-
Notifications
You must be signed in to change notification settings - Fork 63
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
The genome has been circularized, but 2 different contigs #224
Comments
Could you send me your results because it is hard to tell otherwise? |
Sure, here is an example of what I meant in my question.
Thank you so much
Il giorno gio 29 feb 2024 alle ore 03:47 Nicolas Dierckxsens <
***@***.***> ha scritto:
Could you send me your results because it is hard to tell otherwise?
—
Reply to this email directly, view it on GitHub
<#224 (comment)>,
or unsubscribe
<https://github.com/notifications/unsubscribe-auth/BGLUAPZJOIWNVWJMUNKEBXDYV2LE5AVCNFSM6AAAAABDVKGGZSVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTSNZQGMYDANJTHE>
.
You are receiving this because you authored the thread.Message ID:
***@***.***>
9324992
ATATATACAATGTTATTGTAGCTTATCACAAAGCACGGCACTGAAGATGCCAAGATGGGTAAACACACACCCCAAAAACACAAAGATTTGGTCCTAACCTTACTGTTAATTTTTGCTAAACTTATACATGCAAGTATCCGCATACCAGTGAAAACGCCCTAACATATCTAATCAGATAAAAGGAGCCGGTATCAGGCACACCATGACAGCCCAAGACACCTAGCTCTGCCACACCCCCAAGGGTATACTCAGCAGTAATAAAAATTAAGCAATAAGCACAAGCTTGACTTAGTTATAGCAAAGAGAGCTGGTCAACCTCGTGCCAGCCACCGCGGTTATACAAGAAGCCCAAACTAACAACCAATCGGCGTAAAATGTGGCTAAACAGCTCTATCAATAAAATTAAGATGAACCAAGTACCAAACTGTCATACGTAAAAGTACGGATTAACACACTATGAAAATAACCTTAATACAATGAAATAATTTGAACCCACGATCGCTAAGACACAAACTAGGATTAGATACCCTACTATGCTTAGCCCTAAACTTAGATATTTTCCACACAAAAATATCCGCCAGAGAACTACGAGCATAAACGCTTAAAACTCTAAGGACTTGGCGGTACCTCAAACCCTCCTAGAGGAGCCTGTTCTATAATCGATAATCCACGATCTACCTCACCATCCCTTGCCAAACCCGCCTATATACCACCGTCACCAGCTTACCCCATGAGGGCCACAAAAAGTAAGCAAAATAACCTAAACAGTTAATAAGTCAGGTCAAGGTGTAGCTAACTGAGATGGAAGAAATGGGCTACATTTTCTACTTTAGAAATAACCACGGAAGAATACCATGAAATAGGTTCCACAAGCAGGATTTAGCAGTAAACTGGGAACAGAGAGCCCAATTTAAGCCGGTCCTGAGGTACGCACACACCGCCCGTCACCCTCCTCAAACAATCTAACAACCATAAATTAAACCACAACAAACATAATAGATGAGGTAAGTCGTAACAAGGTAAGTACACCGGAAGGTGTACTTGGAACATCAAAACATAGCTTAATCAAAAGCATTCAGCTTACACCTGAAAGACGTCCATTAAACCGGACTATTTTGAGCAAAAATCTAGCCCAACCAACAAATATAAATTCAACAGAAAAAATAATCCTACCAACACCAAACTAAAACATTTTTTCCATCTCAGTATTAGGCGATAGAAAAGACTGTTGGAGCAATAAAGACAGTACCGCAAGGGAAAGATGAAAAACATGAAAGATCTGACTAAGCCCTAAAAAGCAAAGATTAACTCTTATACCTCTTGCATCATGATTTAACTAGTACACCCAAGCAAAGCGAACTAAAGTCTGAACCCCCGAAACCAAGTGAGCTACTTAAGGGCAGCCAACATCACCAGGCTTAAATCCGTCTCTGTGGCAAAAGAGTGGAAAGACCTATAAGTAGAGGTGAAAAGCCTAACGCACTTGGTGATAGCTGGTTGCTCAATAAAAGAATATAAGTTCAACCTTAAATATCCTAAAAACAATATAAAGTATTTAAGAGAAATTTAAGATATATTCAATTGAGGTACAGCTCAATTGAAAAAGGACACAACCTAAAACGGAGGACAAAACATTTAAACATATTACCGTAGGCTTCAAAGCAGCCACCACTAAGGACAGCGTCAAAGCTCATCAACAACAGATATCAACACCAATTTTTTCCCCAAACAATATTGAGCTATTCTACCTAAATAGAAGAACTAATGTTAAAATAAGTAACAAGAAGACAAAACTTCTCTAACGCGCTAGCTTAAATCATAACAGATAAACTAATGATTATTAACAACTAATATTATAAAATCAACAATACTAAACATACCATATAAACTAAACTGTTAACCCAACACAGGAGCGCACACAAGAAAGATTAAAATTTGTAAAAGGAACTAGGCAAACAACTGAGCCCGACTGTTTACCAAAAACATAGCCTCTAGCAGCAACAAGTATTAGAGGTAATGCCTGCCCAGTGACACTGTTAAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGTAATCACTTGTCTTTTAAATAAAGACTAGAATGAATGGCCAAACGAGGTTCCACCTGTCTCTTACAAACAATCAGTGAAATTGGTCTTCCCGTGCAAAAGCGGGAATAACACTATAAGACGAGAAGACCCTGTGGAACTTTAAATATAAATCAACTATTATATTTACCACCCTAAAGACTTATAATTAACTAGTTCTGATCCATATTTTTGGTTGGGGTGACCTCGGAGTAAAACAAAACCTCCGAAAAAAGAACATATTTTCTTAACCTAGATTTACAACTCAAAGTGCCAACGGCAAAATGATCCAATATATTTGATCAACGAACCAAGCTACCCCAGGGATAACAGCGCAATCCCATCCTAGAGTTCCTATCGACGATGGGGTTTACGACCTCGATGTTGGATCAGGACATCCTGATGGTGCAACCGCTATCAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATAAAATTTGAGCTTTTTCCAGTACGAAAGGACCGAAAAACCAAGGCCCATATTAAAAACAAGCCTTACCTTATATTAATGAAACCAACTTAACTAATAATAAGGACAAAACCATACATCACAAGCCCAAGAAAAGGGCAAAGTTCGGGTGGCAGAGCCAGGTAAAAATGCAGAAGGCCTAAACCCTTTATTCAGGGGTTCAACTCCCCTCCCAAACTATGAAAACCCTACTATCCAACCTAATATCACCACTCATATATATAGTCCCAATTCTAATTGCCGTTGCCTTCTTCACCTTAATTGAACGAAAAATCCTAGGATATATACAACTCCGAAAAGGCCCAAACATCGTTGGCCCCTATGGACTACTACAACCAGTAGCAGACGGCGTAAAACTATTTATTAAAGAACCAATTTACCCATCAAATTCATCAATCATATTATTCACAATATCCCCAATACTAGCCCTGCTACTAGCCCTGTCAATCTGACTCCCACTACCACTACCCTTCCCACTAGCTGATCTCAATTTAGGACTGCTATTCCTAATTTCCATATCCAGCTTTATAGTTTACTCCATTCTATGATCAGGCTGAGCCTCAAACTCCAAATACGCCCTAATAGGAGCCCTACGAGCAGTCGCCCAAACAATCTCATATGAAGTAACCCTAGGAATTATCCTACTCTCACTAACCCTATTTTCAGGTGGATTCAACATACAAACATTTATAACAACACAAGAACCAATATACCTAATATTCTCCTCCTGACCACTAATAATAATATGATATATCTCCACATTAGCAGAAACTAACCGAGCACCATTCGACCTTACCGAAGGAGAATCTGAACTAGTATCAGGATTTAACGTTGAATACGCCGCCGGACCATTCGCCCTATTCTTTCTAGCAGAATATGCCAACATCCTAATAATAAACACCCTAACCACCATTCTATTCCTAAATTCAACTTACACCAACAACCCCGAACTATTCTCCGTATTACTAATATCAAAAGTAATACTACTATCAGGAGGCTTCCTATGAATTCGAGCCTCCTATCCACGATTCCGATATGACCAATTAATACATCTCCTATGAAAAAACTTCCTCCCAATCACCCTTGCATTATGCCTATGACATACTTCCATACCAATCACCTTCTCAGGCCTACCACCTATACCCTAGGACACGTGCCTGAACAAAGGGTTACCTTGATAGGGTAAATAATAGAGGATAAAACCCTCTCGTCTCCTTAGAAAAATAGGACTTGAACCTACACCAGAGAGATCAAAACTCCCCATACTCCCATTATACTATATCCTAGTAAAGTCAGCTAATTAAGCTTTCGGGCCCATACCCCGAAAATGTCGGTTAAAATCCCTCCTATACTAATGAATCCCTACGCAAATACAATCATCATCTCAAGCCTAATTATAGGGCCCCTATTAACAATTTCCAGTAATCACTGAATCCTGGCATGAACTGGCCTAGAAATCAGCACGCTAGCCATTATTCCCCTAATCGCTAAACAACACCACCCACGAGCAACTGAAGCCGCCACTAAATACTTTCTAACACAAGCAACTGCCTCAACACTAATCCTATTTTCCAGCATTATTAATGCCTGAACACTAGGCCAATGAGACATTACACAAATATCCAACAATACCTCATGCACAATCCTCACTACAGCCTTAGCCATTAAACTAGGACTAGCTCCCTTCCACTTCTGGTTACCAGAAGTAATACAAGGAACCTCCACAATAACAGCCCTAATCTTAGCTACCTGACAAAAACTAGCCCCACTATCACTACTAACAATAACCGCCCAATCCCTAAACACACCACTACTATTAATACTAGGACTAACATCCGCTCTAATCGGAGGATGAAATGGACTAAATCAAACCCAACTACGAAAAATCATAGCATTCTCCTCCATCGCCCATCTAGGATGAATAGCTACAATCCTTACTCTATCCCCCAAACTTATACTACTTACATTTTACACCTACACCATCATAACCTCAACAATATTTTTAATAATAAAACTTCTAAAAACAAACAAAATCTCTATGATAATAACCTCATGAACAAAACTCCCAACCATAAACACCCTAATAATACTCACCCTTATATCACTCGCAGGCATACCACCACTAACAGGATTTATACCAAAATGACTAATCCTCCAAGAATTAACTAAACAACATATACTCATTATAGCCACTATAATAGCCATACTCTCACTCCTAACCCTATTCTTCTACCTACGAATTTCATACTATGCAACCATCACATTACCACCAAACTCAACCAACTATTCACAACAATGACGCCACAAAATAAACCAAAAACCCCCCTACCTAGCCCTATTAACCACACTATCAACCATTATACTTCCAATTATACCAACCTTATTAACCATCCCATAGAAACTTAGGATCAGACCTATTTTAAACCAGAGGCCTTCAAAGCCTCAAACAAGAGATAAAACCTCTTAGTTTCTGCTAAGACCTACAGGACTTTATCCCATATCTCATGAATGCAACTCAAACACTTTAATTAAGCTAAGGCCTTACTAGACAAATGGGCCTCGATCCCATAACAATTTAGTTAACAGCTAAATACCCAATCCAGCGGGCTTTTGCCTACTTTTCCCGCTCTATAAAAAGCGGGAAAACCCAGACACCAATAAAGGTGTATCTTCAAATTTGCAATTTAACATGAACTTCACTACAAGGTCTGATAGGAAGAGGAATTAAACCTCTGTAAAAGGGACTACAGCCCAACGCTAATACACTCAGCCACCCTACCTGTGTTTTTAACCCGTTGATTCTTTTCCACCAACCATAAAGACATCGGCACCCTATACCTAATCTTCGGGGCATGAGCAGGAATAGTAGGCACAGCACTCAGCCTATTAATCCGCGCAGAACTAAGCCAACCAGGTACTCTTCTAGGAGATGACCAAATTTACAACGTTATCGTCACAGCCCATGCTTTCATCATAATCTTCTTTATAGTTATACCAATCATAATCGGTGGCTTCGGAAACTGACTTGTTCCATTAATAATTGGAGCACCAGATATAGCATTCCCACGTATAAACAACATAAGCTTTTGACTCTTACCTCCTTCATTATTACTACTTCTAGCATCATCAGGAATTGAAGCAGGCGCAGGCACAGGCTGAACAGTGTACCCCCCATTAGCTGGAAACCTAGCCCACGCCGGTGCTTCTGTAGATCTAACCATCTTCTCCCTCCACCTAGCCGGTGTGTCTTCAATTTTAGGTGCTATCAACTTCATCACCACAGCAATCAACATAAAATCCCCTGCCATATCACAATACCAAACACCCTTATTCGTATGATCCGTACTAATTACAGCTGTCCTATTACTACTTTCTCTACCAGTACTCGCTGCAGGTATTACCATACTACTCACAGACCGAAATCTAAATACAACCTTCTTTGATCCTTCAGGGGGAGGAGATCCAATCCTATATCAACACCTATTCTGATTCTTTGGACACCCTGAAGTATACATCCTAATCCTCCCAGGATTCGGCATAATCTCCCACATTGTCACCTATTATGCCGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTTTGAGCAATAATATCCATTGGTTTCCTAGGCTTCATTGTATGAGCTCACCACATATTCACCGTTGGAATAGACGTGGATACACGAGCTTACTTCACATCTGCAACAATAATCATTGCCATTCCAACAGGAGTAAAAGTATTCAGCTGATTAGCCACCCTACATGGTGGAATAATTAAATGAGATGCCGCCATACTCTGAGCCCTAGGCTTTATCTTTCTTTTCACTATTGGAGGATTAACAGGTATTGTATTAGCCAATTCATCATTAGACATTGTACTACACGATACCTACTACGTAGTAGCACATTTCCACTATGTTCTTTCAATAGGGGCCGTATTTGCTATCATAGCAGGATTCACTCATTGATTCCCCCTTTTCACAGGATATTCACTACACCAAACCTGAACAAAAGTACATTTCGGAGTAATATTTACAGGCGTTAACATAACCTTCTTCCCCCAACATTTCTTAGGACTAGCTGGAATACCACGACGCTACTCAGATTATCCAGATGCATACACCCTATGAAACTCCATCTCATCAATCGGATCTTTAATTTCTATAGTAGCAGTAGTTATAATAATATTTATTATTTGAGAAGCATTTTCCTCAAAACGAAAAGTATCAACAGTAGAACTCACAACCACCAACGTAGAATGACTACACGGCTGCCCTCCCCCATATCACACCTACGAAGAACCAGCCCATGTACAAACCCAAGAAAGGAGGGAATCGAACCCCCTTAAATTAGTTTCAAGCCAACCACATAGCCTCTATGTTTCCTTCTTTAAAGACGTTAGTAAAACATATTACCTAACCTTGTCAAGGTTAAATTATAGGTGAAATCCCTTTACGACTTAATGGCACATCCCCTTCAATTAGGATTCCAAGATGCAATATCACCAATTATAGAAGAACTCCTTCATTTCCACGACCACACTTTAATAATTGTATTCTTAATTAGCACCCTAGTACTCTATATCATCACACTAATAATAACAACAAAACTAACATACACCAACACTATAAATGCTCAAGAGGTAGAAATAATTTGAACCATTTTACCAGCTATTGTCTTAATTACTATTGCACTCCCATCGCTACGAGTACTATACCTAATAGACGAAATCAATAACCCACATTTAACCATCAAAGCCATAGGACATCAATGGTATTGAACATACGAATATACTGACTACGAAAACCTTGAATTCGACTCTTACATAATTCCAACCCAAGATCTACCAAACGGACACTTCCGATTACTAGAAGTAGATCACCGCATAGTAATACCAATAGAATCACCAATCCGAATATTAATCTCAGCTGAAGACGTCTTACACTCATGAGCAGTACCATCACTAGGCGTAAAAACAGATGCAATCCCAGGACGATTAAATCAAGCAACATTCATCATTACCCGACCAGGAGTATTCTTTGGACAATGTTCAGAAATTTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCGTACCCTTATCACACTTTGAAGACTGATCTTCATTAATGCTTTCCTAACACTATAGAAGCTAAACAGGATAGCGCTAGCCTTTTAAGCTAGAAAAAGAGAACTCCCCACTCTCCTTAGTGACATGCCTCAACTAAACCCAAATCCGTGACTTATAATCTTACTCTCCGCATGACTAATTTACACCATTATTTTACAACCAAAAATCTCATCTTACTTACCTACAAATAACCCAACCAACAAAAACAATAAAACCAACACAAACCCCTGAACCTGACCATGAACCTAACATTCTTCGACCAATTCATAAGCCCACAAATCCTAGGAATCCCATTAACTACCCTAGCCCTACTAATACCATCAACCCTCTTCCCCACCCAAAACACCCGATGATTAACTAACCGTCTTTCAACACTCCAATCATGAACAATCAACTCATTCACAAAACAACTAATACTTCCAATTAATAAAACAGGCCACCAATGATCCATTATCCTAACATCATTAATAACCATACTATTAATAATCAATTTACTAGGCCTTCTACCATACACCTTCACCCCTACTACACAACTTTCCTTAAACATAGGACTAGCCATCCCAATATGACTAGCCACAGTACTCACAGGACTTCGAAATCAACCAACAACATCACTAGGACACCTATTACCAGAAGGCACCCCAATCCTATTAACCCCTATTCTCATTATCATTGAAACAATCAGCTTATTCATCCGACCATTAGCTTTAGGCGTACGACTCACAGCCAACCTAACAGCCGGACATCTACTAATTCAACTTACCTCAACCGCAGTACTAACCCTACTTCCAATAATACCTACTCTATCATTACTAACTATAGTTATTCTTTTATTACTAACAATTCTAGAATTAGCCGTAGCCATAATTCAAGCTTACGTATTTGTTCTTCTATTAAGCTTATATTTACAAGAAAACACTTAATGGCCCACCAAATACACGCCTACCACATAGTTGACCCAAGCCCATGACCACTAACAGGGGCAGCAGCAGCACTACTAATAACCTCAGGACTCGCCACATGATTCCACTACAACTCAACACTATTAATAACCCTAGGCTTACTAACTATACTTCTAACCATATTTCAATGATGACGAGATATCATCCGAGAAGGAACCTTCCAAGGACATCACACACCCCCAGTACAAAAAGGCTTACGATATGGTATAATCTTATTTATTACATCAGAAGTATTTTTCTTCATCGGATTTTTCTGAGCTTTTTACCATTCAAGTCTAGCCCCTACCCCAGAACTAGGAGGATGTTGACCACCTACAGGAATCACACCACTAAACCCATTTGAGGTCCCCTTATTAAACACAGCAGTATTATTAGCATCAGGAGTAACAATCACCTGAGCTCACCATAGCCTAATAGAAATAAACCGAAATCAAACCACCCAAGCCCTAACTATCACAATTTTACTAGGACTATATTTCACAGCATTACAAGCTATAGAATATTACGAAGCCCCATTCACAATCGCCGATGGAGTGTACGGCTCAACATTTTTTGTCGCAACAGGCTTTCACGGACTCCACGTAATTATTGGCTCAACATTCCTAATTGTTTGCTTACTACGACAAATTAAATTCCATTTTACCTCCACTCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTTGTATGACTCTTCCTCTACGTTTCAATCTACTGATGAGGCTCATGCTCCCCTAGTATAACAGTACAAGTGACTTCCAATCACTAAGTTTTAGTTCAACCCTAAAGAAGAGCAATGAACGTAACAACATCCATCATCACAATAGCCTCCATTCTCTCCATAATCCTAATAATATTAAACTACCAATTAACATTAACAAAACCAGATAACGAAAAATTATCCCCATATGAATGTGGCTTTGACCCACTAGAATCAGCCCGTCTACCATTCTCAATTCGATTTTTCCTTAGTAGCCATCTTATTCCTGCTATTCGACTTAGAAATTGCACTACTCCTACCACTACCATGAGCCACCCAACTCCCATCTCCAACCTCAACCCTTACCTGAACCATTATTATTTTACTTCTCCTAACACTAGGCCTTATTTATGAATGAATCCAAGGAGGCTTAGAATGAGCAGAATAGGCAACTAGTCTAACACAAGACAACTAATTTCGACTTAGTTAATCATGATTAAACTTCATGGTTTCCCAATGACACCATTACACTTCAGCTACCACTCCGCCTTTATTATTAGCATTATAGGCCTCTCATTACACCGAACCCACTTAATCTCAACTCTACTATGTCTAGAAAGCATAATATTATCCCTATTCATTGCTCTAGCAATATGACCCACCCAATTACAAACCCCATCACTTATAATCACCCCAATACTAATACTATCCTTCTCAGCCTGTGAAGCTGGCATAGGCCTATCTTTATTAGTAGCATCCTCACGAACCCATGGTTCAGACCAACTACAAAACCTAAACCTTTTACAATGCTAAAAATCCTACTCCCTACAATTATATTATTACCAACAATCACACTATGTAAACCAAAACAACTATGACCTTCCACATTAATCCATAGCCTAACAATTGCTACTCTAAGCTTACAATGATTTAAACCTTCCATAGAACCAACCATAAACTTTTCTAATAGCTATCTAGGAATAGACCAAACCTCAGCCCCACTATTAATCCTATCATGCTGACTTACCCCTATAATAATCTTGGCTAGCCAAAACCACTTAGCTACCGAACCAACCTCACGAAAACGAACCTTCACCTTCACTATCATCTCACTACAAATTTCACTAATACTAGCTTTCTCAACCATAGAACTAATTATATTTTTTATTGCATTTGAAACTACACTTATCCCAACACTAATAATTATCACACGATGAGGCAACCAAATAGAACGACTAAATGCAGGAACTTACTTTCTATTTTATACCCTCATTGGATCTCTTCCACTACTAATCGCTCTACTATCCCTAAACACTGAAAACGGTTCCTCATCAATATACACAATACAACTAAATCAACCTATCATACCAAACTCATGAACCCATACAACATGATGATTCGCACTACTAATAGCTTTTATAATCAAAATACCACTATACGGTTTACACTTATGACTACCAAAAGCACATGTAGAAGCCCCAATTGCAGGCTCAATAATTCTAGCTGCAGTATTACTAAAACTAGGAGGATATGGTATCATCCGCATTACAATAATACTAAATCCCCTGTCAAAAACACTTTCCTACCCTTTTATGGTACTCGCATTATGAGGAGTAATCATAACTAGCTCTATCTGCTTACGACAAACAGATCTAAAATCACTAATTGCCTATTCATCAGTAAGCCATATAGGCCTTGTCATCGCCGCAACACTAACACAAACTCAATGAGCCTACACCGGCGCAATTACACTTATAATCGCTCATGGCTTAACATCATCAATACTTTTTTGCCTAGCTAATACAAATTACGAACGAACTCACAGCCGAACACTACTATTAGCCCGAAATATACAACTCCTACTCCCCCTAATAAGCCTATGATGACTACTTGCTAGTTTAACTAACATAGCCCTTCCACCAACCATTAACCTAATAGGAGAATTAACCATTATTACTTCACTATTTAACTGATCCAACATTACAATCCTAATAACAGGATTAGGAACCCTAATCACCGCTACTTACACCCTATACATATTATCTACAACACAATGAGGGGAAACACCTTCATACATCAAAACTATCCCCCCAACCCACACACGAGAACATCTCTTAATATCATTACACATCCTACCAATAATTCTACTAATAACAAAACCAGAACTAATCTGAGGCTCCTTCTACTGTTAATATAGTTTCAAAACAAACATTAGACTGTGGCTCTAAAAATAGGAGTTAAAATCTCCTTATAAACCGAGAGAGGTATAATACAATAAGAACTGCTAACTCCTATATCTGAGATTAATCCCTCAGCTCCCTCACTTTTAAAGGATAGAAGTAATCCACTGGTTTTAGGAACCACGAACCCTTGGTGCAATTCCAAGTAAAAGTAATGACCACACTAATAAATTCAACCTTCCTCTTAGCCCTAATCACCCTAATATTTCCACTAACAACAACTTACCCAAAAACATGAACACCTCTAAAAACAAAAACAGCTGTAAAAATAGCATTCTTCATCACCCTAATCCCACTAATCGCCTTCATTTATACAGACATTGAATCTGTTATCACCAACCTACACTGATCAACCACATCCACATTCACCATAAACATAAGCTTTAAACTTGACAAGTACTCCATCATGTTCGTCCCAATCGCCTTATACGTCACATGATCCATCCTAGAATTTACACACTGATACATAGCTACTGACCCTTATATCACAAAATTTTTCAAATACCTACTAATTTTCCTAGTAGCCATAATAATCCTAGTAACAGCCAACAACATATTTCAATTCTTTATTGGCTGAGAAGGAGTAGGAATCATATCCTTCCTCTTAATCGGATGATGATCCGGCCGAACAGAAGCAAACTCATCAGCCCTACAAGCCATTATTTACAACCGTATCGGAGACATCGGACTAATCCTCAGTATAGCCTGACTATCAATAAACCTAAACACATGAGAACTCCAACAAATCTTTACCCACACCAATCTCACCCCACTACTTCCACTCCTAGGATTAATCCTAGCCGCAACAGGAAAATCAGCCCAATTCGGCCTCCACCCCTGACTACCAGCAGCTATAGAAGGCCCCACCCCAGTTTCAGCATTACTACACTCAAGCACTATAGTAATCGCTGGAATCTTCCTACTAATCCGAATACACCCCATCTTAACCACCAACAACACAGCCCTCTCAACCTGCCTTTGCCTAGGAGCCATCACCACACTATTTACAGCTTTTTGCGCCCTCACCCAAAATGATATCAAAAAAATTATTGCCTTCTCCACATCAAGCCAACTAGGCCTTATAATAGTAACTATCGGCCTAAACCAACCACAACTAGCCTTCCTACATATCTCCATACACGCATTCTTCAAAGCCATACTATTCTTATGCTCAGGTTCCATTATTCATAATCTAAACAACGAACAAGATATTCGAAAAATAGGAGGACTACACAAATCCCTACCAATTACCTCCTCATGCCTAACTATTGGTAGCATAGCACTCACAGGCATACCATTTATAACTGGATTCTATTCTAAAGACATCATTATCGAAACCATAAATACATCATACATAAACGCCTGAGCCCTACTCCTAACACTAACCGCAACCTCATTCACTGCAATTTACAGCTTTCGCATCTTAATCTTCGTACAAACAGGACACCCACGATACCCCTCCACACTCCTACTAAACGAAAACAACCCAACAATTATCAACCCAATCACCCGCCTCGCAATAGGAAGCATCGTCGCAGGCTTACTCATTTCACTAAATATCACACCATTAAAAACTCCCCCAACAACTATACCAACATACATTAAAATCACGGCACTAACAGTAACAATCCTAGGCCTACTACTAGCCTTAGAACTAATCACAATAGTAAACAAAACCCAAAAACCCTCCAACACCCATAATTTCTCAAATTCACTAGCATACTTCAACACCCTAATACACCGTTCACTACCAATAGTGAACTTAAAATTTAGCCAAAACATCGCAACACATCTAATCGACCAGTCCTGATATGAAAACGTTGGCCCAAAAGGACTAAGCAAATCACAAATCACCCCAATTACAACTTCATCCGCGTCACAAAAAGGCCTCATTAAAATCTATATAACTTCATTCATCCTATCAATAACATTACTACTTCTCATCACCTAATCGGACGAAGTACCCCACGAGATAAACCACGAACCAACTCCATCACAACAAATAACGTCAACAATAACCCTCAACCAGCAATTAAAAACAACCAACTACCAAAATAATAAAACCATGCCACCCCACTAAAATCTAATCGAACAACAAACAACCCACCAGCATCAATTGTAACACTACCATACCCTTCCATACTCCACAGTCAATAACACATTGCCCCATACCCCACAAGAACTAAAATATAACTCACCACATAAATTATCCCACCTCGATTACCTCAAGCAACAGGATAAGGCTCTTCCACCAACGCAGATGAATAAGCAAAAATAACTAATATACCACCTAAATAAATTAAAAACAATACTACAGAAACAAAAGACCCCCCTATACTAACTAACAACCCACAACCAAAAGCCGCCCCAAGAACCAAACTTAAAACTCCATAATATGGGGACGGATTACAAGACACACCAACCATCCAAAAAACAAAACAAAACCCAAATAAAAATGCAAAATACATCATAATTCTTGCCTGGACTCTAACCAAGACCAATGATTTGAAAAACCACCGTTGTATTCAACTACAAAAACCTAATGGCCACAAACCTACGAAAAACCCACCCAATAATAAAAATCATCAACAATTCACTCATCGACTTACCAAGCCCCTCCAACATCTCTGCATGATGAAACTTCGGATCACTACTAGCCACCTGTCTAGCACTACAAATCATTACCGGAATCTTCCTAGCAATACATTACTCACCAGACATCTCCATAGCCTTTTCATCAATTACCCACATCACCCGAGATGTACAATACGGATGACTCATCCGCAACATGCACGCCAACGGAGCCTCCCTATTTTTCATCTGCATCTACCTCCACATCGGACGAGGAATCTACTACGGTTCCTATCTATACAAAGAAACCTGAAATACCGGAATCATCCTCTTACTACTAGTAATAGCCACCGCATTCGTAGGCTACGTCCTACCATGAGGGCAAATATCATTCTGAGGAGCTACCGTCATCACCAACCTACTATCAGCCATCCCATATATTGGTAACACATTAGTACAATGAATCTGAGGAGGATTCTCAGTAGACAACGCAACCCTAACTCGATTCTTCACCCTCCACTTCCTACTACCATTCGCCATTACCGGCCTTACAATAGTACATTTACTATTCCTACACGAAACAGGCTCAAACAACCCAACAGGACTAAACTCAAACACTGACAAAATCCCCTTCCACCCCTACTTCTCCTACAAAGACTTACTAGGACTTATCTTAATACTAACCTTTCTCCTAACCCTAACACTTTTCTCCCCATACCTACTAGGAGACCCAGACAACTTCACCCCAGCTAACCCCCTATCCACCCCTCCCCACATCAAACCAGAATGATACTTCCTATTCGCCTACGCAATCCTACGATCAATCCCAAACAAACTAGGCGGAGTACTAGCCCTACTATTCTCCATCCTAGTATTATTACTAATACCCACCTTACACACATCAAAACAACGAACAGCCTCATTCCGACCACTCACCCAAATCTTATTCTGATCCCTAGTAGCTGACCTACTAGTACTAACATGAATTGGAGGCCAACCAGTCGAAGATCCATTCATTACCATTGGTCAAATAGCCTCTAGCCTTTACTTCTTAATCTTACTTCTTCTAATACCCACAGCGGGCATAATCGAAAACAAAATACTAAAACTAAAATATTCTAGTAGCTTAACCCCAAAGCATTGGTCTTGTAAACCAAAGATTGAAAACTACAACTTTCCTAGAATAATCAAAAGAGAAGGGTTCAAACCTTCATCTCCGGTCCCCAAAACCGGAATCTTCCAATTAAACTACCCTTTGACGCAAAAGAAGCGCCAACATGTAAATTTACCTATATTCTCTGCCGTGCCCAACAGAATAATATCCATAATACCTATCTATGTATTATCGTACATCAACTTATTTACCACTAGCATATGATCAGTAATGTTGTCGATTAATCTGACCTTAAACATAAAAACTATTAATTTTGCATAAACTGTTTTAGTTACATGACTATTATACAGGTAATAGGAATGAAATGATATAGGACATAAAATTAAACCATTATTCTCAACCATGAATATCGTTACAGTAATAGGTTATTTCTTAGTTCAGCTCATCACGAGAAATAAGCAATCCTTGTTAGTAAGATACAATATTACCAGTTTCAAGTCCATTAAGTCATGTCGTACATAACTGATCTATTCTGGCCTCTGGTTGGTTTTTTCAGGCACATTAAGGCAGTAAAGTTCATTCGTTCCTCTTTAAAAGGCCTCTGGTTGCAAGTAAATGAGTTCTATACATTAAATTTATAACCTGGCATACGGTGGTTTTACTTGCATGTGGTAGTCTTTTTTTTCTCTTTGTGTTCTCAGGCCCACATAACTGATACCTGCCGAATTGATGAAACTGAGCCTACGTTCAAAATGATTGGCCGTGCAGAATACTTAATGGTATTATTTAATTAATGCTTTTAGGACATATATTTTTATAAAAACTCACAACAGTTATTTACAAGCTAAAACCCATTACAACCATACTTTTTAGTTAAACCCCCCCACCCCCATAAACTAACATTATGCCCGAATAGCTATTCACTTCTCGTCAAACCCCTAAATCCGAGACTAACTAAACTGACACAACATTAATCGCATAAGCATTACACAAACTAATGAAACACTTACACTATACCTAAAAAGTACTAAAAACAATTCATCACACCTCTACTACACCCAACTAACCAAACATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTA
…-----------------------------------------------
NOVOPlasty: The Organelle Assembler
Version 4.3.5
Author: Nicolas Dierckxsens, (c) 2015-2024
-----------------------------------------------
Input parameters from the configuration file: *** Verify if everything is correct ***
Project:
----------------------
Project name = 21103_1
Type = mito
Genome range = 15500-18000
K-mer = 50
Max memory =
Extended log = 0
Save assembled reads = no
Seed Input = /mnt/raid/users/livia/Caretta23/novoplasty_pipeline/seed/seed_COI.fa
Extend seed directly = no
Reference sequence = /mnt/raid/users/livia/Caretta23/novoplasty_pipeline/ref_mito/ZAK51.fasta
Variance detection = yes
Chloroplast sequence =
Dataset 1:
----------------------
Read Length = 151
Insert size = 300
Platform = illumina
Single/Paired = PE
Combined reads =
Forward reads = /mnt/raid/users/livia/Caretta23/Trimmomatic_output/Trimmomatic_output_new/21103-1_S63_f_paired.fastq.gz
Reverse reads = /mnt/raid/users/livia/Caretta23/Trimmomatic_output/Trimmomatic_output_new/21103-1_S63_r_paired.fastq.gz
Store Hash =
Heteroplasmy:
-----------------------
MAF =
HP exclude list =
PCR-free =
Optional:
----------------------
Insert size auto = yes
Use Quality Scores =
Reduce ambigious N's =
Output path = /mnt/raid/users/livia/Caretta23/novoplasty_pipeline/output_files/output_failed_samples/
Subsampled fraction: 95.79 %
Forward reads without pair: 782896
Reverse reads without pair: 340107
Retrieve Seed...
Initial read retrieved successfully: ACCCTACCTGTGTTTTTAACCCGTTGATTCTTTTCCACCAACCATAAAGACATCGGCACCCTATACCTAATCTTCGGGGCATGAGCAGGAATAGTAGGCACAGCACTCAGCCTATTAATCCGCGCAGAACTAAGC
Start Assembly...
-----------------Assembly 1 finished successfully: The genome has been circularized-----------------
Contig 1 : 15553 bp
(Check manually if the two contigs overlap to merge them together!)
Contig 2 : 1072 bp
Total contigs : 2
Largest contig : 15553 bp
Smallest contig : 1072 bp
Average insert size : 276 bp
-----------------------------------------Input data metrics-----------------------------------------
Total reads : 20305262
Aligned reads : 17592
Assembled reads : 12438
Organelle genome % : 0.09 %
Average organelle coverage : 160
-----------------------------------------------------------------------------------------------------
|
In this case, the AT repeat caused the assembly to stop, illumina quality and depth usually drops a lot there. If the assembly is uncertain, it will use the paired reads information to jump the problematic region and continue from there in both senses. Sometimes it merges automatically, sometimes it asks you to do manually. I guess the second contig also started with the AT repeat? |
Well, not really. First contig starts with AT repeats and stops more or
less at the end of Val tRNA (which is around 1000 bp after the end of AT
repeats); the second contig starts where the first finishes, and finishes
in the AT repeats. The curious thing that I was asking you something about,
is why the interruption is around Val tRNA. This occurs in several samples
of mine.
Il giorno dom 3 mar 2024 alle ore 16:17 Nicolas Dierckxsens <
***@***.***> ha scritto:
… In this case, the AT repeat caused the assembly to stop, illumina quality
and depth usually drops a lot there. If the assembly is uncertain, it will
use the paired reads information to jump the problematic region and
continue from there in both senses. Sometimes it merges automatically,
sometimes it asks you to do manually. I guess the second contig also
started with the AT repeat?
—
Reply to this email directly, view it on GitHub
<#224 (comment)>,
or unsubscribe
<https://github.com/notifications/unsubscribe-auth/BGLUAP7LJTV37Y6Q3XD2LOLYWM5JPAVCNFSM6AAAAABDVKGGZSVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTSNZVGE4TINBYHA>
.
You are receiving this because you authored the thread.Message ID:
***@***.***>
|
I can only tell why it terminated by seeing the extended log file, need to run it with that option set to 1 |
I am assembling turtles mitogenomes and in some cases the output I obtain is a "Circularized genome", actually made up of 2 non overlapping contigs: in all these cases, the interruption is in correspondence of the Val tRNA. In the end, I managed to circularized all my samples in one single contig by heightening the kmers and the genome range, but I am willing to understand why this interruption in assembly occurs and whether this might be indicative of some noticeable feature of the mitogenome in that point. Do you have any suggestion?
The text was updated successfully, but these errors were encountered: