diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json index 4ecfbfe33..b290e0901 100644 --- a/.devcontainer/devcontainer.json +++ b/.devcontainer/devcontainer.json @@ -10,15 +10,7 @@ "vscode": { // Set *default* container specific settings.json values on container create. "settings": { - "python.defaultInterpreterPath": "/opt/conda/bin/python", - "python.linting.enabled": true, - "python.linting.pylintEnabled": true, - "python.formatting.autopep8Path": "/opt/conda/bin/autopep8", - "python.formatting.yapfPath": "/opt/conda/bin/yapf", - "python.linting.flake8Path": "/opt/conda/bin/flake8", - "python.linting.pycodestylePath": "/opt/conda/bin/pycodestyle", - "python.linting.pydocstylePath": "/opt/conda/bin/pydocstyle", - "python.linting.pylintPath": "/opt/conda/bin/pylint" + "python.defaultInterpreterPath": "/opt/conda/bin/python" }, // Add the IDs of extensions you want installed when the container is created. diff --git a/.editorconfig b/.editorconfig index 9b990088a..dd9ffa538 100644 --- a/.editorconfig +++ b/.editorconfig @@ -18,7 +18,12 @@ end_of_line = unset insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset -indent_size = unset +[/subworkflows/nf-core/**] +charset = unset +end_of_line = unset +insert_final_newline = unset +trim_trailing_whitespace = unset +indent_style = unset [/assets/email*] indent_size = unset @@ -28,5 +33,5 @@ indent_size = unset indent_style = unset # ignore python -[*.{py}] +[*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index e5e7a3d59..325766675 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -9,9 +9,8 @@ Please use the pre-filled template to save time. However, don't be put off by this template - other more general issues and suggestions are welcome! Contributions to the code are even more welcome ;) -:::info -If you need help using or modifying nf-core/ampliseq then the best place to ask is on the nf-core Slack [#ampliseq](https://nfcore.slack.com/channels/ampliseq) channel ([join our Slack here](https://nf-co.re/join/slack)). -::: +> [!NOTE] +> If you need help using or modifying nf-core/ampliseq then the best place to ask is on the nf-core Slack [#ampliseq](https://nfcore.slack.com/channels/ampliseq) channel ([join our Slack here](https://nf-co.re/join/slack)). ## Contribution workflow @@ -27,8 +26,11 @@ If you're not used to this workflow with git, you can start with some [docs from ## Tests -You can optionally test your changes by running the pipeline locally. Then it is recommended to use the `debug` profile to -receive warnings about process selectors and other debug info. Example: `nextflow run . -profile debug,test,docker --outdir `. +You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. Execute all the tests with the following command: + +```bash +nf-test test --profile debug,test,docker --verbose +``` When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests. Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then. @@ -90,7 +92,7 @@ Once there, use `nf-core schema build` to add to `nextflow_schema.json`. Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. -The process resources can be passed on to the tool dynamically within the process with the `${task.cpu}` and `${task.memory}` variables in the `script:` block. +The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. ### Naming schemes diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index ada206f79..f730bdaa3 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -18,7 +18,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/ampl - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/ampliseq/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/ampliseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core lint`). -- [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). +- [ ] Ensure the test suite passes (`nf-test test main.nf.test -profile test,docker`). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. - [ ] Output Documentation in `docs/output.md` is updated. diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index edae2a083..3758ac095 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -19,7 +19,7 @@ jobs: # NOTE - this doesn't currently work if the PR is coming from a fork, due to limitations in GitHub actions secrets - name: Post PR comment if: failure() - uses: mshick/add-pr-comment@v2 + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 with: message: | ## This PR is against the `master` branch :x: diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 45389f8f3..513b282ec 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -63,7 +63,7 @@ jobs: steps: - name: Check out pipeline code - uses: actions/checkout@v4 + uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Check out test data uses: actions/checkout@v3 @@ -87,6 +87,9 @@ jobs: with: version: "${{ matrix.NXF_VER }}" + - name: Disk space cleanup + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + - name: Install nf-test run: | wget -qO- https://code.askimed.com/install/nf-test | bash -s $NFTEST_VER diff --git a/.github/workflows/clean-up.yml b/.github/workflows/clean-up.yml index e37cfda5c..0b6b1f272 100644 --- a/.github/workflows/clean-up.yml +++ b/.github/workflows/clean-up.yml @@ -10,7 +10,7 @@ jobs: issues: write pull-requests: write steps: - - uses: actions/stale@v9 + - uses: actions/stale@28ca1036281a5e5922ead5184a1bbf96e5fc984e # v9 with: stale-issue-message: "This issue has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment otherwise this issue will be closed in 20 days." stale-pr-message: "This PR has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment if it is still useful." diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 8a3300450..08622fd51 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -6,6 +6,11 @@ name: Test successful pipeline download with 'nf-core download' # - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev. on: workflow_dispatch: + inputs: + testbranch: + description: "The specific branch you wish to utilize for the test execution of nf-core download." + required: true + default: "dev" pull_request: types: - opened @@ -25,11 +30,11 @@ jobs: - name: Install Nextflow uses: nf-core/setup-nextflow@v1 - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.11" architecture: "x64" - - uses: eWaterCycle/setup-singularity@v7 + - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 with: singularity-version: 3.8.3 @@ -42,13 +47,13 @@ jobs: run: | echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> ${GITHUB_ENV} echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} - echo "REPO_BRANCH=${GITHUB_REF#refs/heads/}" >> ${GITHUB_ENV} + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} - name: Download the pipeline env: NXF_SINGULARITY_CACHEDIR: ./ run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 81cd098e9..073e18767 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -14,10 +14,10 @@ jobs: pre-commit: runs-on: ubuntu-latest steps: - - uses: actions/checkout@v4 + - uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Set up Python 3.11 - uses: actions/setup-python@v5 + uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: 3.11 cache: "pip" @@ -32,12 +32,12 @@ jobs: runs-on: ubuntu-latest steps: - name: Check out pipeline code - uses: actions/checkout@v4 + uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4 - name: Install Nextflow uses: nf-core/setup-nextflow@v1 - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.11" architecture: "x64" @@ -60,7 +60,7 @@ jobs: - name: Upload linting log file artifact if: ${{ always() }} - uses: actions/upload-artifact@v4 + uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4 with: name: linting-logs path: | diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 147bcd10c..b706875fc 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@v3 + uses: dawidd6/action-download-artifact@f6b0bace624032e30a85a8fd9c1a7f8f611f5737 # v3 with: workflow: linting.yml workflow_conclusion: completed @@ -21,7 +21,7 @@ jobs: run: echo "pr_number=$(cat linting-logs/PR_number.txt)" >> $GITHUB_OUTPUT - name: Post PR comment - uses: marocchino/sticky-pull-request-comment@v2 + uses: marocchino/sticky-pull-request-comment@331f8f5b4215f0445d3c07b4967662a32a2d3e31 # v2 with: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} number: ${{ steps.pr_number.outputs.pr_number }} diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 21ac3f068..d468aeaae 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -9,6 +9,11 @@ jobs: toot: runs-on: ubuntu-latest steps: + - name: get topics and convert to hashtags + id: get_topics + run: | + curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ' >> $GITHUB_OUTPUT + - uses: rzr/fediverse-action@master with: access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} @@ -20,11 +25,13 @@ jobs: Please see the changelog: ${{ github.event.release.html_url }} + ${{ steps.get_topics.outputs.GITHUB_OUTPUT }} #nfcore #openscience #nextflow #bioinformatics + send-tweet: runs-on: ubuntu-latest steps: - - uses: actions/setup-python@v5 + - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5 with: python-version: "3.10" - name: Install dependencies @@ -56,7 +63,7 @@ jobs: bsky-post: runs-on: ubuntu-latest steps: - - uses: zentered/bluesky-post-action@v0.1.0 + - uses: zentered/bluesky-post-action@80dbe0a7697de18c15ad22f4619919ceb5ccf597 # v0.1.0 with: post: | Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! diff --git a/.gitpod.yml b/.gitpod.yml index 363d5b1d4..105a1821a 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -10,13 +10,11 @@ tasks: vscode: extensions: # based on nf-core.nf-core-extensionpack - - codezombiech.gitignore # Language support for .gitignore files - # - cssho.vscode-svgviewer # SVG viewer - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - - eamodio.gitlens # Quickly glimpse into whom, why, and when a line or code block was changed - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + # - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code + - charliermarsh.ruff # Code linter Ruff diff --git a/CHANGELOG.md b/CHANGELOG.md index e0a2b0277..bdab84a5c 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -14,7 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` -- [#697](https://github.com/nf-core/ampliseq/pull/697),[#699](https://github.com/nf-core/ampliseq/pull/699) - Template update for nf-core/tools version 2.12 +- [#697](https://github.com/nf-core/ampliseq/pull/697),[#699](https://github.com/nf-core/ampliseq/pull/699),[#713](https://github.com/nf-core/ampliseq/pull/713) - Template update for nf-core/tools version 2.13.1 ### `Dependencies` diff --git a/README.md b/README.md index 85c3c6870..b250eb198 100644 --- a/README.md +++ b/README.md @@ -5,17 +5,16 @@ -[![GitHub Actions CI Status](https://github.com/nf-core/ampliseq/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/ampliseq/actions?query=workflow%3A%22nf-core+CI%22) -[![GitHub Actions Linting Status](https://github.com/nf-core/ampliseq/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/ampliseq/actions?query=workflow%3A%22nf-core+linting%22) -[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/ampliseq/results) -[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.1493841-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.1493841) -[![Cite Publication](https://img.shields.io/badge/Cite%20Us!-Cite%20Publication-important?labelColor=000000)](https://doi.org/10.3389/fmicb.2020.550420) +[![GitHub Actions CI Status](https://github.com/nf-core/ampliseq/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/ampliseq/actions/workflows/ci.yml) +[![GitHub Actions Linting Status](https://github.com/nf-core/ampliseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/ampliseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/ampliseq/results)[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) + +[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.1493841-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.1493841)[![Cite Publication](https://img.shields.io/badge/Cite%20Us!-Cite%20Publication-important?labelColor=000000)](https://doi.org/10.3389/fmicb.2020.550420) [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg?labelColor=000000)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) -[![Launch on Nextflow Tower](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Nextflow%20Tower-%234256e7?labelColor=000000)](https://tower.nf/launch?pipeline=https://github.com/nf-core/ampliseq) +[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/nf-core/ampliseq) [![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23ampliseq-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/ampliseq)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)[![Watch on YouTube](http://img.shields.io/badge/youtube-ampliseq-FFFF00?labelColor=000000&logo=youtube)](https://youtu.be/a0VOEeAvETs) diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index eaf9f190d..ec828d825 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -11,3 +11,9 @@ report_section_order: order: -1002 export_plots: true + +disable_version_detection: true + +# MultiQC version 1.20 & 1.21 need that flag to produce plots! +# TODO: Remove with version greater than 1.21! +plots_force_flat: true diff --git a/assets/nf-core-ampliseq_logo_light.png b/assets/nf-core-ampliseq_logo_light.png index 0b9000e43..1fc786a29 100644 Binary files a/assets/nf-core-ampliseq_logo_light.png and b/assets/nf-core-ampliseq_logo_light.png differ diff --git a/conf/modules.config b/conf/modules.config index d93b5bb03..389bb1a5a 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -415,7 +415,6 @@ process { ] } - withName: BARRNAP { ext.kingdom = "bac,arc,mito,euk" ext.args = "--quiet --reject 0.1" diff --git a/conf/test_iontorrent.config b/conf/test_iontorrent.config index c4092fdde..a8b94947e 100644 --- a/conf/test_iontorrent.config +++ b/conf/test_iontorrent.config @@ -22,9 +22,12 @@ params { // Input data FW_primer = "GTGARTCATCGARTCTTTG" RV_primer = "TCCTCSSCTTATTGATATGC" - dada_ref_taxonomy = "unite-fungi=8.3" + sintax_ref_taxonomy = "unite-fungi=8.2" input = "https://raw.githubusercontent.com/nf-core/test-datasets/ampliseq/samplesheets/Samplesheet_it_SE_ITS.tsv" iontorrent = true max_ee = 5 skip_qiime = true + + // Prevent default taxonomic classification + skip_dada_taxonomy = true } diff --git a/conf/test_pacbio_its.config b/conf/test_pacbio_its.config index f64706ea6..fea19133a 100644 --- a/conf/test_pacbio_its.config +++ b/conf/test_pacbio_its.config @@ -12,7 +12,7 @@ params { config_profile_name = 'Test profile PacBio ITS' - config_profile_description = 'Minimal test dataset to check pipeline function with PacBio ITS sequences and options --cut_its (set to "full") and --addsh enabled' + config_profile_description = 'Minimal test dataset to check pipeline function with PacBio ITS sequences and options --cut_its (set to "full")' // Limit resources so that this can run on GitHub Actions max_cpus = 2 @@ -22,13 +22,16 @@ params { // Input data FW_primer = "CTTGGTCATTTAGAGGAAGTAA" RV_primer = "TCCTGAGGGAAACTTCG" - dada_ref_taxonomy = "unite-fungi=8.3" + sintax_ref_taxonomy = "unite-fungi=8.2" input = "https://raw.githubusercontent.com/nf-core/test-datasets/ampliseq/samplesheets/Samplesheet_pacbio_ITS.tsv" metadata = "https://raw.githubusercontent.com/nf-core/test-datasets/ampliseq/samplesheets/Metadata_pacbio_ITS.tsv" pacbio = true max_ee = 12 cut_its = "full" - addsh = true + // addsh = true skip_qiime = true sbdiexport = true + + // Prevent default taxonomic classification + skip_dada_taxonomy = true } diff --git a/docs/images/nf-core-ampliseq_logo_dark.png b/docs/images/nf-core-ampliseq_logo_dark.png index 9de168569..8d43f6651 100644 Binary files a/docs/images/nf-core-ampliseq_logo_dark.png and b/docs/images/nf-core-ampliseq_logo_dark.png differ diff --git a/docs/images/nf-core-ampliseq_logo_light.png b/docs/images/nf-core-ampliseq_logo_light.png index a59dfc48c..e252fa3b0 100644 Binary files a/docs/images/nf-core-ampliseq_logo_light.png and b/docs/images/nf-core-ampliseq_logo_light.png differ diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy deleted file mode 100755 index e248e4c3f..000000000 --- a/lib/NfcoreTemplate.groovy +++ /dev/null @@ -1,356 +0,0 @@ -// -// This file holds several functions used within the nf-core pipeline template. -// - -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - -class NfcoreTemplate { - - // - // Check AWS Batch related parameters have been specified correctly - // - public static void awsBatch(workflow, params) { - if (workflow.profile.contains('awsbatch')) { - // Check params.awsqueue and params.awsregion have been set if running on AWSBatch - assert (params.awsqueue && params.awsregion) : "Specify correct --awsqueue and --awsregion parameters on AWSBatch!" - // Check outdir paths to be S3 buckets if running on AWSBatch - assert params.outdir.startsWith('s3:') : "Outdir not on S3 - specify S3 Bucket to run on AWSBatch!" - } - } - - // - // Warn if a -profile or Nextflow config has not been provided to run the pipeline - // - public static void checkConfigProvided(workflow, log) { - if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " - } - } - - // - // Generate version string - // - public static String version(workflow) { - String version_string = "" - - if (workflow.manifest.version) { - def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' - version_string += "${prefix_v}${workflow.manifest.version}" - } - - if (workflow.commitId) { - def git_shortsha = workflow.commitId.substring(0, 7) - version_string += "-g${git_shortsha}" - } - - return version_string - } - - // - // Construct and send completion email - // - public static void email(workflow, params, summary_params, projectDir, log, multiqc_report=[]) { - - // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" - if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" - } - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['Date Started'] = workflow.start - misc_fields['Date Completed'] = workflow.complete - misc_fields['Pipeline script file path'] = workflow.scriptFile - misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build - misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp - - def email_fields = [:] - email_fields['version'] = NfcoreTemplate.version(workflow) - email_fields['runName'] = workflow.runName - email_fields['success'] = workflow.success - email_fields['dateComplete'] = workflow.complete - email_fields['duration'] = workflow.duration - email_fields['exitStatus'] = workflow.exitStatus - email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - email_fields['errorReport'] = (workflow.errorReport ?: 'None') - email_fields['commandLine'] = workflow.commandLine - email_fields['projectDir'] = workflow.projectDir - email_fields['summary'] = summary << misc_fields - - // On success try attach the multiqc report - def mqc_report = null - try { - if (workflow.success) { - mqc_report = multiqc_report.getVal() - if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { - if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" - } - mqc_report = mqc_report[0] - } - } - } catch (all) { - if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" - } - } - - // Check if we are only sending emails on failure - def email_address = params.email - if (!params.email && params.email_on_fail && !workflow.success) { - email_address = params.email_on_fail - } - - // Render the TXT template - def engine = new groovy.text.GStringTemplateEngine() - def tf = new File("$projectDir/assets/email_template.txt") - def txt_template = engine.createTemplate(tf).make(email_fields) - def email_txt = txt_template.toString() - - // Render the HTML template - def hf = new File("$projectDir/assets/email_template.html") - def html_template = engine.createTemplate(hf).make(email_fields) - def email_html = html_template.toString() - - // Render the sendmail template - def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] - def sf = new File("$projectDir/assets/sendmail_template.txt") - def sendmail_template = engine.createTemplate(sf).make(smail_fields) - def sendmail_html = sendmail_template.toString() - - // Send the HTML e-mail - Map colors = logColours(params.monochrome_logs) - if (email_address) { - try { - if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } - // Try to send HTML e-mail using sendmail - def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") - sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { - // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] - if ( mqc_report != null && mqc_report.size() <= max_multiqc_email_size.toBytes() ) { - mail_cmd += [ '-A', mqc_report ] - } - mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" - } - } - - // Write summary e-mail HTML to a file - def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") - output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.html"); - output_hf.delete() - - // Write summary e-mail TXT to a file - def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") - output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.txt"); - output_tf.delete() - } - - // - // Construct and send a notification to a web server as JSON - // e.g. Microsoft Teams and Slack - // - public static void IM_notification(workflow, params, summary_params, projectDir, log) { - def hook_url = params.hook_url - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp - - def msg_fields = [:] - msg_fields['version'] = NfcoreTemplate.version(workflow) - msg_fields['runName'] = workflow.runName - msg_fields['success'] = workflow.success - msg_fields['dateComplete'] = workflow.complete - msg_fields['duration'] = workflow.duration - msg_fields['exitStatus'] = workflow.exitStatus - msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - msg_fields['errorReport'] = (workflow.errorReport ?: 'None') - msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") - msg_fields['projectDir'] = workflow.projectDir - msg_fields['summary'] = summary << misc_fields - - // Render the JSON template - def engine = new groovy.text.GStringTemplateEngine() - // Different JSON depending on the service provider - // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format - def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" - def hf = new File("$projectDir/assets/${json_path}") - def json_template = engine.createTemplate(hf).make(msg_fields) - def json_message = json_template.toString() - - // POST - def post = new URL(hook_url).openConnection(); - post.setRequestMethod("POST") - post.setDoOutput(true) - post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); - } - } - - // - // Dump pipeline parameters in a json file - // - public static void dump_parameters(workflow, params) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) - - FilesEx.copyTo(temp_pf.toPath(), "${params.outdir}/pipeline_info/params_${timestamp}.json") - temp_pf.delete() - } - - // - // Print pipeline summary on completion - // - public static void summary(workflow, params, log) { - Map colors = logColours(params.monochrome_logs) - if (workflow.success) { - if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" - } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" - } - } - - // - // ANSII Colours used for terminal logging - // - public static Map logColours(Boolean monochrome_logs) { - Map colorcodes = [:] - - // Reset / Meta - colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" - colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" - colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" - colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" - colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" - colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" - colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" - - // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" - - // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" - - // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" - - // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" - - // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" - - return colorcodes - } - - // - // Does what is says on the tin - // - public static String dashedLine(monochrome_logs) { - Map colors = logColours(monochrome_logs) - return "-${colors.dim}----------------------------------------------------${colors.reset}-" - } - - // - // nf-core logo - // - public static String logo(workflow, monochrome_logs) { - Map colors = logColours(monochrome_logs) - String workflow_version = NfcoreTemplate.version(workflow) - String.format( - """\n - ${dashedLine(monochrome_logs)} - ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} - ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} - ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} - ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} - ${colors.green}`._,._,\'${colors.reset} - ${colors.purple} ${workflow.manifest.name} ${workflow_version}${colors.reset} - ${dashedLine(monochrome_logs)} - """.stripIndent() - ) - } -} diff --git a/lib/Utils.groovy b/lib/Utils.groovy deleted file mode 100644 index 8d030f4e8..000000000 --- a/lib/Utils.groovy +++ /dev/null @@ -1,47 +0,0 @@ -// -// This file holds several Groovy functions that could be useful for any Nextflow pipeline -// - -import org.yaml.snakeyaml.Yaml - -class Utils { - - // - // When running with -profile conda, warn if channels have not been set-up appropriately - // - public static void checkCondaChannels(log) { - Yaml parser = new Yaml() - def channels = [] - try { - def config = parser.load("conda config --show channels".execute().text) - channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return - } - - // Check that all channels are present - // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] - def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean - - // Check that they are in the right order - def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) - } - - if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - } - } -} diff --git a/lib/WorkflowAmpliseq.groovy b/lib/WorkflowAmpliseq.groovy deleted file mode 100755 index 4676fd4e0..000000000 --- a/lib/WorkflowAmpliseq.groovy +++ /dev/null @@ -1,246 +0,0 @@ -// -// This file holds several functions specific to the workflow/ampliseq.nf in the nf-core/ampliseq pipeline -// - -import nextflow.Nextflow -import groovy.text.SimpleTemplateEngine - -class WorkflowAmpliseq { - - // - // Check and validate parameters - // - public static void initialise(params, log) { - if ( !params.input && !params.input_fasta && !params.input_folder ) { - Nextflow.error("Missing input declaration: One of `--input`, `--input_fasta`, `--input_folder` is required.") - } - - if ( !params.multiregion && !params.input_fasta && (!params.FW_primer || !params.RV_primer) && !params.skip_cutadapt ) { - Nextflow.error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for primer trimming. If primer trimming is not needed, use `--skip_cutadapt`.") - } - - if ( params.pacbio || params.iontorrent || params.single_end ) { - if (params.trunclenr) { log.warn "Unused parameter: `--trunclenr` is ignored because the data is single end." } - } else if (params.trunclenf && !params.trunclenr) { - Nextflow.error("Invalid command: `--trunclenf` is set, but `--trunclenr` is not. Either both parameters `--trunclenf` and `--trunclenr` must be set or none.") - } else if (!params.trunclenf && params.trunclenr) { - Nextflow.error("Invalid command: `--trunclenr` is set, but `--trunclenf` is not. Either both parameters `--trunclenf` and `--trunclenr` must be set or none.") - } - - if (!["pooled", "independent", "pseudo"].contains(params.sample_inference)) { - def error_string = "Please set `--sample_inference` to one of the following:\n" + - "\t-\"independent\" (lowest sensitivity and lowest resources),\n" + - "\t-\"pseudo\" (balance between required resources and sensitivity),\n" + - "\t-\"pooled\" (highest sensitivity and resources)." - Nextflow.error(error_string) - } - - if (params.double_primer && params.retain_untrimmed) { - Nextflow.error("Incompatible parameters `--double_primer` and `--retain_untrimmed` cannot be set at the same time.") - } - - if ( params.min_len_asv && params.max_len_asv && (params.min_len_asv > params.max_len_asv) ) { - Nextflow.error("Incompatible parameters: `--min_len_asv` may not be greater than `--max_len_asv`.") - } - - if ( params.skip_dada_quality && (params.trunclenf == null || params.trunclenr == null) ) { - Nextflow.error("Incompatible parameters: `--skip_dada_quality` may not be used without setting `--trunclenf` and `--trunclenr`.") - } - - if (params.tax_agglom_min > params.tax_agglom_max) { - Nextflow.error("Incompatible parameters: `--tax_agglom_min` may not be greater than `--tax_agglom_max`.") - } - - if (!params.dada_ref_tax_custom && params.dada_ref_tax_custom_sp) { - Nextflow.error("Incompatible parameters: `--dada_ref_tax_custom_sp` requires `--dada_ref_tax_custom`.") - } - - if (params.dada_ref_tax_custom && !params.dada_ref_tax_custom_sp && !params.skip_dada_addspecies) { - Nextflow.error("Incompatible parameters: Either `--skip_dada_addspecies` or `--dada_ref_tax_custom_sp` is additionally required to `--dada_ref_tax_custom`.") - } - - if (params.pplace_tree) { - if (!params.pplace_aln) { - Nextflow.error("Missing parameter: Phylogenetic placement requires in addition to `--pplace_tree` also `--pplace_aln`.") - } - if (!params.pplace_model) { - Nextflow.error("Missing parameter: Phylogenetic placement requires in addition to `--pplace_tree` also `--pplace_model`.") - } - } - - if (params.dada_assign_taxlevels && params.sbdiexport && !params.sintax_ref_taxonomy) { - Nextflow.error("Incompatible parameters: `--sbdiexport` expects specific taxonomics ranks (default) and therefore excludes modifying those using `--dada_assign_taxlevels`.") - } - - if (params.skip_taxonomy && params.sbdiexport) { - Nextflow.error("Incompatible parameters: `--sbdiexport` expects taxa annotation and therefore excludes `--skip_taxonomy`.") - } - - if (params.skip_dada_taxonomy && params.sbdiexport) { - if (!params.sintax_ref_taxonomy && (params.skip_qiime || (!params.qiime_ref_taxonomy && !params.qiime_ref_tax_custom))) { - Nextflow.error("Incompatible parameters: `--sbdiexport` expects taxa annotation and therefore annotation with either DADA2, SINTAX, or QIIME2 is needed.") - } - } - - if ( (!params.FW_primer || !params.RV_primer) && (params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && !params.skip_qiime && !params.skip_taxonomy ) { - Nextflow.error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for cutting the QIIME2 reference database to the amplicon sequences. Please specify primers or do not use `--qiime_ref_taxonomy`.") - } - - if ( (!params.FW_primer || !params.RV_primer) && params.cut_dada_ref_taxonomy && !params.skip_taxonomy ) { - Nextflow.error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for cutting the DADA2 reference database to the amplicon sequences. Please specify primers or do not use `--cut_dada_ref_taxonomy`.") - } - - if ((params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && params.classifier) { - Nextflow.error("Incompatible parameters: `--qiime_ref_taxonomy` and `--qiime_ref_tax_custom` will produce a classifier but `--classifier` points to a precomputed classifier, therefore, only use one of those.") - } - - if (params.kraken2_ref_tax_custom && !params.kraken2_assign_taxlevels ) { - Nextflow.error("Missing parameter: Taxonomic classification with a user provided database via `--kraken2_ref_tax_custom` requires `--kraken2_assign_taxlevels`") - } - - if (params.filter_ssu && params.skip_barrnap) { - Nextflow.error("Incompatible parameters: `--filter_ssu` cannot be used with `--skip_barrnap` because filtering for SSU's depends on barrnap.") - } - - String[] sbdi_compatible_databases = ["coidb","coidb=221216","gtdb","gtdb=R08-RS214","gtdb=R07-RS207","gtdb=R06-RS202","gtdb=R05-RS95","midori2-co1","midori2-co1=gb250","pr2","pr2=5.0.0","pr2=4.14.0","pr2=4.13.0","rdp","rdp=18","sbdi-gtdb","sbdi-gtdb=R07-RS207-1","silva","silva=138","silva=132","unite-fungi","unite-fungi=9.0","unite-fungi=8.3","unite-fungi=8.2","unite-alleuk","unite-alleuk=9.0","unite-alleuk=8.3","unite-alleuk=8.2"] - if (params.sbdiexport){ - if (params.sintax_ref_taxonomy ) { - if (!Arrays.stream(sbdi_compatible_databases).anyMatch(entry -> params.sintax_ref_taxonomy.toString().equals(entry)) ) { - Nextflow.error("Incompatible parameters: `--sbdiexport` does not work with the chosen database of `--sintax_ref_taxonomy` because the expected taxonomic levels do not match.") - } - } else if (!Arrays.stream(sbdi_compatible_databases).anyMatch(entry -> params.dada_ref_taxonomy.toString().equals(entry)) ) { - Nextflow.error("Incompatible parameters: `--sbdiexport` does not work with the chosen database of `--dada_ref_taxonomy` because the expected taxonomic levels do not match.") - } - } - - if (params.addsh && !params.dada_ref_databases[params.dada_ref_taxonomy]["shfile"]) { - def validDBs = "" - for (db in params.dada_ref_databases.keySet()) { - if (params.dada_ref_databases[db]["shfile"]) { - validDBs += " " + db - } - } - Nextflow.error("UNITE species hypothesis information is not available for the selected reference database, please use the option `--dada_ref_taxonomy` to select an appropriate database. Currently, the option `--addsh` can only be used together with the following UNITE reference databases:\n" + validDBs + ".") - } - - if (params.addsh && params.cut_its == "none") { - log.warn "Adding UNITE species hypothesis (SH) assignments is only feasible for ITS sequences. Please use option `--cut_its` to find ITS regions in the ASV sequences, unless the given sequences are already cut to the ITS region.\n" - } - - // Error message for incompatible combination of --orf_start and --orf_end - if ( params.orf_end && ( ( ( params.orf_end + 1 ) - params.orf_start ) % 3 != 0 ) ) { - Nextflow.error("Incompatible parameters: The difference of `--orf_end` and `--orf_start` must be a multiple of 3.") - } - - // When multi-region analysis is used, some parameter combinations are required or not allowed: - if ( params.multiregion ) { - if ( !params.sidle_ref_taxonomy && !params.sidle_ref_tree_custom ) { - log.warn "Missing parameter: Either use `--sidle_ref_taxonomy` or `--sidle_ref_tree_custom` to get (unified) taxonomic classifications" - } - if ( (params.dada_ref_tax_custom || params.dada_ref_taxonomy) && !params.skip_dada_taxonomy ) { - Nextflow.error("Incompatible parameters: Multiple region analysis with `--multiregion` does not work with `--dada_ref_tax_custom`, `--dada_ref_taxonomy`") - } - if ( params.cut_its != "none" ) { - Nextflow.error("Incompatible parameters: Multiple region analysis with `--multiregion` does not work with `--cut_its`") - } - if ( params.vsearch_cluster || params.filter_ssu || params.min_len_asv || params.max_len_asv || params.filter_codons ) { - log.warn "Incompatible parameters: Multiple region analysis with `--multiregion` ignores any of `--vsearch_cluster`, `--filter_ssu`, `--min_len_asv`, `--max_len_asv`, `--filter_codons`, `--cut_its`" - } - } - } - - // - // Prepare complement sequence - ultimately to make reverse complement primers - // Complement table taken from http://arep.med.harvard.edu/labgc/adnan/projects/Utilities/revcomp.html - public static String makeComplement(seq) { - def complements = [ A:'T', T:'A', U:'A', G:'C', C:'G', Y:'R', R:'Y', S:'S', W:'W', K:'M', M:'K', B:'V', D:'H', H:'D', V:'B', N:'N' ] - def comp = seq.toUpperCase().collect { base -> complements[ base ] ?: 'X' }.join() - return comp - } - - // - // Get workflow summary for MultiQC - // - public static String paramsSummaryMultiqc(workflow, summary) { - String summary_section = '' - for (group in summary.keySet()) { - def group_params = summary.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

$group

\n" - summary_section += "
\n" - for (param in group_params.keySet()) { - summary_section += "
$param
${group_params.get(param) ?: 'N/A'}
\n" - } - summary_section += "
\n" - } - } - - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" - return yaml_file_text - } - - // - // Generate methods description for MultiQC - // - - public static String toolCitationText(params) { - - // TODO nf-core: Optionally add in-text citation tools to this list. - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def citation_text = [ - "Tools used in the workflow included:", - "FastQC (Andrews 2010),", - "MultiQC (Ewels et al. 2016)", - "." - ].join(' ').trim() - - return citation_text - } - - public static String toolBibliographyText(params) { - - // TODO Optionally add bibliographic entries to this list. - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
    • " : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def reference_text = [ - "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", - "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " - ].join(' ').trim() - - return reference_text - } - - public static String methodsDescriptionText(run_workflow, mqc_methods_yaml, params) { - // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file - def meta = [:] - meta.workflow = run_workflow.toMap() - meta["manifest_map"] = run_workflow.manifest.toMap() - - // Pipeline DOI - meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" - meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " - - // Tool references - meta["tool_citations"] = "" - meta["tool_bibliography"] = "" - - // TODO Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! - //meta["tool_citations"] = toolCitationText(params).replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") - //meta["tool_bibliography"] = toolBibliographyText(params) - - - def methods_text = mqc_methods_yaml.text - - def engine = new SimpleTemplateEngine() - def description_html = engine.createTemplate(methods_text).make(meta) - - return description_html - } -} diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy deleted file mode 100755 index 5d1f9c083..000000000 --- a/lib/WorkflowMain.groovy +++ /dev/null @@ -1,113 +0,0 @@ -// -// This file holds several functions specific to the main.nf workflow in the nf-core/ampliseq pipeline -// - -import nextflow.Nextflow - -class WorkflowMain { - - // - // Citation string for pipeline - // - public static String citation(workflow) { - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline publication\n" + - " https://doi.org/10.3389/fmicb.2020.550420\n\n" + - "* The pipeline\n" + - " https://doi.org/10.5281/zenodo.1493841\n\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" - } - - - // - // Validate parameters and print summary to screen - // - public static void initialise(workflow, params, log, args) { - - // Check that keys for reference databases are valid - if (params.dada_ref_taxonomy && !params.skip_taxonomy && !params.skip_dada_taxonomy) { - dadareftaxonomyExistsError(params, log) - } - if (params.sintax_ref_taxonomy && !params.skip_taxonomy) { - sintaxreftaxonomyExistsError(params, log) - } - if ((params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && !params.skip_taxonomy && !params.classifier) { - qiimereftaxonomyExistsError(params, log) - } - - // Print workflow version and exit on --version - if (params.version) { - String workflow_version = NfcoreTemplate.version(workflow) - log.info "${workflow.manifest.name} ${workflow_version}" - System.exit(0) - } - - // Check that a -profile or Nextflow config has been provided to run the pipeline - NfcoreTemplate.checkConfigProvided(workflow, log) - // Check that the profile doesn't contain spaces and doesn't end with a trailing comma - checkProfile(workflow.profile, args, log) - - // Check that conda channels are set-up correctly - if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { - Utils.checkCondaChannels(log) - } - - // Check AWS batch settings - NfcoreTemplate.awsBatch(workflow, params) - } - - // - // Exit pipeline if incorrect --dada_ref_taxonomy key provided - // - private static void dadareftaxonomyExistsError(params, log) { - if (params.dada_ref_databases && params.dada_ref_taxonomy && !params.dada_ref_databases.containsKey(params.dada_ref_taxonomy)) { - def error_string = "=============================================================================\n" + - " DADA2 reference database '${params.dada_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + - " Currently, the available reference taxonomy keys for `--dada_ref_taxonomy` are:\n" + - " ${params.dada_ref_databases.keySet().join(", ")}\n" + - "===================================================================================" - Nextflow.error(error_string) - } - } - // - // Exit pipeline if incorrect --sintax_ref_taxonomy key provided - // - private static void sintaxreftaxonomyExistsError(params, log) { - if (params.sintax_ref_databases && params.sintax_ref_taxonomy && !params.sintax_ref_databases.containsKey(params.sintax_ref_taxonomy)) { - def error_string = "=============================================================================\n" + - " SINTAX reference database '${params.sintax_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + - " Currently, the available reference taxonomy keys for `--sintax_ref_taxonomy` are:\n" + - " ${params.sintax_ref_databases.keySet().join(", ")}\n" + - "===================================================================================" - Nextflow.error(error_string) - } - } - // - // Exit pipeline if incorrect --qiime_ref_taxonomy key provided - // - private static void qiimereftaxonomyExistsError(params, log) { - if (params.qiime_ref_databases && params.qiime_ref_taxonomy && !params.qiime_ref_databases.containsKey(params.qiime_ref_taxonomy)) { - def error_string = "=============================================================================\n" + - " QIIME2 reference database '${params.qiime_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + - " Currently, the available reference taxonomy keys for `--qiime_ref_taxonomy` are:\n" + - " ${params.qiime_ref_databases.keySet().join(", ")}\n" + - "===================================================================================" - Nextflow.error(error_string) - } - } - - // - // Exit pipeline if --profile contains spaces - // - private static void checkProfile(profile, args, log) { - if (profile.endsWith(',')) { - Nextflow.error "Profile cannot end with a trailing comma. Please remove the comma from the end of the profile string.\nHint: A common mistake is to provide multiple values to `-profile` separated by spaces. Please use commas to separate profiles instead,e.g., `-profile docker,test`." - } - if (args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${args[0]}` has been detected.\n Hint: A common mistake is to provide multiple values to `-profile` separated by spaces. Please use commas to separate profiles instead,e.g., `-profile docker,test`." - } - } -} diff --git a/main.nf b/main.nf index dd35beca5..d3de3de5c 100644 --- a/main.nf +++ b/main.nf @@ -13,55 +13,75 @@ nextflow.enable.dsl = 2 /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - VALIDATE & PRINT PARAMETER SUMMARY + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { validateParameters; paramsHelp } from 'plugin/nf-validation' - -// Print help message if needed -if (params.help) { - def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) - def citation = '\n' + WorkflowMain.citation(workflow) + '\n' - def String command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh37 -profile docker" - log.info logo + paramsHelp(command) + citation + NfcoreTemplate.dashedLine(params.monochrome_logs) - System.exit(0) -} - -// Validate input parameters -if (params.validate_params) { - validateParameters() -} - -WorkflowMain.initialise(workflow, params, log, args) +include { AMPLISEQ } from './workflows/ampliseq' +include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_ampliseq_pipeline' +include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_ampliseq_pipeline' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - NAMED WORKFLOW FOR PIPELINE + NAMED WORKFLOWS FOR PIPELINE ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { AMPLISEQ } from './workflows/ampliseq' - // -// WORKFLOW: Run main nf-core/ampliseq analysis pipeline +// WORKFLOW: Run main analysis pipeline depending on type of input // workflow NFCORE_AMPLISEQ { + + main: + + // + // WORKFLOW: Run pipeline + // AMPLISEQ () -} + emit: + multiqc_report = AMPLISEQ.out.multiqc_report // channel: /path/to/multiqc_report.html + +} /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - RUN ALL WORKFLOWS + RUN MAIN WORKFLOW ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -// -// WORKFLOW: Execute a single named workflow for the pipeline -// See: https://github.com/nf-core/rnaseq/issues/619 -// workflow { + + main: + + // + // SUBWORKFLOW: Run initialisation tasks + // + PIPELINE_INITIALISATION ( + params.version, + params.help, + params.validate_params, + params.monochrome_logs, + args, + params.outdir + ) + + // + // WORKFLOW: Run main workflow + // NFCORE_AMPLISEQ () + + // + // SUBWORKFLOW: Run completion tasks + // + PIPELINE_COMPLETION ( + params.email, + params.email_on_fail, + params.plaintext_email, + params.outdir, + params.monochrome_logs, + params.hook_url, + NFCORE_AMPLISEQ.out.multiqc_report + ) } /* diff --git a/modules.json b/modules.json index f94caaac4..69eb91ff9 100644 --- a/modules.json +++ b/modules.json @@ -5,11 +5,6 @@ "https://github.com/nf-core/modules.git": { "modules": { "nf-core": { - "custom/dumpsoftwareversions": { - "branch": "master", - "git_sha": "8ec825f465b9c17f9d83000022995b4f7de6fe93", - "installed_by": ["modules"] - }, "cutadapt": { "branch": "master", "git_sha": "0efbaeb95c58da5a1096c99b5e919bc0c99cc952", @@ -27,7 +22,7 @@ }, "fastqc": { "branch": "master", - "git_sha": "c9488585ce7bd35ccd2a30faa2371454c8112fb9", + "git_sha": "f4ae1d942bd50c5c0b9bd2de1393ce38315ba57c", "installed_by": ["modules"] }, "gappa/examineassign": { @@ -78,7 +73,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "8ec825f465b9c17f9d83000022995b4f7de6fe93", + "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", "installed_by": ["modules"] }, "pigz/uncompress": { @@ -114,6 +109,21 @@ "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", "installed_by": ["subworkflows"] + }, + "utils_nextflow_pipeline": { + "branch": "master", + "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "installed_by": ["subworkflows"] + }, + "utils_nfcore_pipeline": { + "branch": "master", + "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "installed_by": ["subworkflows"] + }, + "utils_nfvalidation_plugin": { + "branch": "master", + "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "installed_by": ["subworkflows"] } } } diff --git a/modules/local/summary_report.nf b/modules/local/summary_report.nf index 1a288a0fb..2306a061e 100644 --- a/modules/local/summary_report.nf +++ b/modules/local/summary_report.nf @@ -81,7 +81,7 @@ process SUMMARY_REPORT { input_samplesheet ? "input_samplesheet='$input_samplesheet'" : "", input_fasta ? "input_fasta='$input_fasta'" : "", !input_fasta && !input_samplesheet ? "input_folder='$params.input_folder'" : "", - mqc_plots ? "mqc_plot='${mqc_plots}/svg/mqc_fastqc_per_sequence_quality_scores_plot_1.svg'" : "", + mqc_plots ? "mqc_plot='${mqc_plots}/svg/fastqc_per_sequence_quality_scores_plot.svg'" : "", cutadapt_summary ? params.retain_untrimmed ? "flag_retain_untrimmed=TRUE,cutadapt_summary='$cutadapt_summary'" : "cutadapt_summary='$cutadapt_summary'" : "", diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml deleted file mode 100644 index 9b3272bc1..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: custom_dumpsoftwareversions -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::multiqc=1.19 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf deleted file mode 100644 index f2187611c..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ /dev/null @@ -1,24 +0,0 @@ -process CUSTOM_DUMPSOFTWAREVERSIONS { - label 'process_single' - - // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.19--pyhdfd78af_0' : - 'biocontainers/multiqc:1.19--pyhdfd78af_0' }" - - input: - path versions - - output: - path "software_versions.yml" , emit: yml - path "software_versions_mqc.yml", emit: mqc_yml - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - template 'dumpsoftwareversions.py' -} diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml deleted file mode 100644 index 5f15a5fde..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ /dev/null @@ -1,37 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json -name: custom_dumpsoftwareversions -description: Custom module used to dump software versions within the nf-core pipeline template -keywords: - - custom - - dump - - version -tools: - - custom: - description: Custom module used to dump software versions within the nf-core pipeline template - homepage: https://github.com/nf-core/tools - documentation: https://github.com/nf-core/tools - licence: ["MIT"] -input: - - versions: - type: file - description: YML file containing software versions - pattern: "*.yml" -output: - - yml: - type: file - description: Standard YML file containing software versions - pattern: "software_versions.yml" - - mqc_yml: - type: file - description: MultiQC custom content YML file containing software versions - pattern: "software_versions_mqc.yml" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" -authors: - - "@drpatelh" - - "@grst" -maintainers: - - "@drpatelh" - - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py deleted file mode 100755 index da0334085..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py +++ /dev/null @@ -1,101 +0,0 @@ -#!/usr/bin/env python - - -"""Provide functions to merge multiple versions.yml files.""" - - -import yaml -import platform -from textwrap import dedent - - -def _make_versions_html(versions): - """Generate a tabular HTML output of all versions for MultiQC.""" - html = [ - dedent( - """\\ - - - - - - - - - - """ - ) - ] - for process, tmp_versions in sorted(versions.items()): - html.append("") - for i, (tool, version) in enumerate(sorted(tmp_versions.items())): - html.append( - dedent( - f"""\\ - - - - - - """ - ) - ) - html.append("") - html.append("
    Process Name Software Version
    {process if (i == 0) else ''}{tool}{version}
    ") - return "\\n".join(html) - - -def main(): - """Load all version files and generate merged output.""" - versions_this_module = {} - versions_this_module["${task.process}"] = { - "python": platform.python_version(), - "yaml": yaml.__version__, - } - - with open("$versions") as f: - versions_by_process = yaml.load(f, Loader=yaml.BaseLoader) | versions_this_module - - # aggregate versions by the module name (derived from fully-qualified process name) - versions_by_module = {} - for process, process_versions in versions_by_process.items(): - module = process.split(":")[-1] - try: - if versions_by_module[module] != process_versions: - raise AssertionError( - "We assume that software versions are the same between all modules. " - "If you see this error-message it means you discovered an edge-case " - "and should open an issue in nf-core/tools. " - ) - except KeyError: - versions_by_module[module] = process_versions - - versions_by_module["Workflow"] = { - "Nextflow": "$workflow.nextflow.version", - "$workflow.manifest.name": "$workflow.manifest.version", - } - - versions_mqc = { - "id": "software_versions", - "section_name": "${workflow.manifest.name} Software Versions", - "section_href": "https://github.com/${workflow.manifest.name}", - "plot_type": "html", - "description": "are collected at run time from the software output.", - "data": _make_versions_html(versions_by_module), - } - - with open("software_versions.yml", "w") as f: - yaml.dump(versions_by_module, f, default_flow_style=False) - with open("software_versions_mqc.yml", "w") as f: - yaml.dump(versions_mqc, f, default_flow_style=False) - - with open("versions.yml", "w") as f: - yaml.dump(versions_this_module, f, default_flow_style=False) - - -if __name__ == "__main__": - main() diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test deleted file mode 100644 index b1e1630bb..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test +++ /dev/null @@ -1,43 +0,0 @@ -nextflow_process { - - name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" - script "../main.nf" - process "CUSTOM_DUMPSOFTWAREVERSIONS" - tag "modules" - tag "modules_nfcore" - tag "custom" - tag "dumpsoftwareversions" - tag "custom/dumpsoftwareversions" - - test("Should run without failures") { - when { - process { - """ - def tool1_version = ''' - TOOL1: - tool1: 0.11.9 - '''.stripIndent() - - def tool2_version = ''' - TOOL2: - tool2: 1.9 - '''.stripIndent() - - input[0] = Channel.of(tool1_version, tool2_version).collectFile() - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot( - process.out.versions, - file(process.out.mqc_yml[0]).readLines()[0..10], - file(process.out.yml[0]).readLines()[0..7] - ).match() - } - ) - } - } -} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap deleted file mode 100644 index 5f59a936d..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap +++ /dev/null @@ -1,33 +0,0 @@ -{ - "Should run without failures": { - "content": [ - [ - "versions.yml:md5,76d454d92244589d32455833f7c1ba6d" - ], - [ - "data: \"\\n\\n \\n \\n \\n \\n \\n \\n \\n\\", - " \\n\\n\\n \\n \\n\\", - " \\ \\n\\n\\n\\n \\n \\", - " \\ \\n \\n\\n\\n\\n\\", - " \\n\\n \\n \\n\\", - " \\ \\n\\n\\n\\n\\n\\n \\n\\", - " \\ \\n \\n\\n\\n\\n\\", - " \\n\\n \\n \\n\\" - ], - [ - "CUSTOM_DUMPSOFTWAREVERSIONS:", - " python: 3.11.7", - " yaml: 5.4.1", - "TOOL1:", - " tool1: 0.11.9", - "TOOL2:", - " tool2: '1.9'", - "Workflow:" - ] - ], - "timestamp": "2024-01-09T23:01:18.710682" - } -} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml deleted file mode 100644 index 405aa24ae..000000000 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -custom/dumpsoftwareversions: - - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 1f21c6646..70edae4d9 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -33,7 +33,7 @@ nextflow_process { { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, { assert path(process.out.html[0][1]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_single") } ) } } @@ -63,7 +63,7 @@ nextflow_process { { assert path(process.out.html[0][1][0]).text.contains("") }, { assert path(process.out.html[0][1][1]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_paired") } ) } } @@ -89,7 +89,7 @@ nextflow_process { { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, { assert path(process.out.html[0][1]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } ) } } @@ -115,7 +115,7 @@ nextflow_process { { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, { assert path(process.out.html[0][1]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_bam") } ) } } @@ -153,7 +153,7 @@ nextflow_process { { assert path(process.out.html[0][1][2]).text.contains("") }, { assert path(process.out.html[0][1][3]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } ) } } @@ -179,7 +179,7 @@ nextflow_process { { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, { assert path(process.out.html[0][1]).text.contains("") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } ) } } @@ -204,7 +204,7 @@ nextflow_process { { assert process.success }, { assert snapshot(process.out.html.collect { file(it[1]).getName() } + process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match() } + process.out.versions ).match("fastqc_stub") } ) } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 5d624bb82..86f7c3115 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,5 +1,17 @@ { - "sarscov2 single-end [fastq] - stub": { + "fastqc_versions_interleaved": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:07.293713" + }, + "fastqc_stub": { "content": [ [ "test.html", @@ -7,14 +19,70 @@ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], - "timestamp": "2024-01-17T18:40:57.254299" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:31:01.425198" + }, + "fastqc_versions_multiple": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:55.797907" + }, + "fastqc_versions_bam": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:26.795862" + }, + "fastqc_versions_single": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:39:27.043675" + }, + "fastqc_versions_paired": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:39:47.584191" }, - "versions": { + "fastqc_versions_custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], - "timestamp": "2024-01-17T18:36:50.033627" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:41:14.576531" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index 7625b7520..ca39fb67e 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -4,4 +4,4 @@ channels: - bioconda - defaults dependencies: - - bioconda::multiqc=1.19 + - bioconda::multiqc=1.21 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 1b9f7c431..47ac352f9 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,8 +3,8 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.19--pyhdfd78af_0' : - 'biocontainers/multiqc:1.19--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : + 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index d0438eda6..f1c4242ef 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -3,6 +3,7 @@ nextflow_process { name "Test Process MULTIQC" script "../main.nf" process "MULTIQC" + tag "modules" tag "modules_nfcore" tag "multiqc" @@ -12,7 +13,7 @@ nextflow_process { when { process { """ - input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) input[1] = [] input[2] = [] input[3] = [] @@ -25,7 +26,7 @@ nextflow_process { { assert process.success }, { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, { assert process.out.data[0] ==~ ".*/multiqc_data" }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("multiqc_versions_single") } ) } @@ -36,7 +37,7 @@ nextflow_process { when { process { """ - input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] @@ -49,7 +50,7 @@ nextflow_process { { assert process.success }, { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, { assert process.out.data[0] ==~ ".*/multiqc_data" }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out.versions).match("multiqc_versions_config") } ) } } @@ -61,7 +62,7 @@ nextflow_process { when { process { """ - input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) input[1] = [] input[2] = [] input[3] = [] @@ -75,7 +76,7 @@ nextflow_process { { assert snapshot(process.out.report.collect { file(it).getName() } + process.out.data.collect { file(it).getName() } + process.out.plots.collect { file(it).getName() } + - process.out.versions ).match() } + process.out.versions ).match("multiqc_stub") } ) } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index d37e73040..bfebd8029 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -1,21 +1,41 @@ { - "versions": { + "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,14e9a2661241abd828f4f06a7b5c222d" + "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" ] ], - "timestamp": "2024-01-09T23:02:49.911994" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-29T08:48:55.657331" }, - "sarscov2 single-end [fastqc] - stub": { + "multiqc_stub": { "content": [ [ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,14e9a2661241abd828f4f06a7b5c222d" + "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" ] ], - "timestamp": "2024-01-09T23:03:14.524346" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-29T08:49:49.071937" + }, + "multiqc_versions_config": { + "content": [ + [ + "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-29T08:49:25.457567" } } \ No newline at end of file diff --git a/nextflow.config b/nextflow.config index 66ceda10e..c6d64e89c 100644 --- a/nextflow.config +++ b/nextflow.config @@ -148,7 +148,6 @@ params { config_profile_contact = null config_profile_url = null - // Max resource options // Defaults only, expecting to be overwritten max_memory = '128.GB' diff --git a/nextflow_schema.json b/nextflow_schema.json index 8d9b6221c..a837661d4 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -5,7 +5,7 @@ "description": "Amplicon sequencing analysis workflow using DADA2 and QIIME2", "type": "object", "definitions": { - "main_arguments": { + "input_output_options": { "title": "Main arguments", "type": "object", "description": "", @@ -13,6 +13,7 @@ "properties": { "input": { "type": "string", + "format": "file-path", "mimetype": "text/tsv", "fa_icon": "fas fa-dna", "description": "Path to tab-separated sample sheet", @@ -21,6 +22,7 @@ }, "input_fasta": { "type": "string", + "format": "file-path", "mimetype": "text/tsv", "fa_icon": "fas fa-dna", "description": "Path to ASV/OTU fasta file", @@ -28,7 +30,7 @@ }, "input_folder": { "type": "string", - "mimetype": "text/tsv", + "format": "directory-path", "fa_icon": "fas fa-dna", "description": "Path to folder containing zipped FastQ files", "help_text": "Path to folder containing compressed fastq files.\n\nExample for input data organization from one sequencing run with two samples, paired-end data:\n\n```bash\ndata\n \u251c\u2500sample1_1_L001_R1_001.fastq.gz\n \u251c\u2500sample1_1_L001_R2_001.fastq.gz\n \u251c\u2500sample2_1_L001_R1_001.fastq.gz\n \u2514\u2500sample2_1_L001_R2_001.fastq.gz\n```\n\nPlease note the following requirements:\n\n1. The path must be enclosed in quotes\n2. The folder must contain gzip compressed demultiplexed fastq files. If the file names do not follow the default (`\"/*_R{1,2}_001.fastq.gz\"`), please check `--extension`.\n3. Sample identifiers are extracted from file names, i.e. the string before the first underscore `_`, these must be unique\n4. If your data is scattered, produce a sample sheet\n5. All sequencing data should originate from one sequencing run, because processing relies on run-specific error models that are unreliable when data from several sequencing runs are mixed. Sequencing data originating from multiple sequencing runs requires additionally the parameter `--multiple_sequencing_runs` and a specific folder structure.\n\nRelated parameters are:\n- `--pacbio` and `--iontorrent` if the sequencing data is PacBio data or IonTorrent data (default expected: paired-end Illumina data)\n- `--single_end` if the sequencing data is single-ended Illumina data (default expected: paired-end Illumina data)\n- `--multiple_sequencing_runs` if the sequencing data originates from multiple sequencing runs\n- `--extension` if the sequencing file names do not follow the default (`\"/*_R{1,2}_001.fastq.gz\"`)\n- Choose an appropriate reference taxonomy for the type of amplicon (16S/18S/ITS/CO1) (default: DADA2 assignTaxonomy and 16S rRNA sequence database)" @@ -47,12 +49,14 @@ }, "metadata": { "type": "string", + "format": "file-path", "description": "Path to metadata sheet, when missing most downstream analysis are skipped (barplots, PCoA plots, ...).", "help_text": "This is optional, but for performing downstream analysis such as barplots, diversity indices or differential abundance testing, a metadata file is essential.\n\nRelated parameter:\n- `--metadata_category` (optional) to choose columns that are used for testing significance\n\nFor example:\n\n```bash\n--metadata \"path/to/metadata.tsv\"\n```\n\nPlease note the following requirements:\n\n1. The path must be enclosed in quotes\n2. The metadata file has to follow the QIIME2 specifications (https://docs.qiime2.org/2021.2/tutorials/metadata/)\n\nThe first column in the tab-separated metadata file is the sample identifier column (required header: `ID`) and defines the sample or feature IDs associated with your study. In addition to the sample identifier column, the metadata file is required to have at least one column with multiple different non-numeric values but not all unique.\n**NB**: without additional columns there might be no groupings for the downstream analyses.\n\nSample identifiers should be 36 characters long or less, and also contain only ASCII alphanumeric characters (i.e. in the range of [a-z], [A-Z], or [0-9]), or the dash (-) character. For downstream analysis, by default all numeric columns, blanks or NA are removed, and only columns with multiple different values but not all unique are selected.\n\nThe columns which are to be assessed can be specified by `--metadata_category`. If `--metadata_category` isn't specified than all columns that fit the specification are automatically chosen.", "fa_icon": "fas fa-file-csv" }, "multiregion": { "type": "string", + "format": "file-path", "mimetype": "text/tsv", "fa_icon": "fas fa-dna", "description": "Path to tab-separated multi region sheet", @@ -958,7 +962,7 @@ }, "allOf": [ { - "$ref": "#/definitions/main_arguments" + "$ref": "#/definitions/input_output_options" }, { "$ref": "#/definitions/sequencing_input" @@ -978,6 +982,9 @@ { "$ref": "#/definitions/taxonomic_database" }, + { + "$ref": "#/definitions/multiregion_taxonomic_database" + }, { "$ref": "#/definitions/asv_filtering" }, diff --git a/pyproject.toml b/pyproject.toml index 7d08e1c8e..56110621e 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -3,11 +3,13 @@ [tool.ruff] line-length = 120 target-version = "py38" -select = ["I", "E1", "E4", "E7", "E9", "F", "UP", "N"] cache-dir = "~/.cache/ruff" -[tool.ruff.isort] +[tool.ruff.lint] +select = ["I", "E1", "E4", "E7", "E9", "F", "UP", "N"] + +[tool.ruff.lint.isort] known-first-party = ["nf_core"] -[tool.ruff.per-file-ignores] +[tool.ruff.lint.per-file-ignores] "__init__.py" = ["E402", "F401"] diff --git a/subworkflows/local/dada2_taxonomy_wf.nf b/subworkflows/local/dada2_taxonomy_wf.nf index 52c1760dc..71fe438f8 100644 --- a/subworkflows/local/dada2_taxonomy_wf.nf +++ b/subworkflows/local/dada2_taxonomy_wf.nf @@ -11,6 +11,7 @@ include { FORMAT_TAXRESULTS as FORMAT_TAXRESULTS_STD } from '../../modules/loc include { FORMAT_TAXRESULTS as FORMAT_TAXRESULTS_ADDSP } from '../../modules/local/format_taxresults' include { ASSIGNSH } from '../../modules/local/assignsh' +include { makeComplement } from '../../subworkflows/local/utils_nfcore_ampliseq_pipeline' workflow DADA2_TAXONOMY_WF { take: @@ -39,7 +40,7 @@ workflow DADA2_TAXONOMY_WF { meta.single_end = true meta.id = "assignTaxonomy" meta.fw_primer = params.FW_primer - meta.rv_primer_revcomp = WorkflowAmpliseq.makeComplement ( "${params.RV_primer}".reverse() ) + meta.rv_primer_revcomp = makeComplement ( "${params.RV_primer}".reverse() ) [ meta, db ] } .set { ch_assigntax } CUTADAPT_TAXONOMY ( ch_assigntax ).reads diff --git a/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf new file mode 100644 index 000000000..fcd1c5ae0 --- /dev/null +++ b/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf @@ -0,0 +1,433 @@ +// +// Subworkflow with functionality specific to the nf-core/ampliseq pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' +include { paramsSummaryMap } from 'plugin/nf-validation' +include { fromSamplesheet } from 'plugin/nf-validation' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' +include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' +include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' +include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' +include { imNotification } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' +include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' + +/* +======================================================================================== + SUBWORKFLOW TO INITIALISE PIPELINE +======================================================================================== +*/ + +workflow PIPELINE_INITIALISATION { + + take: + version // boolean: Display version and exit + help // boolean: Display help text + validate_params // boolean: Boolean whether to validate parameters against the schema at runtime + monochrome_logs // boolean: Do not use coloured log outputs + nextflow_cli_args // array: List of positional nextflow CLI args + outdir // string: The output directory where the results will be saved + + main: + + ch_versions = Channel.empty() + + // + // Print version and exit if required and dump pipeline parameters to JSON file + // + UTILS_NEXTFLOW_PIPELINE ( + version, + true, + outdir, + workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 + ) + + // + // Validate parameters and generate parameter summary to stdout + // + pre_help_text = nfCoreLogo(monochrome_logs) + post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) + def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " + UTILS_NFVALIDATION_PLUGIN ( + help, + workflow_command, + pre_help_text, + post_help_text, + validate_params, + "nextflow_schema.json" + ) + + // + // Check config provided to the pipeline + // + UTILS_NFCORE_PIPELINE ( + nextflow_cli_args + ) + + // + // Custom validation for pipeline parameters + // + validateInputParameters() + // Check that keys for reference databases are valid + if ( params.dada_ref_taxonomy && !params.skip_taxonomy && !params.skip_dada_taxonomy ) { + dadareftaxonomyExistsError() + } + if ( params.sintax_ref_taxonomy && !params.skip_taxonomy ) { + sintaxreftaxonomyExistsError() + } + if ( (params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && !params.skip_taxonomy && !params.classifier ) { + qiimereftaxonomyExistsError() + } + if ( params.kraken2_ref_taxonomy && !params.skip_taxonomy ) { + kraken2reftaxonomyExistsError() + } + if ( params.sidle_ref_taxonomy && !params.skip_taxonomy ) { + sidlereftaxonomyExistsError() + } + + emit: + versions = ch_versions +} + +/* +======================================================================================== + SUBWORKFLOW FOR PIPELINE COMPLETION +======================================================================================== +*/ + +workflow PIPELINE_COMPLETION { + + take: + email // string: email address + email_on_fail // string: email address sent on pipeline failure + plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published + monochrome_logs // boolean: Disable ANSI colour codes in log output + hook_url // string: hook URL for notifications + multiqc_report // string: Path to MultiQC report + + main: + + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + + // + // Completion email and summary + // + workflow.onComplete { + if (email || email_on_fail) { + completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + } + + completionSummary(monochrome_logs) + + if (hook_url) { + imNotification(summary_params, hook_url) + } + } +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ + +// +// Check and validate pipeline parameters +// +def validateInputParameters() { + if ( !params.input && !params.input_fasta && !params.input_folder ) { + error("Missing input declaration: One of `--input`, `--input_fasta`, `--input_folder` is required.") + } + + if ( !params.multiregion && !params.input_fasta && (!params.FW_primer || !params.RV_primer) && !params.skip_cutadapt ) { + error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for primer trimming. If primer trimming is not needed, use `--skip_cutadapt`.") + } + + if ( params.pacbio || params.iontorrent || params.single_end ) { + if (params.trunclenr) { log.warn "Unused parameter: `--trunclenr` is ignored because the data is single end." } + } else if (params.trunclenf && !params.trunclenr) { + error("Invalid command: `--trunclenf` is set, but `--trunclenr` is not. Either both parameters `--trunclenf` and `--trunclenr` must be set or none.") + } else if (!params.trunclenf && params.trunclenr) { + error("Invalid command: `--trunclenr` is set, but `--trunclenf` is not. Either both parameters `--trunclenf` and `--trunclenr` must be set or none.") + } + + if (!["pooled", "independent", "pseudo"].contains(params.sample_inference)) { + def error_string = "Please set `--sample_inference` to one of the following:\n" + + "\t-\"independent\" (lowest sensitivity and lowest resources),\n" + + "\t-\"pseudo\" (balance between required resources and sensitivity),\n" + + "\t-\"pooled\" (highest sensitivity and resources)." + error(error_string) + } + + if (params.double_primer && params.retain_untrimmed) { + error("Incompatible parameters `--double_primer` and `--retain_untrimmed` cannot be set at the same time.") + } + + if ( params.min_len_asv && params.max_len_asv && (params.min_len_asv > params.max_len_asv) ) { + error("Incompatible parameters: `--min_len_asv` may not be greater than `--max_len_asv`.") + } + + if ( params.skip_dada_quality && (params.trunclenf == null || params.trunclenr == null) ) { + error("Incompatible parameters: `--skip_dada_quality` may not be used without setting `--trunclenf` and `--trunclenr`.") + } + + if (params.tax_agglom_min > params.tax_agglom_max) { + error("Incompatible parameters: `--tax_agglom_min` may not be greater than `--tax_agglom_max`.") + } + + if (!params.dada_ref_tax_custom && params.dada_ref_tax_custom_sp) { + error("Incompatible parameters: `--dada_ref_tax_custom_sp` requires `--dada_ref_tax_custom`.") + } + + if (params.dada_ref_tax_custom && !params.dada_ref_tax_custom_sp && !params.skip_dada_addspecies) { + error("Incompatible parameters: Either `--skip_dada_addspecies` or `--dada_ref_tax_custom_sp` is additionally required to `--dada_ref_tax_custom`.") + } + + if (params.pplace_tree) { + if (!params.pplace_aln) { + error("Missing parameter: Phylogenetic placement requires in addition to `--pplace_tree` also `--pplace_aln`.") + } + if (!params.pplace_model) { + error("Missing parameter: Phylogenetic placement requires in addition to `--pplace_tree` also `--pplace_model`.") + } + } + + if (params.dada_assign_taxlevels && params.sbdiexport && !params.sintax_ref_taxonomy) { + error("Incompatible parameters: `--sbdiexport` expects specific taxonomics ranks (default) and therefore excludes modifying those using `--dada_assign_taxlevels`.") + } + + if (params.skip_taxonomy && params.sbdiexport) { + error("Incompatible parameters: `--sbdiexport` expects taxa annotation and therefore excludes `--skip_taxonomy`.") + } + + if (params.skip_dada_taxonomy && params.sbdiexport) { + if (!params.sintax_ref_taxonomy && (params.skip_qiime || (!params.qiime_ref_taxonomy && !params.qiime_ref_tax_custom))) { + error("Incompatible parameters: `--sbdiexport` expects taxa annotation and therefore annotation with either DADA2, SINTAX, or QIIME2 is needed.") + } + } + + if ( (!params.FW_primer || !params.RV_primer) && (params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && !params.skip_qiime && !params.skip_taxonomy ) { + error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for cutting the QIIME2 reference database to the amplicon sequences. Please specify primers or do not use `--qiime_ref_taxonomy`.") + } + + if ( (!params.FW_primer || !params.RV_primer) && params.cut_dada_ref_taxonomy && !params.skip_taxonomy ) { + error("Incompatible parameters: `--FW_primer` and `--RV_primer` are required for cutting the DADA2 reference database to the amplicon sequences. Please specify primers or do not use `--cut_dada_ref_taxonomy`.") + } + + if ((params.qiime_ref_taxonomy || params.qiime_ref_tax_custom) && params.classifier) { + error("Incompatible parameters: `--qiime_ref_taxonomy` and `--qiime_ref_tax_custom` will produce a classifier but `--classifier` points to a precomputed classifier, therefore, only use one of those.") + } + + if (params.kraken2_ref_tax_custom && !params.kraken2_assign_taxlevels ) { + error("Missing parameter: Taxonomic classification with a user provided database via `--kraken2_ref_tax_custom` requires `--kraken2_assign_taxlevels`") + } + + if (params.filter_ssu && params.skip_barrnap) { + error("Incompatible parameters: `--filter_ssu` cannot be used with `--skip_barrnap` because filtering for SSU's depends on barrnap.") + } + + String[] sbdi_compatible_databases = ["coidb","coidb=221216","gtdb","gtdb=R08-RS214","gtdb=R07-RS207","gtdb=R06-RS202","gtdb=R05-RS95","midori2-co1","midori2-co1=gb250","pr2","pr2=5.0.0","pr2=4.14.0","pr2=4.13.0","rdp","rdp=18","sbdi-gtdb","sbdi-gtdb=R07-RS207-1","silva","silva=138","silva=132","unite-fungi","unite-fungi=9.0","unite-fungi=8.3","unite-fungi=8.2","unite-alleuk","unite-alleuk=9.0","unite-alleuk=8.3","unite-alleuk=8.2"] + if (params.sbdiexport){ + if (params.sintax_ref_taxonomy ) { + if (!Arrays.stream(sbdi_compatible_databases).anyMatch(entry -> params.sintax_ref_taxonomy.toString().equals(entry)) ) { + error("Incompatible parameters: `--sbdiexport` does not work with the chosen database of `--sintax_ref_taxonomy` because the expected taxonomic levels do not match.") + } + } else if (!Arrays.stream(sbdi_compatible_databases).anyMatch(entry -> params.dada_ref_taxonomy.toString().equals(entry)) ) { + error("Incompatible parameters: `--sbdiexport` does not work with the chosen database of `--dada_ref_taxonomy` because the expected taxonomic levels do not match.") + } + } + + if (params.addsh && !params.dada_ref_databases[params.dada_ref_taxonomy]["shfile"]) { + def validDBs = "" + for (db in params.dada_ref_databases.keySet()) { + if (params.dada_ref_databases[db]["shfile"]) { + validDBs += " " + db + } + } + error("UNITE species hypothesis information is not available for the selected reference database, please use the option `--dada_ref_taxonomy` to select an appropriate database. Currently, the option `--addsh` can only be used together with the following UNITE reference databases:\n" + validDBs + ".") + } + + if (params.addsh && params.cut_its == "none") { + log.warn "Adding UNITE species hypothesis (SH) assignments is only feasible for ITS sequences. Please use option `--cut_its` to find ITS regions in the ASV sequences, unless the given sequences are already cut to the ITS region.\n" + } + + // Error message for incompatible combination of --orf_start and --orf_end + if ( params.orf_end && ( ( ( params.orf_end + 1 ) - params.orf_start ) % 3 != 0 ) ) { + error("Incompatible parameters: The difference of `--orf_end` and `--orf_start` must be a multiple of 3.") + } + + // When multi-region analysis is used, some parameter combinations are required or not allowed: + if ( params.multiregion ) { + if ( !params.sidle_ref_taxonomy && !params.sidle_ref_tree_custom ) { + log.warn "Missing parameter: Either use `--sidle_ref_taxonomy` or `--sidle_ref_tree_custom` to get (unified) taxonomic classifications" + } + if ( (params.dada_ref_tax_custom || params.dada_ref_taxonomy) && !params.skip_dada_taxonomy ) { + error("Incompatible parameters: Multiple region analysis with `--multiregion` does not work with `--dada_ref_tax_custom`, `--dada_ref_taxonomy`") + } + if ( params.cut_its != "none" ) { + error("Incompatible parameters: Multiple region analysis with `--multiregion` does not work with `--cut_its`") + } + if ( params.vsearch_cluster || params.filter_ssu || params.min_len_asv || params.max_len_asv || params.filter_codons ) { + log.warn "Incompatible parameters: Multiple region analysis with `--multiregion` ignores any of `--vsearch_cluster`, `--filter_ssu`, `--min_len_asv`, `--max_len_asv`, `--filter_codons`, `--cut_its`" + } + } +} + +// +// Prepare complement sequence - ultimately to make reverse complement primers +// Complement table taken from http://arep.med.harvard.edu/labgc/adnan/projects/Utilities/revcomp.html +def makeComplement(seq) { + def complements = [ A:'T', T:'A', U:'A', G:'C', C:'G', Y:'R', R:'Y', S:'S', W:'W', K:'M', M:'K', B:'V', D:'H', H:'D', V:'B', N:'N' ] + def comp = seq.toUpperCase().collect { base -> complements[ base ] ?: 'X' }.join() + return comp +} + +// +// Exit pipeline if incorrect --dada_ref_taxonomy key provided +// +def dadareftaxonomyExistsError() { + if (params.dada_ref_databases && params.dada_ref_taxonomy && !params.dada_ref_databases.containsKey(params.dada_ref_taxonomy)) { + def error_string = "=============================================================================\n" + + " DADA2 reference database '${params.dada_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + + " Currently, the available reference taxonomy keys for `--dada_ref_taxonomy` are:\n" + + " ${params.dada_ref_databases.keySet().join(", ")}\n" + + "===================================================================================" + error(error_string) + } +} + +// +// Exit pipeline if incorrect --sintax_ref_taxonomy key provided +// +def sintaxreftaxonomyExistsError() { + if (params.sintax_ref_databases && params.sintax_ref_taxonomy && !params.sintax_ref_databases.containsKey(params.sintax_ref_taxonomy)) { + def error_string = "=============================================================================\n" + + " SINTAX reference database '${params.sintax_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + + " Currently, the available reference taxonomy keys for `--sintax_ref_taxonomy` are:\n" + + " ${params.sintax_ref_databases.keySet().join(", ")}\n" + + "===================================================================================" + error(error_string) + } +} + +// +// Exit pipeline if incorrect --qiime_ref_taxonomy key provided +// +def qiimereftaxonomyExistsError() { + if (params.qiime_ref_databases && params.qiime_ref_taxonomy && !params.qiime_ref_databases.containsKey(params.qiime_ref_taxonomy)) { + def error_string = "=============================================================================\n" + + " QIIME2 reference database '${params.qiime_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + + " Currently, the available reference taxonomy keys for `--qiime_ref_taxonomy` are:\n" + + " ${params.qiime_ref_databases.keySet().join(", ")}\n" + + "===================================================================================" + error(error_string) + } +} + +// +// Exit pipeline if incorrect --kraken2_ref_taxonomy key provided +// +def kraken2reftaxonomyExistsError() { + if (params.kraken2_ref_databases && params.kraken2_ref_taxonomy && !params.kraken2_ref_databases.containsKey(params.kraken2_ref_taxonomy)) { + def error_string = "=============================================================================\n" + + " Kraken2 reference database '${params.kraken2_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + + " Currently, the available reference taxonomy keys for `--kraken2_ref_taxonomy` are:\n" + + " ${params.kraken2_ref_databases.keySet().join(", ")}\n" + + "===================================================================================" + error(error_string) + } +} + +// +// Exit pipeline if incorrect --sidle_ref_taxonomy key provided +// +def sidlereftaxonomyExistsError() { + if (params.sidle_ref_databases && params.sidle_ref_taxonomy && !params.sidle_ref_databases.containsKey(params.sidle_ref_taxonomy)) { + def error_string = "=============================================================================\n" + + " Sidle reference database '${params.sidle_ref_taxonomy}' not found in any config file provided to the pipeline.\n" + + " Currently, the available reference taxonomy keys for `--sidle_ref_taxonomy` are:\n" + + " ${params.sidle_ref_databases.keySet().join(", ")}\n" + + "===================================================================================" + error(error_string) + } +} + +// +// Validate channels from input samplesheet +// +def validateInputSamplesheet(input) { + def (metas, fastqs) = input[1..2] + + // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end + def endedness_ok = metas.collect{ it.single_end }.unique().size == 1 + if (!endedness_ok) { + error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") + } + + return [ metas[0], fastqs ] +} + +// +// Generate methods description for MultiQC +// +def toolCitationText() { + // TODO nf-core: Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text +} + +def toolBibliographyText() { + // TODO nf-core: Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
    • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " + ].join(' ').trim() + + return reference_text +} + +def methodsDescriptionText(mqc_methods_yaml) { + // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file + def meta = [:] + meta.workflow = workflow.toMap() + meta["manifest_map"] = workflow.manifest.toMap() + + // Pipeline DOI + meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" + meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " + + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO nf-core: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + // meta["tool_citations"] = toolCitationText().replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + // meta["tool_bibliography"] = toolBibliographyText() + + + def methods_text = mqc_methods_yaml.text + + def engine = new groovy.text.SimpleTemplateEngine() + def description_html = engine.createTemplate(methods_text).make(meta) + + return description_html.toString() +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf new file mode 100644 index 000000000..ac31f28f6 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -0,0 +1,126 @@ +// +// Subworkflow with functionality that may be useful for any Nextflow pipeline +// + +import org.yaml.snakeyaml.Yaml +import groovy.json.JsonOutput +import nextflow.extension.FilesEx + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NEXTFLOW_PIPELINE { + + take: + print_version // boolean: print version + dump_parameters // boolean: dump parameters + outdir // path: base directory used to publish pipeline results + check_conda_channels // boolean: check conda channels + + main: + + // + // Print workflow version and exit on --version + // + if (print_version) { + log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + System.exit(0) + } + + // + // Dump pipeline parameters to a JSON file + // + if (dump_parameters && outdir) { + dumpParametersToJSON(outdir) + } + + // + // When running with Conda, warn if channels have not been set-up appropriately + // + if (check_conda_channels) { + checkCondaChannels() + } + + emit: + dummy_emit = true +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ + +// +// Generate version string +// +def getWorkflowVersion() { + String version_string = "" + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Dump pipeline parameters to a JSON file +// +def dumpParametersToJSON(outdir) { + def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = JsonOutput.toJson(params) + temp_pf.text = JsonOutput.prettyPrint(jsonStr) + + FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + temp_pf.delete() +} + +// +// When running with -profile conda, warn if channels have not been set-up appropriately +// +def checkCondaChannels() { + Yaml parser = new Yaml() + def channels = [] + try { + def config = parser.load("conda config --show channels".execute().text) + channels = config.channels + } catch(NullPointerException | IOException e) { + log.warn "Could not verify conda channel configuration." + return + } + + // Check that all channels are present + // This channel list is ordered by required channel priority. + def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean + + // Check that they are in the right order + def channel_priority_violation = false + def n = required_channels_in_order.size() + for (int i = 0; i < n - 1; i++) { + channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) + } + + if (channels_missing | channel_priority_violation) { + log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + " There is a problem with your Conda configuration!\n\n" + + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + + " Please refer to https://bioconda.github.io/\n" + + " The observed channel order is \n" + + " ${channels}\n" + + " but the following channel order is required:\n" + + " ${required_channels_in_order}\n" + + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml new file mode 100644 index 000000000..e5c3a0a82 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml @@ -0,0 +1,38 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NEXTFLOW_PIPELINE" +description: Subworkflow with functionality that may be useful for any Nextflow pipeline +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - print_version: + type: boolean + description: | + Print the version of the pipeline and exit + - dump_parameters: + type: boolean + description: | + Dump the parameters of the pipeline to a JSON file + - output_directory: + type: directory + description: Path to output dir to write JSON file to. + pattern: "results/" + - check_conda_channel: + type: boolean + description: | + Check if the conda channel priority is correct. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" + - "@drpatelh" +maintainers: + - "@adamrtalbot" + - "@drpatelh" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test new file mode 100644 index 000000000..68718e4f5 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test @@ -0,0 +1,54 @@ + +nextflow_function { + + name "Test Functions" + script "subworkflows/nf-core/utils_nextflow_pipeline/main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Test Function getWorkflowVersion") { + + function "getWorkflowVersion" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dumpParametersToJSON") { + + function "dumpParametersToJSON" + + when { + function { + """ + // define inputs of the function here. Example: + input[0] = "$outputDir" + """.stripIndent() + } + } + + then { + assertAll( + { assert function.success } + ) + } + } + + test("Test Function checkCondaChannels") { + + function "checkCondaChannels" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 000000000..e3f0baf47 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,20 @@ +{ + "Test Function getWorkflowVersion": { + "content": [ + "v9.9.9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:05.308243" + }, + "Test Function checkCondaChannels": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:12.425833" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test new file mode 100644 index 000000000..ca964ce8e --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,111 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NEXTFLOW_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + workflow "UTILS_NEXTFLOW_PIPELINE" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Should run no inputs") { + + when { + workflow { + """ + print_version = false + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should print version") { + + when { + workflow { + """ + print_version = true + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.stdout.contains("nextflow_workflow v9.9.9") } + ) + } + } + + test("Should dump params") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = 'results' + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should not create params JSON if no output directory") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = null + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config new file mode 100644 index 000000000..d0a926bf6 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml new file mode 100644 index 000000000..f84761125 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nextflow_pipeline: + - subworkflows/nf-core/utils_nextflow_pipeline/** diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf new file mode 100644 index 000000000..a8b55d6fe --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -0,0 +1,440 @@ +// +// Subworkflow with utility functions specific to the nf-core pipeline template +// + +import org.yaml.snakeyaml.Yaml +import nextflow.extension.FilesEx + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NFCORE_PIPELINE { + + take: + nextflow_cli_args + + main: + valid_config = checkConfigProvided() + checkProfileProvided(nextflow_cli_args) + + emit: + valid_config +} + +/* +======================================================================================== + FUNCTIONS +======================================================================================== +*/ + +// +// Warn if a -profile or Nextflow config has not been provided to run the pipeline +// +def checkConfigProvided() { + valid_config = true + if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { + log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + + "Please refer to the quick start section and usage docs for the pipeline.\n " + valid_config = false + } + return valid_config +} + +// +// Exit pipeline if --profile contains spaces +// +def checkProfileProvided(nextflow_cli_args) { + if (workflow.profile.endsWith(',')) { + error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + } + if (nextflow_cli_args[0]) { + log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + } +} + +// +// Citation string for pipeline +// +def workflowCitation() { + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + + "* The pipeline\n" + + " ${workflow.manifest.doi}\n\n" + + "* The nf-core framework\n" + + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + + "* Software dependencies\n" + + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" +} + +// +// Generate workflow version string +// +def getWorkflowVersion() { + String version_string = "" + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Get software versions for pipeline +// +def processVersionsFromYAML(yaml_file) { + Yaml yaml = new Yaml() + versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + return yaml.dumpAsMap(versions).trim() +} + +// +// Get workflow version for pipeline +// +def workflowVersionToYAML() { + return """ + Workflow: + $workflow.manifest.name: ${getWorkflowVersion()} + Nextflow: $workflow.nextflow.version + """.stripIndent().trim() +} + +// +// Get channel of software versions used in pipeline in YAML format +// +def softwareVersionsToYAML(ch_versions) { + return ch_versions + .unique() + .map { processVersionsFromYAML(it) } + .unique() + .mix(Channel.of(workflowVersionToYAML())) +} + +// +// Get workflow summary for MultiQC +// +def paramsSummaryMultiqc(summary_params) { + def summary_section = '' + for (group in summary_params.keySet()) { + def group_params = summary_params.get(group) // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    $group

    \n" + summary_section += "
    \n" + for (param in group_params.keySet()) { + summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" + } + } + + String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" + + return yaml_file_text +} + +// +// nf-core logo +// +def nfCoreLogo(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + String.format( + """\n + ${dashedLine(monochrome_logs)} + ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} + ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} + ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} + ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} + ${colors.green}`._,._,\'${colors.reset} + ${colors.purple} ${workflow.manifest.name} ${getWorkflowVersion()}${colors.reset} + ${dashedLine(monochrome_logs)} + """.stripIndent() + ) +} + +// +// Return dashed line +// +def dashedLine(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + return "-${colors.dim}----------------------------------------------------${colors.reset}-" +} + +// +// ANSII colours used for terminal logging +// +def logColours(monochrome_logs=true) { + Map colorcodes = [:] + + // Reset / Meta + colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" + colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" + colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" + colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" + colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" + colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" + colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" + + // Regular Colors + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + + // Bold + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + + // Underline + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + + // High Intensity + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + + // Bold High Intensity + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + + return colorcodes +} + +// +// Attach the multiqc report to email +// +def attachMultiqcReport(multiqc_report) { + def mqc_report = null + try { + if (workflow.success) { + mqc_report = multiqc_report.getVal() + if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { + if (mqc_report.size() > 1) { + log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + } + mqc_report = mqc_report[0] + } + } + } catch (all) { + if (multiqc_report) { + log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + } + } + return mqc_report +} + +// +// Construct and send completion email +// +def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { + + // Set up the e-mail variables + def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + if (!workflow.success) { + subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + } + + def summary = [:] + for (group in summary_params.keySet()) { + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['Date Started'] = workflow.start + misc_fields['Date Completed'] = workflow.complete + misc_fields['Pipeline script file path'] = workflow.scriptFile + misc_fields['Pipeline script hash ID'] = workflow.scriptId + if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository + if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId + if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build + misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp + + def email_fields = [:] + email_fields['version'] = getWorkflowVersion() + email_fields['runName'] = workflow.runName + email_fields['success'] = workflow.success + email_fields['dateComplete'] = workflow.complete + email_fields['duration'] = workflow.duration + email_fields['exitStatus'] = workflow.exitStatus + email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + email_fields['errorReport'] = (workflow.errorReport ?: 'None') + email_fields['commandLine'] = workflow.commandLine + email_fields['projectDir'] = workflow.projectDir + email_fields['summary'] = summary << misc_fields + + // On success try attach the multiqc report + def mqc_report = attachMultiqcReport(multiqc_report) + + // Check if we are only sending emails on failure + def email_address = email + if (!email && email_on_fail && !workflow.success) { + email_address = email_on_fail + } + + // Render the TXT template + def engine = new groovy.text.GStringTemplateEngine() + def tf = new File("${workflow.projectDir}/assets/email_template.txt") + def txt_template = engine.createTemplate(tf).make(email_fields) + def email_txt = txt_template.toString() + + // Render the HTML template + def hf = new File("${workflow.projectDir}/assets/email_template.html") + def html_template = engine.createTemplate(hf).make(email_fields) + def email_html = html_template.toString() + + // Render the sendmail template + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit + def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") + def sendmail_template = engine.createTemplate(sf).make(smail_fields) + def sendmail_html = sendmail_template.toString() + + // Send the HTML e-mail + Map colors = logColours(monochrome_logs) + if (email_address) { + try { + if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + // Try to send HTML e-mail using sendmail + def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") + sendmail_tf.withWriter { w -> w << sendmail_html } + [ 'sendmail', '-t' ].execute() << sendmail_html + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" + } catch (all) { + // Catch failures and try with plaintext + def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + mail_cmd.execute() << email_html + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + } + } + + // Write summary e-mail HTML to a file + def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") + output_hf.withWriter { w -> w << email_html } + FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + output_hf.delete() + + // Write summary e-mail TXT to a file + def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") + output_tf.withWriter { w -> w << email_txt } + FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + output_tf.delete() +} + +// +// Print pipeline summary on completion +// +def completionSummary(monochrome_logs=true) { + Map colors = logColours(monochrome_logs) + if (workflow.success) { + if (workflow.stats.ignoredCount == 0) { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" + } else { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + } + } else { + log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } +} + +// +// Construct and send a notification to a web server as JSON e.g. Microsoft Teams and Slack +// +def imNotification(summary_params, hook_url) { + def summary = [:] + for (group in summary_params.keySet()) { + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) misc_fields['repository'] = workflow.repository + if (workflow.commitId) misc_fields['commitid'] = workflow.commitId + if (workflow.revision) misc_fields['revision'] = workflow.revision + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + + def msg_fields = [:] + msg_fields['version'] = getWorkflowVersion() + msg_fields['runName'] = workflow.runName + msg_fields['success'] = workflow.success + msg_fields['dateComplete'] = workflow.complete + msg_fields['duration'] = workflow.duration + msg_fields['exitStatus'] = workflow.exitStatus + msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + msg_fields['errorReport'] = (workflow.errorReport ?: 'None') + msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") + msg_fields['projectDir'] = workflow.projectDir + msg_fields['summary'] = summary << misc_fields + + // Render the JSON template + def engine = new groovy.text.GStringTemplateEngine() + // Different JSON depending on the service provider + // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format + def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" + def hf = new File("${workflow.projectDir}/assets/${json_path}") + def json_template = engine.createTemplate(hf).make(msg_fields) + def json_message = json_template.toString() + + // POST + def post = new URL(hook_url).openConnection(); + post.setRequestMethod("POST") + post.setDoOutput(true) + post.setRequestProperty("Content-Type", "application/json") + post.getOutputStream().write(json_message.getBytes("UTF-8")); + def postRC = post.getResponseCode(); + if (! postRC.equals(200)) { + log.warn(post.getErrorStream().getText()); + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml new file mode 100644 index 000000000..d08d24342 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml @@ -0,0 +1,24 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFCORE_PIPELINE" +description: Subworkflow with utility functions specific to the nf-core pipeline template +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - nextflow_cli_args: + type: list + description: | + Nextflow CLI positional arguments +output: + - success: + type: boolean + description: | + Dummy output to indicate success +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test new file mode 100644 index 000000000..1dc317f8f --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test @@ -0,0 +1,134 @@ + +nextflow_function { + + name "Test Functions" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Test Function checkConfigProvided") { + + function "checkConfigProvided" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function checkProfileProvided") { + + function "checkProfileProvided" + + when { + function { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function workflowCitation") { + + function "workflowCitation" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function nfCoreLogo") { + + function "nfCoreLogo" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dashedLine") { + + function "dashedLine" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function without logColours") { + + function "logColours" + + when { + function { + """ + input[0] = true + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function with logColours") { + function "logColours" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 000000000..1037232c9 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,166 @@ +{ + "Test Function checkProfileProvided": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:03.360873" + }, + "Test Function checkConfigProvided": { + "content": [ + true + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:59.729647" + }, + "Test Function nfCoreLogo": { + "content": [ + "\n\n-\u001b[2m----------------------------------------------------\u001b[0m-\n \u001b[0;32m,--.\u001b[0;30m/\u001b[0;32m,-.\u001b[0m\n\u001b[0;34m ___ __ __ __ ___ \u001b[0;32m/,-._.--~'\u001b[0m\n\u001b[0;34m |\\ | |__ __ / ` / \\ |__) |__ \u001b[0;33m} {\u001b[0m\n\u001b[0;34m | \\| | \\__, \\__/ | \\ |___ \u001b[0;32m\\`-._,-`-,\u001b[0m\n \u001b[0;32m`._,._,'\u001b[0m\n\u001b[0;35m nextflow_workflow v9.9.9\u001b[0m\n-\u001b[2m----------------------------------------------------\u001b[0m-\n" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:10.562934" + }, + "Test Function workflowCitation": { + "content": [ + "If you use nextflow_workflow for your analysis please cite:\n\n* The pipeline\n https://doi.org/10.5281/zenodo.5070524\n\n* The nf-core framework\n https://doi.org/10.1038/s41587-020-0439-x\n\n* Software dependencies\n https://github.com/nextflow_workflow/blob/master/CITATIONS.md" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:07.019761" + }, + "Test Function without logColours": { + "content": [ + { + "reset": "", + "bold": "", + "dim": "", + "underlined": "", + "blink": "", + "reverse": "", + "hidden": "", + "black": "", + "red": "", + "green": "", + "yellow": "", + "blue": "", + "purple": "", + "cyan": "", + "white": "", + "bblack": "", + "bred": "", + "bgreen": "", + "byellow": "", + "bblue": "", + "bpurple": "", + "bcyan": "", + "bwhite": "", + "ublack": "", + "ured": "", + "ugreen": "", + "uyellow": "", + "ublue": "", + "upurple": "", + "ucyan": "", + "uwhite": "", + "iblack": "", + "ired": "", + "igreen": "", + "iyellow": "", + "iblue": "", + "ipurple": "", + "icyan": "", + "iwhite": "", + "biblack": "", + "bired": "", + "bigreen": "", + "biyellow": "", + "biblue": "", + "bipurple": "", + "bicyan": "", + "biwhite": "" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:17.969323" + }, + "Test Function dashedLine": { + "content": [ + "-\u001b[2m----------------------------------------------------\u001b[0m-" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:14.366181" + }, + "Test Function with logColours": { + "content": [ + { + "reset": "\u001b[0m", + "bold": "\u001b[1m", + "dim": "\u001b[2m", + "underlined": "\u001b[4m", + "blink": "\u001b[5m", + "reverse": "\u001b[7m", + "hidden": "\u001b[8m", + "black": "\u001b[0;30m", + "red": "\u001b[0;31m", + "green": "\u001b[0;32m", + "yellow": "\u001b[0;33m", + "blue": "\u001b[0;34m", + "purple": "\u001b[0;35m", + "cyan": "\u001b[0;36m", + "white": "\u001b[0;37m", + "bblack": "\u001b[1;30m", + "bred": "\u001b[1;31m", + "bgreen": "\u001b[1;32m", + "byellow": "\u001b[1;33m", + "bblue": "\u001b[1;34m", + "bpurple": "\u001b[1;35m", + "bcyan": "\u001b[1;36m", + "bwhite": "\u001b[1;37m", + "ublack": "\u001b[4;30m", + "ured": "\u001b[4;31m", + "ugreen": "\u001b[4;32m", + "uyellow": "\u001b[4;33m", + "ublue": "\u001b[4;34m", + "upurple": "\u001b[4;35m", + "ucyan": "\u001b[4;36m", + "uwhite": "\u001b[4;37m", + "iblack": "\u001b[0;90m", + "ired": "\u001b[0;91m", + "igreen": "\u001b[0;92m", + "iyellow": "\u001b[0;93m", + "iblue": "\u001b[0;94m", + "ipurple": "\u001b[0;95m", + "icyan": "\u001b[0;96m", + "iwhite": "\u001b[0;97m", + "biblack": "\u001b[1;90m", + "bired": "\u001b[1;91m", + "bigreen": "\u001b[1;92m", + "biyellow": "\u001b[1;93m", + "biblue": "\u001b[1;94m", + "bipurple": "\u001b[1;95m", + "bicyan": "\u001b[1;96m", + "biwhite": "\u001b[1;97m" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:21.714424" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test new file mode 100644 index 000000000..8940d32d1 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,29 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFCORE_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + workflow "UTILS_NFCORE_PIPELINE" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Should run without failures") { + + when { + workflow { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap new file mode 100644 index 000000000..859d1030f --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap @@ -0,0 +1,19 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + true + ], + "valid_config": [ + true + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:25.726491" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config new file mode 100644 index 000000000..d0a926bf6 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml new file mode 100644 index 000000000..ac8523c9a --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfcore_pipeline: + - subworkflows/nf-core/utils_nfcore_pipeline/** diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf new file mode 100644 index 000000000..2585b65d1 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf @@ -0,0 +1,62 @@ +// +// Subworkflow that uses the nf-validation plugin to render help text and parameter summary +// + +/* +======================================================================================== + IMPORT NF-VALIDATION PLUGIN +======================================================================================== +*/ + +include { paramsHelp } from 'plugin/nf-validation' +include { paramsSummaryLog } from 'plugin/nf-validation' +include { validateParameters } from 'plugin/nf-validation' + +/* +======================================================================================== + SUBWORKFLOW DEFINITION +======================================================================================== +*/ + +workflow UTILS_NFVALIDATION_PLUGIN { + + take: + print_help // boolean: print help + workflow_command // string: default commmand used to run pipeline + pre_help_text // string: string to be printed before help text and summary log + post_help_text // string: string to be printed after help text and summary log + validate_params // boolean: validate parameters + schema_filename // path: JSON schema file, null to use default value + + main: + + log.debug "Using schema file: ${schema_filename}" + + // Default values for strings + pre_help_text = pre_help_text ?: '' + post_help_text = post_help_text ?: '' + workflow_command = workflow_command ?: '' + + // + // Print help message if needed + // + if (print_help) { + log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text + System.exit(0) + } + + // + // Print parameter summary to stdout + // + log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text + + // + // Validate parameters relative to the parameter JSON schema + // + if (validate_params){ + validateParameters(parameters_schema: schema_filename) + } + + emit: + dummy_emit = true +} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml new file mode 100644 index 000000000..3d4a6b04f --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml @@ -0,0 +1,44 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFVALIDATION_PLUGIN" +description: Use nf-validation to initiate and validate a pipeline +keywords: + - utility + - pipeline + - initialise + - validation +components: [] +input: + - print_help: + type: boolean + description: | + Print help message and exit + - workflow_command: + type: string + description: | + The command to run the workflow e.g. "nextflow run main.nf" + - pre_help_text: + type: string + description: | + Text to print before the help message + - post_help_text: + type: string + description: | + Text to print after the help message + - validate_params: + type: boolean + description: | + Validate the parameters and error if invalid. + - schema_filename: + type: string + description: | + The filename of the schema to validate against. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test new file mode 100644 index 000000000..5784a33f2 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test @@ -0,0 +1,200 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFVALIDATION_PLUGIN" + script "../main.nf" + workflow "UTILS_NFVALIDATION_PLUGIN" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "plugin/nf-validation" + tag "'plugin/nf-validation'" + tag "utils_nfvalidation_plugin" + tag "subworkflows/utils_nfvalidation_plugin" + + test("Should run nothing") { + + when { + + params { + monochrome_logs = true + test_data = '' + } + + workflow { + """ + help = false + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should run help") { + + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } } + ) + } + } + + test("Should run help with command") { + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = "nextflow run noorg/doesntexist" + pre_help_text = null + post_help_text = null + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } } + ) + } + } + + test("Should run help with extra text") { + + + when { + + params { + monochrome_logs = true + test_data = '' + } + workflow { + """ + help = true + workflow_command = "nextflow run noorg/doesntexist" + pre_help_text = "pre-help-text" + post_help_text = "post-help-text" + validate_params = false + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.exitStatus == 0 }, + { assert workflow.stdout.any { it.contains('pre-help-text') } }, + { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, + { assert workflow.stdout.any { it.contains('Input/output options') } }, + { assert workflow.stdout.any { it.contains('--outdir') } }, + { assert workflow.stdout.any { it.contains('post-help-text') } } + ) + } + } + + test("Should validate params") { + + when { + + params { + monochrome_logs = true + test_data = '' + outdir = 1 + } + workflow { + """ + help = false + workflow_command = null + pre_help_text = null + post_help_text = null + validate_params = true + schema_filename = "$moduleTestDir/nextflow_schema.json" + + input[0] = help + input[1] = workflow_command + input[2] = pre_help_text + input[3] = post_help_text + input[4] = validate_params + input[5] = schema_filename + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json new file mode 100644 index 000000000..7626c1c93 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json @@ -0,0 +1,96 @@ +{ + "$schema": "http://json-schema.org/draft-07/schema", + "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", + "title": ". pipeline parameters", + "description": "", + "type": "object", + "definitions": { + "input_output_options": { + "title": "Input/output options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define where the pipeline should find input data and save output data.", + "required": ["outdir"], + "properties": { + "validate_params": { + "type": "boolean", + "description": "Validate parameters?", + "default": true, + "hidden": true + }, + "outdir": { + "type": "string", + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open" + }, + "test_data_base": { + "type": "string", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/modules", + "description": "Base for test data directory", + "hidden": true + }, + "test_data": { + "type": "string", + "description": "Fake test data param", + "hidden": true + } + } + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "help": { + "type": "boolean", + "description": "Display help text.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "logo": { + "type": "boolean", + "default": true, + "description": "Display nf-core logo in console output.", + "fa_icon": "fas fa-image", + "hidden": true + }, + "singularity_pull_docker_container": { + "type": "boolean", + "description": "Pull Singularity container from Docker?", + "hidden": true + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Use monochrome_logs", + "hidden": true + } + } + } + }, + "allOf": [ + { + "$ref": "#/definitions/input_output_options" + }, + { + "$ref": "#/definitions/generic_options" + } + ] +} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml new file mode 100644 index 000000000..60b1cfff4 --- /dev/null +++ b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfvalidation_plugin: + - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/tests/pipeline/doubleprimers.nf.test b/tests/pipeline/doubleprimers.nf.test index 3925c9889..2b81571cf 100644 --- a/tests/pipeline/doubleprimers.nf.test +++ b/tests/pipeline/doubleprimers.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/doubleprimers.nf.test.snap b/tests/pipeline/doubleprimers.nf.test.snap index 81545d788..159fe53fa 100644 --- a/tests/pipeline/doubleprimers.nf.test.snap +++ b/tests/pipeline/doubleprimers.nf.test.snap @@ -11,12 +11,6 @@ ], "timestamp": "2023-05-28T21:08:54+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, FILTER_STATS={pandas=1.1.5, python=3.9.1}, KRAKEN2_KRAKEN2={kraken2=2.1.2, pigz=2.6}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-07-27T13:49:03+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,19d8b19b8f406d238011c2b3d384b7d3" diff --git a/tests/pipeline/fasta.nf.test b/tests/pipeline/fasta.nf.test index 35408ce6d..23e7e6e08 100644 --- a/tests/pipeline/fasta.nf.test +++ b/tests/pipeline/fasta.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/asv_length_filter/ASV_len_filt.tsv"), path("$outputDir/asv_length_filter/ASV_len_orig.tsv"), path("$outputDir/asv_length_filter/ASV_seqs.len.fasta"), diff --git a/tests/pipeline/fasta.nf.test.snap b/tests/pipeline/fasta.nf.test.snap index 00351b323..b2df9e6d9 100644 --- a/tests/pipeline/fasta.nf.test.snap +++ b/tests/pipeline/fasta.nf.test.snap @@ -5,12 +5,6 @@ ], "timestamp": "2023-05-28T21:06:17+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FILTER_CODONS={pandas=1.1.5, python=3.9.1}, FILTER_LEN_ASV={Biostrings=2.58.0, R=4.0.3}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T21:06:17+0000" - }, "dada2": { "content": [ "ref_taxonomy.rdp_18.txt:md5,815c4fce9f3d1de019fb995a43fb66ed" diff --git a/tests/pipeline/iontorrent.nf.test b/tests/pipeline/iontorrent.nf.test index 200a98251..98d1618f5 100644 --- a/tests/pipeline/iontorrent.nf.test +++ b/tests/pipeline/iontorrent.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), @@ -27,11 +27,9 @@ nextflow_pipeline { { assert snapshot(path("$outputDir/dada2/ASV_seqs.fasta"), path("$outputDir/dada2/ASV_table.tsv"), path("$outputDir/dada2/DADA2_stats.tsv"), - path("$outputDir/dada2/ref_taxonomy.unite-fungi_8_3.txt"), path("$outputDir/dada2/DADA2_table.rds"), path("$outputDir/dada2/DADA2_table.tsv")).match("dada2") }, - { assert new File("$outputDir/dada2/ASV_tax.unite-fungi_8_3.tsv").exists() }, - { assert new File("$outputDir/dada2/ASV_tax_species.unite-fungi_8_3.tsv").exists() }, + { assert new File("$outputDir/sintax/ASV_tax_sintax.unite-fungi_8_2.tsv").exists() }, { assert new File("$outputDir/fastqc/it1_fastqc.html").exists() }, { assert new File("$outputDir/fastqc/it2_fastqc.html").exists() }, { assert new File("$outputDir/fastqc/it3_fastqc.html").exists() }, @@ -40,7 +38,7 @@ nextflow_pipeline { path("$outputDir/multiqc/multiqc_data/multiqc_general_stats.txt"), path("$outputDir/multiqc/multiqc_data/multiqc_cutadapt.txt")).match("multiqc") }, { assert new File("$outputDir/summary_report/summary_report.html").exists() }, - { assert new File("$outputDir/phyloseq/dada2_phyloseq.rds").exists() } + { assert new File("$outputDir/phyloseq/sintax_phyloseq.rds").exists() } ) } } diff --git a/tests/pipeline/iontorrent.nf.test.snap b/tests/pipeline/iontorrent.nf.test.snap index 27f6d930a..1a98d70f0 100644 --- a/tests/pipeline/iontorrent.nf.test.snap +++ b/tests/pipeline/iontorrent.nf.test.snap @@ -11,12 +11,6 @@ ], "timestamp": "2023-06-20T01:42:35+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-06-20T01:42:35+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,a7d1d93ad079ec0ea2479126dba0a607" @@ -28,7 +22,6 @@ "ASV_seqs.fasta:md5,24a69ad674c0b99882d095f6e8afdc03", "ASV_table.tsv:md5,bd99a0696aa853c0d12c2870ec9fb987", "DADA2_stats.tsv:md5,f543f7445bbb3941138166615fcf4866", - "ref_taxonomy.unite-fungi_8_3.txt:md5,0f0f24c6c937cfe315f7f490ecdf9af4", "DADA2_table.rds:md5,bbbe293f2e03869cbe6b8f6b15ea0ed8", "DADA2_table.tsv:md5,d92684c4ac57c34341171f1dffccb4d6" ], diff --git a/tests/pipeline/multi.nf.test b/tests/pipeline/multi.nf.test index 3e01ff202..59dd21b57 100644 --- a/tests/pipeline/multi.nf.test +++ b/tests/pipeline/multi.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/multi.nf.test.snap b/tests/pipeline/multi.nf.test.snap index 4a8d2afc0..69dcdde54 100644 --- a/tests/pipeline/multi.nf.test.snap +++ b/tests/pipeline/multi.nf.test.snap @@ -12,12 +12,6 @@ ], "timestamp": "2023-05-28T21:15:03+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, FILTER_STATS={pandas=1.1.5, python=3.9.1}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T21:15:03+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,cc01727705136cc5d096d373237e1e06" diff --git a/tests/pipeline/novaseq.nf.test b/tests/pipeline/novaseq.nf.test index a346898d7..6efdf118f 100644 --- a/tests/pipeline/novaseq.nf.test +++ b/tests/pipeline/novaseq.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/dada2/ASV_seqs.fasta"), path("$outputDir/dada2/ASV_table.tsv"), path("$outputDir/dada2/DADA2_stats.tsv"), diff --git a/tests/pipeline/novaseq.nf.test.snap b/tests/pipeline/novaseq.nf.test.snap index 7a294cec5..2b6aea337 100644 --- a/tests/pipeline/novaseq.nf.test.snap +++ b/tests/pipeline/novaseq.nf.test.snap @@ -5,12 +5,6 @@ ], "timestamp": "2023-06-20T00:10:02+0000" }, - "software_versions": { - "content": [ - "{CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, FILTER_CODONS={pandas=1.1.5, python=3.9.1}, RENAME_RAW_DATA_FILES={sed=4.7}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-06-20T00:10:02+0000" - }, "dada2": { "content": [ "ASV_seqs.fasta:md5,60c7cc4669df672109fce853dfa874fd", diff --git a/tests/pipeline/pacbio_its.nf.test b/tests/pipeline/pacbio_its.nf.test index ffe4b31c2..e40929209 100644 --- a/tests/pipeline/pacbio_its.nf.test +++ b/tests/pipeline/pacbio_its.nf.test @@ -16,10 +16,8 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, - { assert snapshot(path("$outputDir/assignsh/ASV_tax_species_SH.unite-fungi_8_3.tsv")).match("assignsh") }, - { assert new File("$outputDir/assignsh/ASV_ITS_tax.vsearch.txt").exists() }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), path("$outputDir/barrnap/rrna.euk.gff"), @@ -31,12 +29,10 @@ nextflow_pipeline { { assert new File("$outputDir/cutadapt/pb3.trimmed.cutadapt.log").exists() }, { assert snapshot(path("$outputDir/dada2/ASV_seqs.fasta"), path("$outputDir/dada2/ASV_table.tsv"), - path("$outputDir/dada2/ref_taxonomy.unite-fungi_8_3.txt"), path("$outputDir/dada2/DADA2_stats.tsv"), path("$outputDir/dada2/DADA2_table.rds"), path("$outputDir/dada2/DADA2_table.tsv")).match("dada2") }, - { assert new File("$outputDir/dada2/ASV_tax.unite-fungi_8_3.tsv").exists() }, - { assert new File("$outputDir/dada2/ASV_tax_species.unite-fungi_8_3.tsv").exists() }, + { assert new File("$outputDir/sintax/ASV_tax_sintax.unite-fungi_8_2.tsv").exists() }, { assert new File("$outputDir/fastqc/pb1_fastqc.html").exists() }, { assert new File("$outputDir/fastqc/pb2_fastqc.html").exists() }, { assert new File("$outputDir/fastqc/pb3_fastqc.html").exists() }, @@ -54,7 +50,7 @@ nextflow_pipeline { { assert new File("$outputDir/SBDI/annotation.tsv").exists() }, { assert new File("$outputDir/SBDI/asv-table.tsv").exists() }, { assert new File("$outputDir/summary_report/summary_report.html").exists() }, - { assert new File("$outputDir/phyloseq/dada2_phyloseq.rds").exists() } + { assert new File("$outputDir/phyloseq/sintax_phyloseq.rds").exists() } ) } } diff --git a/tests/pipeline/pacbio_its.nf.test.snap b/tests/pipeline/pacbio_its.nf.test.snap index 74f31f81d..c453cd5a7 100644 --- a/tests/pipeline/pacbio_its.nf.test.snap +++ b/tests/pipeline/pacbio_its.nf.test.snap @@ -33,12 +33,6 @@ ], "timestamp": "2023-06-20T02:07:02+0000" }, - "software_versions": { - "content": [ - "{ASSIGNSH={pandas=1.1.5, python=3.9.1}, BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, FORMAT_TAXRESULTS_STD={pandas=1.1.5, python=3.9.1}, ITSX_CUTASV={ITSx=1.1.3}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, SBDIEXPORT={R=3.6.3}, VSEARCH_USEARCHGLOBAL={vsearch=2.21.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-06-20T02:07:02+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,97a8ee12c40a0bc582ba1cefda117f95" @@ -49,7 +43,6 @@ "content": [ "ASV_seqs.fasta:md5,a2632b1cc533d290db19ceedaf350dcd", "ASV_table.tsv:md5,6de5507a0fcb0c9b03f8fec0270440be", - "ref_taxonomy.unite-fungi_8_3.txt:md5,0f0f24c6c937cfe315f7f490ecdf9af4", "DADA2_stats.tsv:md5,4bbde0bbf579f60e692bd32d14034f0d", "DADA2_table.rds:md5,a36558c04a7b21050bb6e479b09bd483", "DADA2_table.tsv:md5,7e7aab7ae9a3b20fb08f3fe7f8b0430c" diff --git a/tests/pipeline/pplace.nf.test b/tests/pipeline/pplace.nf.test index 781d3dcd9..0c6f4f67a 100644 --- a/tests/pipeline/pplace.nf.test +++ b/tests/pipeline/pplace.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/pplace.nf.test.snap b/tests/pipeline/pplace.nf.test.snap index 35a33476e..cd9a46118 100644 --- a/tests/pipeline/pplace.nf.test.snap +++ b/tests/pipeline/pplace.nf.test.snap @@ -6,12 +6,6 @@ ], "timestamp": "2023-06-20T17:24:03+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, EPANG_PLACE={epang=0.3.8}, FILTER_STATS={pandas=1.1.5, python=3.9.1}, GAPPA_ASSIGN={gappa=0.8.0}, GAPPA_GRAFT={gappa=0.8.0}, GAPPA_HEATTREE={gappa=0.8.0}, HMMER_AFAFORMATQUERY={hmmer/easel=0.48}, HMMER_AFAFORMATREF={hmmer/easel=0.48}, HMMER_HMMALIGNQUERY={hmmer=3.3.2}, HMMER_HMMALIGNREF={hmmer=3.3.2}, HMMER_HMMBUILD={hmmer=3.3.2}, HMMER_MASKQUERY={hmmer/easel=0.48}, HMMER_MASKREF={hmmer/easel=0.48}, HMMER_UNALIGNREF={hmmer/easel=0.48}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, QIIME2_INSEQ={qiime2=2023.7.0}, RENAME_RAW_DATA_FILES={sed=4.7}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-06-20T17:24:03+0000" - }, "cutadapt": { "content": [ "cutadapt_summary.tsv:md5,5d02749984a811479e7d534fda75163f" diff --git a/tests/pipeline/qiimecustom.nf.test b/tests/pipeline/qiimecustom.nf.test index 493968153..965f5e842 100644 --- a/tests/pipeline/qiimecustom.nf.test +++ b/tests/pipeline/qiimecustom.nf.test @@ -17,7 +17,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/qiimecustom.nf.test.snap b/tests/pipeline/qiimecustom.nf.test.snap index 9bbb27a3a..8c96a24cf 100644 --- a/tests/pipeline/qiimecustom.nf.test.snap +++ b/tests/pipeline/qiimecustom.nf.test.snap @@ -11,12 +11,6 @@ ], "timestamp": "2023-05-28T21:18:54+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, QIIME2_INSEQ={qiime2=2023.7.0}, RENAME_RAW_DATA_FILES={sed=4.7}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T21:18:54+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,3231d6ee72b9a1e7742e5605caaff05a" diff --git a/tests/pipeline/reftaxcustom.nf.test b/tests/pipeline/reftaxcustom.nf.test index dba78c126..0fc2ab4de 100644 --- a/tests/pipeline/reftaxcustom.nf.test +++ b/tests/pipeline/reftaxcustom.nf.test @@ -17,7 +17,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/reftaxcustom.nf.test.snap b/tests/pipeline/reftaxcustom.nf.test.snap index 077b9391f..161250d14 100644 --- a/tests/pipeline/reftaxcustom.nf.test.snap +++ b/tests/pipeline/reftaxcustom.nf.test.snap @@ -11,12 +11,6 @@ ], "timestamp": "2023-05-28T21:18:54+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, KRAKEN2_KRAKEN2={kraken2=2.1.2, pigz=2.6}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, QIIME2_INSEQ={qiime2=2023.7.0}, RENAME_RAW_DATA_FILES={sed=4.7}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T21:18:54+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,3231d6ee72b9a1e7742e5605caaff05a" diff --git a/tests/pipeline/single.nf.test b/tests/pipeline/single.nf.test index 11bb91569..add750b94 100644 --- a/tests/pipeline/single.nf.test +++ b/tests/pipeline/single.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/single.nf.test.snap b/tests/pipeline/single.nf.test.snap index b73d8e39e..fdbe15dea 100644 --- a/tests/pipeline/single.nf.test.snap +++ b/tests/pipeline/single.nf.test.snap @@ -11,12 +11,6 @@ ], "timestamp": "2023-08-16T20:35:33+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T20:35:33+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,9c37a0292537273537640cdb0dd8fba5" diff --git a/tests/pipeline/sintax.nf.test b/tests/pipeline/sintax.nf.test index f4ff3a4f1..03490f18e 100644 --- a/tests/pipeline/sintax.nf.test +++ b/tests/pipeline/sintax.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/barrnap/rrna.arc.gff"), path("$outputDir/barrnap/rrna.bac.gff"), diff --git a/tests/pipeline/sintax.nf.test.snap b/tests/pipeline/sintax.nf.test.snap index 749ba2175..002e77d7f 100644 --- a/tests/pipeline/sintax.nf.test.snap +++ b/tests/pipeline/sintax.nf.test.snap @@ -14,12 +14,6 @@ ], "timestamp": "2023-06-20T16:40:18+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, FILTER_STATS={pandas=1.1.5, python=3.9.1}, ITSX_CUTASV={ITSx=1.1.3}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, RENAME_RAW_DATA_FILES={sed=4.7}, SBDIEXPORT={R=3.6.3}, VSEARCH_SINTAX={vsearch=2.21.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-06-20T16:40:18+0000" - }, "cutadapt": { "content": [ "cutadapt_summary.tsv:md5,d185ccd02c22b859fcaf2e5158ce70c6" diff --git a/tests/pipeline/test.nf.test b/tests/pipeline/test.nf.test index f76bb324d..59a1082d2 100644 --- a/tests/pipeline/test.nf.test +++ b/tests/pipeline/test.nf.test @@ -16,7 +16,7 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir")).match("software_versions") }, + { assert new File("$outputDir/pipeline_info/software_versions.yml").exists() }, { assert snapshot(path("$outputDir/overall_summary.tsv")).match("overall_summary_tsv") }, { assert snapshot(path("$outputDir/asv_length_filter/").list()).match("asv_length_filter") }, { assert snapshot(path("$outputDir/barrnap/ASV_seqs.ssu.fasta"), diff --git a/tests/pipeline/test.nf.test.snap b/tests/pipeline/test.nf.test.snap index dd523b980..b26665d3e 100644 --- a/tests/pipeline/test.nf.test.snap +++ b/tests/pipeline/test.nf.test.snap @@ -20,12 +20,6 @@ ], "timestamp": "2023-05-28T20:55:32+0000" }, - "software_versions": { - "content": [ - "{BARRNAP={barrnap=0.9}, CUSTOM_DUMPSOFTWAREVERSIONS={python=3.11.7, yaml=5.4.1}, CUTADAPT_BASIC={cutadapt=3.4}, DADA2_DENOISING={R=4.3.1, dada2=1.28.0}, DADA2_FILTNTRIM={R=4.3.1, dada2=1.28.0}, DADA2_QUALITY1={R=4.3.1, ShortRead=1.58.0, dada2=1.28.0}, DADA2_TAXONOMY={R=4.3.1, dada2=1.28.0}, FASTQC={fastqc=0.12.1}, FILTER_CLUSTERS={pandas=1.1.5, python=3.9.1}, FILTER_LEN_ASV={Biostrings=2.58.0, R=4.0.3}, FILTER_STATS={pandas=1.1.5, python=3.9.1}, PHYLOSEQ={R=4.3.0, phyloseq=1.44.0}, QIIME2_INSEQ={qiime2=2023.7.0}, RENAME_RAW_DATA_FILES={sed=4.7}, SBDIEXPORT={R=3.6.3}, TRUNCLEN={pandas=1.1.5, python=3.9.1}, VSEARCH_CLUSTER={vsearch=2.21.1}, Workflow={nf-core/ampliseq=2.9.0dev}}" - ], - "timestamp": "2023-05-28T20:55:32+0000" - }, "overall_summary_tsv": { "content": [ "overall_summary.tsv:md5,a20dea9e5f4ca80723d31494399510fc" diff --git a/workflows/ampliseq.nf b/workflows/ampliseq.nf index 2a8fae5b3..0aaa79268 100644 --- a/workflows/ampliseq.nf +++ b/workflows/ampliseq.nf @@ -1,35 +1,7 @@ /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - PRINT PARAMS SUMMARY -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -include { paramsSummaryLog; paramsSummaryMap; fromSamplesheet } from 'plugin/nf-validation' - -def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) -def citation = '\n' + WorkflowMain.citation(workflow) + '\n' -def summary_params = paramsSummaryMap(workflow) - -// Print parameter summary log to screen -log.info logo + paramsSummaryLog(workflow) + citation - -WorkflowAmpliseq.initialise(params, log) - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - CONFIG FILES -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) -ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath( params.multiqc_config, checkIfExists: true ) : Channel.empty() -ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath( params.multiqc_logo, checkIfExists: true ) : Channel.empty() -ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) - -/* -======================================================================================== INPUT AND VARIABLES -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // Input @@ -189,11 +161,24 @@ ch_tax_for_phyloseq = Channel.empty() /* -======================================================================================== - IMPORT LOCAL MODULES/SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ +// +// MODULE & SUBWORKFLOW: Installed directly from nf-core/modules & nf-core/subworkflows +// + +include { FASTQC } from '../modules/nf-core/fastqc/main' +include { MULTIQC } from '../modules/nf-core/multiqc/main' +include { VSEARCH_CLUSTER } from '../modules/nf-core/vsearch/cluster/main' +include { FASTA_NEWICK_EPANG_GAPPA } from '../subworkflows/nf-core/fasta_newick_epang_gappa/main' + +// +// MODULE: Installed directly from nf-core/modules +// + include { RENAME_RAW_DATA_FILES } from '../modules/local/rename_raw_data_files' include { DADA2_ERR } from '../modules/local/dada2_err' include { NOVASEQ_ERR } from '../modules/local/novaseq_err' @@ -253,22 +238,14 @@ include { QIIME2_DIVERSITY } from '../subworkflows/local/qiime2_div include { QIIME2_ANCOM } from '../subworkflows/local/qiime2_ancom' include { PHYLOSEQ_WORKFLOW } from '../subworkflows/local/phyloseq_workflow' -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - IMPORT NF-CORE MODULES/SUBWORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - // -// MODULE: Installed directly from nf-core/modules +// FUNCTIONS // - -include { FASTQC } from '../modules/nf-core/fastqc/main' -include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoftwareversions/main' -include { VSEARCH_CLUSTER } from '../modules/nf-core/vsearch/cluster/main' -include { FASTA_NEWICK_EPANG_GAPPA } from '../subworkflows/nf-core/fasta_newick_epang_gappa/main' - +include { paramsSummaryMap } from 'plugin/nf-validation' +include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_ampliseq_pipeline' +include { makeComplement } from '../subworkflows/local/utils_nfcore_ampliseq_pipeline' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -276,12 +253,12 @@ include { FASTA_NEWICK_EPANG_GAPPA } from '../subworkflows/nf-core/fast ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -// Info required for completion email and summary -def multiqc_report = [] - workflow AMPLISEQ { + main: + ch_versions = Channel.empty() + ch_multiqc_files = Channel.empty() // // Create input channels @@ -320,8 +297,8 @@ workflow AMPLISEQ { .map{ info, reads -> def meta = info + [id: info.sample+"_"+info.fw_primer+"_"+info.rv_primer] + - [fw_primer_revcomp: WorkflowAmpliseq.makeComplement(info.fw_primer.reverse())] + - [rv_primer_revcomp: WorkflowAmpliseq.makeComplement(info.rv_primer.reverse())] + [fw_primer_revcomp: makeComplement(info.fw_primer.reverse())] + + [rv_primer_revcomp: makeComplement(info.rv_primer.reverse())] return [ meta, reads ] } .set { ch_input_reads } } else { @@ -332,8 +309,8 @@ workflow AMPLISEQ { [region: null, region_length: null] + [fw_primer: params.FW_primer, rv_primer: params.RV_primer] + [id: info.sample] + - [fw_primer_revcomp: params.FW_primer ? WorkflowAmpliseq.makeComplement(params.FW_primer.reverse()) : null] + - [rv_primer_revcomp: params.RV_primer ? WorkflowAmpliseq.makeComplement(params.RV_primer.reverse()) : null] + [fw_primer_revcomp: params.FW_primer ? makeComplement(params.FW_primer.reverse()) : null] + + [rv_primer_revcomp: params.RV_primer ? makeComplement(params.RV_primer.reverse()) : null] return [ meta, reads ] } .set { ch_input_reads } } @@ -370,6 +347,7 @@ workflow AMPLISEQ { // if (!params.skip_fastqc) { FASTQC ( RENAME_RAW_DATA_FILES.out.fastq ) + ch_multiqc_files = ch_multiqc_files.mix(FASTQC.out.zip.collect{it[1]}) ch_versions = ch_versions.mix(FASTQC.out.versions.first()) } @@ -382,6 +360,7 @@ workflow AMPLISEQ { params.illumina_pe_its, params.double_primer ).reads.set { ch_trimmed_reads } + ch_multiqc_files = ch_multiqc_files.mix(CUTADAPT_WORKFLOW.out.logs.collect{it[1]}) ch_versions = ch_versions.mix(CUTADAPT_WORKFLOW.out.versions.first()) } else { ch_trimmed_reads = RENAME_RAW_DATA_FILES.out.fastq @@ -877,32 +856,26 @@ workflow AMPLISEQ { } // - // MODULE: Sortware versions + // Collate and save software versions // - CUSTOM_DUMPSOFTWAREVERSIONS ( - ch_versions.unique().collectFile(name: 'collated_versions.yml') - ) + softwareVersionsToYAML(ch_versions) + .collectFile(storeDir: "${params.outdir}/pipeline_info", name: 'software_versions.yml', sort: true, newLine: true) + .set { ch_collated_versions } // // MODULE: MultiQC // if (!params.skip_multiqc) { - workflow_summary = WorkflowAmpliseq.paramsSummaryMultiqc(workflow, summary_params) - ch_workflow_summary = Channel.value(workflow_summary) - - methods_description = WorkflowAmpliseq.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description, params) - ch_methods_description = Channel.value(methods_description) - - ch_multiqc_files = Channel.empty() - ch_multiqc_files = ch_multiqc_files.mix(ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - ch_multiqc_files = ch_multiqc_files.mix(ch_methods_description.collectFile(name: 'methods_description_mqc.yaml')) - ch_multiqc_files = ch_multiqc_files.mix(CUSTOM_DUMPSOFTWAREVERSIONS.out.mqc_yml.collect()) - if (!params.skip_fastqc) { - ch_multiqc_files = ch_multiqc_files.mix(FASTQC.out.zip.collect{it[1]}.ifEmpty([])) - } - if (!params.skip_cutadapt) { - ch_multiqc_files = ch_multiqc_files.mix(CUTADAPT_WORKFLOW.out.logs.collect{it[1]}.ifEmpty([])) - } + ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) + ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath(params.multiqc_config, checkIfExists: true) : Channel.empty() + ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) + ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) + ch_methods_description = Channel.value(methodsDescriptionText(ch_multiqc_custom_methods_description)) + ch_multiqc_files = ch_multiqc_files.mix(ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) + ch_multiqc_files = ch_multiqc_files.mix(ch_methods_description.collectFile(name: 'methods_description_mqc.yaml', sort: false)) MULTIQC ( ch_multiqc_files.collect(), @@ -910,7 +883,10 @@ workflow AMPLISEQ { ch_multiqc_custom_config.toList(), ch_multiqc_logo.toList() ) - multiqc_report = MULTIQC.out.report.toList() + + ch_multiqc_report_list = MULTIQC.out.report.toList() + } else { + ch_multiqc_report_list = Channel.empty() } // @@ -925,7 +901,7 @@ workflow AMPLISEQ { ch_metadata.ifEmpty( [] ), params.input ? file(params.input) : [], // samplesheet input ch_input_fasta.ifEmpty( [] ), // fasta input - !params.input_fasta && !params.skip_fastqc && !params.skip_multiqc ? MULTIQC.out.plots : [], //.collect().flatten().collectFile(name: "mqc_fastqc_per_sequence_quality_scores_plot_1.svg") + !params.input_fasta && !params.skip_fastqc && !params.skip_multiqc ? MULTIQC.out.plots : [], //.collect().flatten().collectFile(name: "fastqc_per_sequence_quality_scores_plot.svg") !params.skip_cutadapt ? CUTADAPT_WORKFLOW.out.summary.collect().ifEmpty( [] ) : [], find_truncation_values, DADA2_PREPROCESSING.out.args.first().ifEmpty( [] ), @@ -984,7 +960,9 @@ workflow AMPLISEQ { ch_versions = ch_versions.mix(SUMMARY_REPORT.out.versions) } - //Save input in results folder + // + // Save input files in results folder + // if ( params.input ) { file("${params.outdir}/input").mkdir() file("${params.input}").copyTo("${params.outdir}/input") @@ -997,35 +975,14 @@ workflow AMPLISEQ { file("${params.outdir}/input").mkdir() file("${params.multiregion}").copyTo("${params.outdir}/input") } - //Save metadata in results folder if ( params.metadata ) { file("${params.outdir}/input").mkdir() file("${params.metadata}").copyTo("${params.outdir}/input") } -} - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - COMPLETION EMAIL AND SUMMARY -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -workflow.onComplete { - if (params.email || params.email_on_fail) { - NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report) - } - NfcoreTemplate.dump_parameters(workflow, params) - NfcoreTemplate.summary(workflow, params, log) - if (params.hook_url) { - NfcoreTemplate.IM_notification(workflow, params, summary_params, projectDir, log) - } -} -workflow.onError { - if (workflow.errorReport.contains("Process requirement exceeds available memory")) { - println("🛑 Default resources exceed availability 🛑 ") - println("💡 See here on how to configure pipeline: https://nf-co.re/docs/usage/configuration#tuning-workflow-resources 💡") - } + emit: + multiqc_report = ch_multiqc_report_list // MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + versions = ch_versions // channel: [ path(versions.yml) ] } /*
    Process Name \\", - " \\ Software Version
    CUSTOM_DUMPSOFTWAREVERSIONSpython3.11.7
    yaml5.4.1
    TOOL1tool10.11.9
    TOOL2tool21.9
    WorkflowNextflow
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls