isomiR annotation

[bounlu]

Hi,

I don't get the annotation of this isomiR:

seq                      mir             mism     add t5 t3 changes
CTATACAATCTATTGCCTTCCTTT hsa-let-7f-1-3p 22TC24-G T   0  TG 2

seq                      isomir
CTATACAATCTATTGCCTTCCTTT hsa-let-7f-1-3p;iso_snp:22TC24-G;iso_add:T;iso_3p:TG

The original sequence hsa-let-7f-1-3p is CTATACAATCTATTGCCTTCCC.

Where does the G at 3' come from?

[lpantano]

Hi, We need to look at the precursor sequence for that. Probably after the last CCC in the precursor there is a UG that is missing in the sequence, and you are getting TT instead.