUSP github page at https://github.com/MPUSP for more info on this workflow and other projects.

References

• Essential tools are linked in the top section of this document
• The sequencing library preparation is based on the publication:

McGlincy, N. J., & Ingolia, N. T. Transcriptome-wide measurement of translation by ribosome profiling. Methods, 126, 112–129, 2017. https://doi.org/10.1016/J.YMETH.2017.05.028.