Skip to content

Latest commit

 

History

History
92 lines (63 loc) · 2.95 KB

Overlapper.md

File metadata and controls

92 lines (63 loc) · 2.95 KB
Raw

Followed Methods in this paper

  • download for bbmerge:
  • paper for bbmerge: BBMerge – Accurate paired shotgun read merging via overlap

Synthetic data

  1. Dowload the data:

  1. Produce indexed reference sequence

    ./../tools/bbmap/bbmap.sh ref=chlamy_reference.fasta.qz

  2. Generate Synthetic Reads

    ./../tools/bbmap/randomreads.sh reads=20m out=synth20m.fq.gz len=150 paired int pigz=32 zl=6 minq=14 midq=24 maxq=34 qv=6 adderrors=t nrate=0.00 maxns=2 maxnlen=8 ow mininsert=100 maxinsert=400 gaussian overlap=150 banns fragadapter=GACGCTGCCGACGAATAGAGAGGTGTAGATCTCGGTGGTCGCCGTATCATT fragadapter2=CCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG

  3. Rename read headers to know their insert size to allow for subsequent grading

    ./../tools/bbmap/rename.sh in=synth20m.fq.gz out=renamed20m.fq.gz renamebyinsert int

  4. Reformat and store:

    ./../tools/bbmap/reformat.sh in=renamed20m.fq.gz out=/share/biocore/keith/benchmarking/data/r#.fq

Real Shotgun Data

  1. Download the data:

  1. Index the reference genomes

    ./..tools/bbmap/bbmap.sh ref=mock_ref.fa

  2. shotgun metagenome reads were mapped to reference sequences to a) determine insert sizes, and b) to remove reads that mapped with indels or that did not map in a properly paired orientation

    ./..tools/bbmap/bbmap.sh in=mock_raw.fq.gz outm=mapped_renamed_noindels.fq.gz ow po indelfilter=0 renamebyinsert maxindel=20 minid=0.75

  3. The remaining shotgun metagenome reads were subsampled to 20 million read pairs

    ./..tools/bbmap/reformat.sh in=clean.fq.gz out=20m.fq.gz srt=20m

THIS IS WHERE TOOLS ARE RUN?

bbmerge.sh in=r#.fq out=merged_bbmerge.fq adapters=adapters.fa t=32
bbmerge-auto.sh in=r#.fq out=merged_bbmerge_rem.fq adapters=adapters.fa  t=32 rem k=62
bbmerge-auto.sh in=r#.fq out=merged_bbmerge_rsem.fq adapters=adapters.fa  t=32 rsem k=62
fastq-join -p 8 r1.fq r2.fq -o merged_fqj%.fq
flash -t 32 -x 0.25 -M 200 r1.fq r2.fq
hts_overlapper ....

  1. Grading performed using grade merge

    ./..tools/bbmap/grademerge.sh in=merged.fq

  2. Assembly quality was evaluated using raw shotgun metagenomic reads from MBARC-26 subsampled to 20 million read pairs

    ./..tools/bbmap/reformat.sh in = mock_raw.fq.gz out = r#.fq srt = 20m

Not needed yet?

  1. Reads were merged with each tool, then both the merged and unmerged output was passed to SPAdes v. 3.8.2 for assembly in metagenome mode

    spades.py—meta -k25,55,95,125—phred-offset 33 -s merged.fq -1 unmerged1.fq -2 unmerged2.fq -o spades_out

  2. Assembled contigs were compared to the metagenome reference using QUAST v. 4.2 for evaluation

    quast.py -o quast_out -R mock_ref.fa -f spades_*/contigs.fasta