From 7fbbdaf9cabbe3639f48fc65733c0e19935953a4 Mon Sep 17 00:00:00 2001 From: Luca Foppiano Date: Fri, 22 Nov 2024 08:49:08 +0000 Subject: [PATCH] new training data and segmentation model --- grobid-home/models/segmentation/model.wapiti | 56961 ++++++++++------ .../s11084-024-09647-4.training.segmentation | 718 + .../s41467-024-52091-1.training.segmentation | 1223 + .../s41588-024-01785-9.training.segmentation | 2811 + ...rum.02630-23.training.segmentation.tei.xml | 2 +- ...-024-09647-4.training.segmentation.tei.xml | 124 + ...-024-52091-1.training.segmentation.tei.xml | 103 + ...-024-01785-9.training.segmentation.tei.xml | 183 + 8 files changed, 40995 insertions(+), 21130 deletions(-) create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/raw/s11084-024-09647-4.training.segmentation create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/raw/s41467-024-52091-1.training.segmentation create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/raw/s41588-024-01785-9.training.segmentation create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/tei/s11084-024-09647-4.training.segmentation.tei.xml create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/tei/s41467-024-52091-1.training.segmentation.tei.xml create mode 100644 grobid-trainer/resources/dataset/segmentation/corpus/tei/s41588-024-01785-9.training.segmentation.tei.xml diff --git a/grobid-home/models/segmentation/model.wapiti b/grobid-home/models/segmentation/model.wapiti index da520bc68c..7683efb038 100644 --- a/grobid-home/models/segmentation/model.wapiti +++ b/grobid-home/models/segmentation/model.wapiti @@ -1,4 +1,4 @@ -#mdl#2#14158 +#mdl#2#13683 #rdr#111/32/0 12:u00:%x[-4,0], 12:u01:%x[-3,0], @@ -137,7 +137,7 @@ 6:, 7:I-, 5:, -#qrk#2194790 +#qrk#2209968 8:u00:_x-4, 8:u01:_x-3, 8:u02:_x-2, @@ -241030,6 +241030,5131 @@ 8:u01:date, 12:u03:595-605., 9:u11:pages, +21:u04:Vol.:(0123456789), +12:u05:Discover, +10:u06:(2024), +12:u08:Discover, +8:u05:Life, +8:u06:54:4, +46:u07:https://doi.org/10.1007/s11084-024-09647-4, +8:u08:Life, +21:u12:vol.:(0123456789), +12:u13:discover, +10:u14:(2024), +8:uI1:.:(), +21:u03:Vol.:(0123456789), +12:u04:Discover, +10:u05:(2024), +12:u07:Discover, +9:u08:Green, +8:u04:Life, +8:u05:54:4, +46:u06:https://doi.org/10.1007/s11084-024-09647-4, +8:u07:Life, +21:u11:vol.:(0123456789), +12:u12:discover, +10:u13:(2024), +8:uI0:.:(), +21:u02:Vol.:(0123456789), +12:u03:Discover, +10:u04:(2024), +12:u06:Discover, +8:u03:Life, +8:u04:54:4, +46:u05:https://doi.org/10.1007/s11084-024-09647-4, +8:u06:Life, +21:u10:vol.:(0123456789), +12:u11:discover, +10:u12:(2024), +12:u14:discover, +14:uI2:://././---, +21:u01:Vol.:(0123456789), +12:u02:Discover, +10:u03:(2024), +9:u07:Green, +8:u02:Life, +8:u03:54:4, +46:u04:https://doi.org/10.1007/s11084-024-09647-4, +12:u10:discover, +10:u11:(2024), +14:uI1:://././---, +21:u00:Vol.:(0123456789), +12:u01:Discover, +10:u02:(2024), +9:u06:Green, +12:u08:Sikander, +8:u01:Life, +8:u02:54:4, +46:u03:https://doi.org/10.1007/s11084-024-09647-4, +10:u10:(2024), +9:u14:green, +14:uI0:://././---, +12:u00:Discover, +10:u01:(2024), +9:u05:Green, +9:u08:Zafar, +8:u00:Life, +8:u01:54:4, +46:u02:https://doi.org/10.1007/s11084-024-09647-4, +7:u08:Ali, +9:u13:green, +10:u00:(2024), +9:u04:Green, +12:u07:Sikander, +12:u08:Mohammed, +8:u00:54:4, +46:u01:https://doi.org/10.1007/s11084-024-09647-4, +7:u07:Ali, +10:u08:Siddiq, +9:u12:green, +8:u23:Gree, +9:u03:Green, +12:u06:Sikander, +9:u07:Zafar, +46:u00:https://doi.org/10.1007/s11084-024-09647-4, +7:u06:Ali, +10:u07:Siddiq, +11:u08:Bourhia, +9:u11:green, +12:u14:sikander, +9:u02:Green, +12:u05:Sikander, +9:u06:Zafar, +12:u07:Mohammed, +7:u05:Ali, +10:u06:Siddiq, +11:u07:Bourhia, +9:u10:green, +12:u13:sikander, +9:u14:zafar, +19:uI2:•••••, +9:u01:Green, +12:u04:Sikander, +9:u05:Zafar, +12:u06:Mohammed, +7:u04:Ali, +10:u05:Siddiq, +11:u06:Bourhia, +12:u12:sikander, +9:u13:zafar, +12:u14:mohammed, +7:u22:Sik, +8:u23:Sika, +19:uI1:•••••, +20:uI2:•••.••, +9:u00:Green, +12:u03:Sikander, +9:u04:Zafar, +12:u05:Mohammed, +7:u03:Ali, +10:u04:Siddiq, +11:u05:Bourhia, +12:u11:sikander, +9:u12:zafar, +12:u13:mohammed, +7:u22:Zaf, +8:u23:Zafa, +19:uI0:•••••, +20:uI1:•••.••, +12:u02:Sikander, +9:u03:Zafar, +12:u04:Mohammed, +7:u02:Ali, +10:u03:Siddiq, +11:u04:Bourhia, +12:u10:sikander, +9:u11:zafar, +12:u12:mohammed, +20:uI0:•••.••, +7:uI2::/:, +12:u01:Sikander, +9:u02:Zafar, +12:u03:Mohammed, +7:u01:Ali, +10:u02:Siddiq, +11:u03:Bourhia, +9:u10:zafar, +12:u11:mohammed, +7:uI1::/:, +12:u00:Sikander, +9:u01:Zafar, +12:u02:Mohammed, +7:u08:mum, +7:u00:Ali, +10:u01:Siddiq, +11:u02:Bourhia, +12:u10:mohammed, +7:uI0::/:, +9:u00:Zafar, +12:u01:Mohammed, +10:u00:Siddiq, +11:u01:Bourhia, +12:u08:tyrosine, +12:u00:Mohammed, +7:u07:mum, +11:u00:Bourhia, +12:u07:tyrosine, +7:u06:mum, +12:u06:tyrosine, +7:u14:mum, +7:u05:mum, +11:u08:groups,, +12:u05:tyrosine, +7:u13:mum, +16:uI2:()(.,/),(-),, +7:u04:mum, +19:u08:mycosynthesized, +12:u04:tyrosine, +7:u12:mum, +7:u22:mum, +7:u23:mum, +16:uI1:()(.,/),(-),, +10:uI2:().()., +7:u03:mum, +11:u07:groups,, +9:u08:AgNPs, +12:u03:tyrosine, +7:u11:mum, +16:uI0:()(.,/),(-),, +10:uI1:().()., +7:u02:mum, +11:u06:groups,, +19:u07:mycosynthesized, +12:u02:tyrosine, +9:u07:AgNPs, +7:u10:mum, +11:u14:groups,, +10:uI0:().()., +7:u01:mum, +11:u05:groups,, +19:u06:mycosynthesized, +7:u08:(20, +12:u01:tyrosine, +9:u06:AgNPs, +11:u13:groups,, +19:u14:mycosynthesized, +9:uI2:,.-(), +7:u00:mum, +11:u04:groups,, +19:u05:mycosynthesized, +6:u08:TH, +12:u00:tyrosine, +9:u05:AgNPs, +8:u08:℃), +11:u12:groups,, +19:u13:mycosynthesized, +9:u14:agnps, +9:uI1:,.-(), +21:uI2:.(),.(),.(),.().-, +11:u03:groups,, +19:u04:mycosynthesized, +7:u07:(20, +9:u04:AgNPs, +8:u07:℃), +11:u11:groups,, +19:u12:mycosynthesized, +9:u13:agnps, +9:uI0:,.-(), +21:uI1:.(),.(),.(),.().-, +11:u02:groups,, +19:u03:mycosynthesized, +7:u06:(20, +6:u07:TH, +15:u08:efficiency., +9:u03:AgNPs, +8:u06:℃), +11:u10:groups,, +19:u11:mycosynthesized, +9:u12:agnps, +7:u14:(20, +7:u22:AgN, +8:u23:AgNP, +21:uI0:.(),.(),.(),.().-, +11:u01:groups,, +19:u02:mycosynthesized, +7:u05:(20, +6:u06:TH, +9:u02:AgNPs, +8:u05:℃), +13:u08:AgA-AgNPs, +19:u10:mycosynthesized, +9:u11:agnps, +7:u13:(20, +13:uI2:()..---.,, +11:u00:groups,, +19:u01:mycosynthesized, +7:u04:(20, +6:u05:TH, +15:u07:efficiency., +14:u08:Highlights, +9:u01:AgNPs, +8:u04:℃), +13:u07:AgA-AgNPs, +9:u10:agnps, +7:u12:(20, +7:u23:(20, +13:uI1:()..---.,, +11:uI2:-..../., +19:u00:mycosynthesized, +7:u03:(20, +6:u04:TH, +15:u06:efficiency., +9:u00:AgNPs, +8:u03:℃), +13:u06:AgA-AgNPs, +7:u11:(20, +15:u14:efficiency., +6:u22:TH, +6:u23:TH, +13:uI0:()..---.,, +11:uI1:-..../., +7:u02:(20, +6:u03:TH, +15:u05:efficiency., +14:u07:Highlights, +8:u02:℃), +13:u05:AgA-AgNPs, +7:u10:(20, +15:u13:efficiency., +11:uI0:-..../., +7:u01:(20, +6:u02:TH, +15:u04:efficiency., +14:u06:Highlights, +12:u08:09647-4., +8:u01:℃), +13:u04:AgA-AgNPs, +15:u12:efficiency., +14:u14:highlights, +7:u00:(20, +6:u01:TH, +15:u03:efficiency., +14:u05:Highlights, +8:u00:℃), +13:u03:AgA-AgNPs, +15:u11:efficiency., +14:u13:highlights, +6:u00:TH, +15:u02:efficiency., +14:u04:Highlights, +12:u07:09647-4., +33:u08:Patelsanjay.pharma@gmail.com;, +13:u02:AgA-AgNPs, +15:u10:efficiency., +14:u12:highlights, +7:u22:Hig, +8:u23:High, +15:u01:efficiency., +14:u03:Highlights, +12:u06:09647-4., +10:u08:(IIB),, +13:u01:AgA-AgNPs, +9:u08:Tawaf, +14:u11:highlights, +12:u14:09647-4., +13:uI2:://././--, +15:u00:efficiency., +14:u02:Highlights, +12:u05:09647-4., +33:u07:Patelsanjay.pharma@gmail.com;, +13:u00:AgA-AgNPs, +9:u07:Tawaf, +14:u10:highlights, +12:u13:09647-4., +13:uI1:://././--, +14:u01:Highlights, +12:u04:09647-4., +33:u06:Patelsanjay.pharma@gmail.com;, +10:u07:(IIB),, +13:u08:Pakistan., +9:u06:Tawaf, +11:u08:Lahore,, +12:u12:09647-4., +33:u14:patelsanjay.pharma@gmail.com;, +7:u22:096, +8:u23:0964, +13:uI0:://././--, +17:uI2:*,.@..;*,@.;,, +14:u00:Highlights, +12:u03:09647-4., +33:u05:Patelsanjay.pharma@gmail.com;, +10:u06:(IIB),, +9:u05:Tawaf, +11:u07:Lahore,, +12:u11:09647-4., +33:u13:patelsanjay.pharma@gmail.com;, +10:u14:(iib),, +17:uI1:*,.@..;*,@.;,, +12:uI2:.@.;,@.,, +12:u02:09647-4., +33:u04:Patelsanjay.pharma@gmail.com;, +10:u05:(IIB),, +13:u07:Pakistan., +11:u08:Riyadh,, +9:u04:Tawaf, +11:u06:Lahore,, +12:u10:09647-4., +33:u12:patelsanjay.pharma@gmail.com;, +10:u13:(iib),, +8:u23:Pate, +17:uI0:*,.@..;*,@.;,, +12:uI1:.@.;,@.,, +11:uI2:(),,,.,, +12:u01:09647-4., +33:u03:Patelsanjay.pharma@gmail.com;, +10:u04:(IIB),, +13:u06:Pakistan., +9:u03:Tawaf, +11:u05:Lahore,, +9:u08:Saudi, +33:u11:patelsanjay.pharma@gmail.com;, +10:u12:(iib),, +13:u14:pakistan., +7:u22:(II, +8:u23:(IIB, +12:uI0:.@.;,@.,, +11:uI1:(),,,.,, +10:uI2:,,.,,,, +12:u00:09647-4., +33:u02:Patelsanjay.pharma@gmail.com;, +10:u03:(IIB),, +13:u05:Pakistan., +11:u07:Riyadh,, +21:u08:Vol:.(1234567890), +9:u02:Tawaf, +11:u04:Lahore,, +9:u07:Saudi, +33:u10:patelsanjay.pharma@gmail.com;, +10:u11:(iib),, +13:u13:pakistan., +11:uI0:(),,,.,, +10:uI1:,,.,,,, +10:uI2:.,,,.,, +33:u01:Patelsanjay.pharma@gmail.com;, +10:u02:(IIB),, +13:u04:Pakistan., +11:u06:Riyadh,, +9:u01:Tawaf, +11:u03:Lahore,, +9:u06:Saudi, +10:u10:(iib),, +13:u12:pakistan., +11:u14:riyadh,, +7:u22:Pak, +8:u23:Paki, +10:uI0:,,.,,,, +10:uI1:.,,,.,, +13:uI2:,,.,,,..,, +33:u00:Patelsanjay.pharma@gmail.com;, +10:u01:(IIB),, +13:u03:Pakistan., +11:u05:Riyadh,, +21:u07:Vol:.(1234567890), +9:u00:Tawaf, +11:u02:Lahore,, +9:u05:Saudi, +13:u11:pakistan., +11:u13:riyadh,, +11:u14:faculty, +10:uI0:.,,,.,, +13:uI1:,,.,,,..,, +12:uI2:,.,,',.,, +10:u00:(IIB),, +13:u02:Pakistan., +11:u04:Riyadh,, +21:u06:Vol:.(1234567890), +10:u08:(2024), +11:u01:Lahore,, +9:u04:Saudi, +13:u10:pakistan., +11:u12:riyadh,, +11:u13:faculty, +21:u14:vol:.(1234567890), +7:u22:Riy, +8:u23:Riya, +13:uI0:,,.,,,..,, +12:uI1:,.,,',.,, +13:u01:Pakistan., +11:u03:Riyadh,, +21:u05:Vol:.(1234567890), +11:u00:Lahore,, +9:u03:Saudi, +8:u08:54:4, +11:u11:riyadh,, +11:u12:faculty, +21:u13:vol:.(1234567890), +8:u23:Facu, +12:uI0:,.,,',.,, +13:u00:Pakistan., +11:u02:Riyadh,, +21:u04:Vol:.(1234567890), +10:u07:(2024), +46:u08:https://doi.org/10.1007/s11084-024-09647-4, +9:u02:Saudi, +8:u07:54:4, +11:u10:riyadh,, +11:u11:faculty, +21:u12:vol:.(1234567890), +8:u23:Vol:, +11:u01:Riyadh,, +21:u03:Vol:.(1234567890), +9:u01:Saudi, +11:u10:faculty, +21:u11:vol:.(1234567890), +11:u00:Riyadh,, +21:u02:Vol:.(1234567890), +9:u00:Saudi, +12:u08:Improved, +21:u10:vol:.(1234567890), +21:u01:Vol:.(1234567890), +12:u07:Improved, +46:u14:https://doi.org/10.1007/s11084-024-09647-4, +21:u00:Vol:.(1234567890), +12:u06:Improved, +10:u08:Silver, +46:u13:https://doi.org/10.1007/s11084-024-09647-4, +12:u08:Tyrosine, +12:u05:Improved, +10:u07:Silver, +46:u12:https://doi.org/10.1007/s11084-024-09647-4, +9:uI2:•--, +12:u04:Improved, +10:u06:Silver, +15:u08:hydroxylase, +46:u11:https://doi.org/10.1007/s11084-024-09647-4, +9:uI1:•--, +12:u07:Tyrosine, +12:u03:Improved, +10:u05:Silver, +15:u07:hydroxylase, +23:u08:tetrahydrobiopterin, +46:u10:https://doi.org/10.1007/s11084-024-09647-4, +9:uI0:•--, +21:uI2:••-•••-, +12:u06:Tyrosine, +12:u08:Hydroxyl, +12:u02:Improved, +10:u04:Silver, +15:u06:hydroxylase, +23:u07:tetrahydrobiopterin, +12:u14:tyrosine, +21:uI1:••-•••-, +12:u05:Tyrosine, +12:u01:Improved, +10:u03:Silver, +15:u05:hydroxylase, +23:u06:tetrahydrobiopterin, +12:u13:tyrosine, +21:uI0:••-•••-, +12:u04:Tyrosine, +12:u07:Hydroxyl, +12:u00:Improved, +10:u02:Silver, +15:u04:hydroxylase, +23:u05:tetrahydrobiopterin, +10:u08:L-dopa, +12:u12:tyrosine, +7:u22:Tyr, +8:u23:Tyro, +12:u03:Tyrosine, +12:u06:Hydroxyl, +10:u01:Silver, +15:u03:hydroxylase, +23:u04:tetrahydrobiopterin, +10:u07:L-dopa, +12:u08:frequent, +12:u11:tyrosine, +12:u14:hydroxyl, +16:uI2:[].,(....)-., +12:u02:Tyrosine, +12:u05:Hydroxyl, +13:u08:disorder,, +10:u00:Silver, +15:u02:hydroxylase, +23:u03:tetrahydrobiopterin, +10:u06:L-dopa, +12:u07:frequent, +12:u10:tyrosine, +12:u13:hydroxyl, +16:uI1:[].,(....)-., +10:uI2:-(,'-), +12:u01:Tyrosine, +12:u04:Hydroxyl, +15:u01:hydroxylase, +23:u02:tetrahydrobiopterin, +10:u05:L-dopa, +12:u06:frequent, +12:u12:hydroxyl, +7:u22:Hyd, +8:u23:Hydr, +16:uI0:[].,(....)-., +10:uI1:-(,'-), +17:uI2:-(,---)[].'(), +12:u00:Tyrosine, +12:u03:Hydroxyl, +13:u07:disorder,, +15:u00:hydroxylase, +23:u01:tetrahydrobiopterin, +10:u04:L-dopa, +12:u05:frequent, +12:u11:hydroxyl, +10:uI0:-(,'-), +17:uI1:-(,---)[].'(), +10:uI2:'.-,,-, +12:u02:Hydroxyl, +13:u06:disorder,, +23:u00:tetrahydrobiopterin, +10:u03:L-dopa, +12:u04:frequent, +12:u10:hydroxyl, +13:u14:disorder,, +17:uI0:-(,---)[].'(), +10:uI1:'.-,,-, +12:u01:Hydroxyl, +13:u05:disorder,, +15:u08:crystalline, +10:u02:L-dopa, +12:u03:frequent, +13:u13:disorder,, +10:uI0:'.-,,-, +12:u00:Hydroxyl, +13:u04:disorder,, +17:u08:decarboxylase, +10:u01:L-dopa, +12:u02:frequent, +13:u12:disorder,, +13:u03:disorder,, +15:u07:crystalline, +10:u00:L-dopa, +12:u01:frequent, +9:u08:(E.C., +13:u11:disorder,, +12:uI2:.'(,---), +13:u02:disorder,, +15:u06:crystalline, +17:u07:decarboxylase, +12:u00:frequent, +9:u07:(E.C., +13:u10:disorder,, +15:u14:crystalline, +12:uI1:.'(,---), +12:uI2:[].,,,.,, +13:u01:disorder,, +15:u05:crystalline, +17:u06:decarboxylase, +9:u06:(E.C., +15:u13:crystalline, +17:u14:decarboxylase, +12:uI0:.'(,---), +12:uI1:[].,,,.,, +9:uI2:./[]., +13:u00:disorder,, +15:u04:crystalline, +17:u05:decarboxylase, +13:u08:prospects, +9:u05:(E.C., +13:u08:materials, +15:u12:crystalline, +17:u13:decarboxylase, +7:u22:cry, +8:u23:crys, +12:uI0:[].,,,.,, +9:uI1:./[]., +14:uI2:(.....)-.,, +15:u03:crystalline, +17:u04:decarboxylase, +18:u08:antibacterial,, +9:u04:(E.C., +13:u07:materials, +15:u11:crystalline, +17:u12:decarboxylase, +9:uI0:./[]., +14:uI1:(.....)-.,, +15:u02:crystalline, +17:u03:decarboxylase, +13:u07:prospects, +8:u08:drug, +9:u03:(E.C., +13:u06:materials, +14:u08:antiviral,, +15:u10:crystalline, +17:u11:decarboxylase, +14:uI0:(.....)-.,, +15:u01:crystalline, +17:u02:decarboxylase, +13:u06:prospects, +18:u07:antibacterial,, +9:u02:(E.C., +13:u05:materials, +14:u07:antiviral,, +17:u10:decarboxylase, +13:u14:prospects, +15:u00:crystalline, +17:u01:decarboxylase, +13:u05:prospects, +18:u06:antibacterial,, +8:u07:drug, +9:u01:(E.C., +13:u04:materials, +14:u06:antiviral,, +13:u13:prospects, +18:u14:antibacterial,, +17:u00:decarboxylase, +13:u04:prospects, +18:u05:antibacterial,, +8:u06:drug, +9:u00:(E.C., +13:u03:materials, +14:u05:antiviral,, +7:u08:NPs, +13:u12:prospects, +18:u13:antibacterial,, +8:u23:pros, +13:u03:prospects, +18:u04:antibacterial,, +8:u05:drug, +18:u08:biosynthesized, +13:u02:materials, +14:u04:antiviral,, +7:u07:NPs, +17:u08:antibacterial, +13:u11:prospects, +18:u12:antibacterial,, +11:uI2:,,,,[]., +13:u02:prospects, +18:u03:antibacterial,, +8:u04:drug, +9:u08:green, +13:u01:materials, +14:u03:antiviral,, +7:u06:NPs, +17:u07:antibacterial, +13:u10:prospects, +18:u11:antibacterial,, +11:uI1:,,,,[]., +13:u01:prospects, +18:u02:antibacterial,, +8:u03:drug, +18:u07:biosynthesized, +13:u00:materials, +14:u02:antiviral,, +7:u05:NPs, +17:u06:antibacterial, +18:u10:antibacterial,, +11:uI0:,,,,[]., +10:uI2:-[].[], +13:u00:prospects, +18:u01:antibacterial,, +8:u02:drug, +18:u06:biosynthesized, +9:u07:green, +14:u01:antiviral,, +7:u04:NPs, +17:u05:antibacterial, +7:u08:Nps, +18:u14:biosynthesized, +10:uI1:-[].[], +18:u00:antibacterial,, +8:u01:drug, +18:u05:biosynthesized, +9:u06:green, +14:u00:antiviral,, +7:u03:NPs, +17:u04:antibacterial, +7:u07:Nps, +18:u13:biosynthesized, +10:uI0:-[].[], +8:u00:drug, +18:u04:biosynthesized, +9:u05:green, +7:u02:NPs, +17:u03:antibacterial, +7:u06:Nps, +18:u12:biosynthesized, +8:u23:bios, +9:uI2:[].[], +18:u03:biosynthesized, +9:u04:green, +14:u08:electronic, +7:u01:NPs, +17:u02:antibacterial, +7:u05:Nps, +18:u11:biosynthesized, +7:u14:nps, +8:u23:gree, +9:uI1:[].[], +18:u02:biosynthesized, +9:u03:green, +7:u00:NPs, +17:u01:antibacterial, +7:u04:Nps, +18:u10:biosynthesized, +7:u13:nps, +9:uI0:[].[], +18:u01:biosynthesized, +9:u02:green, +14:u07:electronic, +17:u00:antibacterial, +7:u03:Nps, +7:u12:nps, +7:u22:NPs, +7:u23:NPs, +13:uI2:,,[][].,-, +18:u00:biosynthesized, +9:u01:green, +14:u06:electronic, +15:u08:nanoscience, +7:u02:Nps, +7:u11:nps, +14:u14:electronic, +13:uI1:,,[][].,-, +9:u00:green, +14:u05:electronic, +14:u08:cosmetics,, +7:u01:Nps, +7:u10:nps, +14:u13:electronic, +13:uI0:,,[][].,-, +10:uI2:,,,,-., +14:u04:electronic, +15:u07:nanoscience, +7:u00:Nps, +16:u08:electronics,, +14:u12:electronic, +10:uI1:,,,,-., +14:u03:electronic, +15:u06:nanoscience, +14:u07:cosmetics,, +18:u08:antifungicidal, +16:u07:electronics,, +14:u11:electronic, +15:u14:nanoscience, +10:uI0:,,,,-., +14:u02:electronic, +15:u05:nanoscience, +14:u06:cosmetics,, +16:u06:electronics,, +14:u10:electronic, +15:u13:nanoscience, +14:u14:cosmetics,, +13:uI2:.,,,,,,,,, +14:u01:electronic, +15:u04:nanoscience, +14:u05:cosmetics,, +18:u07:antifungicidal, +16:u05:electronics,, +15:u12:nanoscience, +14:u13:cosmetics,, +13:uI1:.,,,,,,,,, +14:u00:electronic, +15:u03:nanoscience, +14:u04:cosmetics,, +18:u06:antifungicidal, +16:u04:electronics,, +15:u11:nanoscience, +14:u12:cosmetics,, +18:u14:antifungicidal, +8:u23:cosm, +13:uI0:.,,,,,,,,, +15:u02:nanoscience, +14:u03:cosmetics,, +18:u05:antifungicidal, +16:u03:electronics,, +14:u08:L-tyrosine, +15:u10:nanoscience, +14:u11:cosmetics,, +18:u13:antifungicidal, +15:u01:nanoscience, +14:u02:cosmetics,, +18:u04:antifungicidal, +16:u02:electronics,, +14:u07:L-tyrosine, +14:u10:cosmetics,, +18:u12:antifungicidal, +9:uI2:()-'., +15:u00:nanoscience, +14:u01:cosmetics,, +18:u03:antifungicidal, +16:u01:electronics,, +14:u06:L-tyrosine, +18:u11:antifungicidal, +9:uI1:()-'., +14:u00:cosmetics,, +18:u02:antifungicidal, +16:u00:electronics,, +14:u05:L-tyrosine, +18:u10:antifungicidal, +7:u22:tyr, +8:u23:tyro, +9:uI0:()-'., +8:uI2:-.'', +18:u01:antifungicidal, +14:u04:L-tyrosine, +8:uI1:-.'', +18:u00:antifungicidal, +21:u08:Vol.:(0123456789), +14:u03:L-tyrosine, +8:uI0:-.'', +14:u02:L-tyrosine, +13:u14:activity., +21:u07:Vol.:(0123456789), +14:u01:L-tyrosine, +13:u13:activity., +21:u06:Vol.:(0123456789), +14:u00:L-tyrosine, +13:u12:activity., +21:u14:vol.:(0123456789), +21:u05:Vol.:(0123456789), +13:u11:activity., +21:u13:vol.:(0123456789), +8:uI2:.:(), +13:u10:activity., +13:u08:Materials, +9:u08:Acros, +13:u07:Materials, +17:u08:premium-grade, +13:u06:Materials, +17:u07:premium-grade, +12:u08:Organics, +9:u07:Acros, +12:u08:Agaricus, +13:u05:Materials, +17:u06:premium-grade, +12:u07:Organics, +9:u06:Acros, +13:u04:Materials, +17:u05:premium-grade, +12:u06:Organics, +12:u08:arvensis, +9:u14:acros, +9:u05:Acros, +12:u07:Agaricus, +13:u03:Materials, +17:u04:premium-grade, +12:u05:Organics, +12:u07:arvensis, +12:u08:mushroom, +9:u13:acros, +19:uI2:(),(),(..),-()., +9:u04:Acros, +12:u06:Agaricus, +11:u08:Whatman, +13:u02:Materials, +17:u03:premium-grade, +12:u04:Organics, +12:u06:arvensis, +12:u07:mushroom, +9:u12:acros, +12:u14:agaricus, +8:u23:Acro, +19:uI1:(),(),(..),-()., +9:u03:Acros, +12:u05:Agaricus, +13:u01:Materials, +17:u02:premium-grade, +12:u03:Organics, +12:u05:arvensis, +12:u06:mushroom, +9:u11:acros, +12:u13:agaricus, +19:uI0:(),(),(..),-()., +9:u02:Acros, +12:u04:Agaricus, +11:u07:Whatman, +13:u00:Materials, +17:u01:premium-grade, +12:u02:Organics, +12:u04:arvensis, +12:u05:mushroom, +15:u08:Preparation, +9:u10:acros, +12:u12:agaricus, +12:u14:properly, +10:uI2:-(,.)., +9:u01:Acros, +12:u03:Agaricus, +11:u06:Whatman, +17:u00:premium-grade, +12:u01:Organics, +12:u03:arvensis, +12:u04:mushroom, +15:u07:Preparation, +12:u11:agaricus, +12:u13:properly, +11:u14:whatman, +10:uI1:-(,.)., +9:u00:Acros, +12:u02:Agaricus, +11:u05:Whatman, +9:u08:many), +12:u00:Organics, +12:u02:arvensis, +12:u03:mushroom, +15:u06:Preparation, +12:u10:agaricus, +12:u12:properly, +11:u13:whatman, +10:uI0:-(,.)., +12:u01:Agaricus, +11:u04:Whatman, +15:u08:Afterwards,, +12:u01:arvensis, +12:u02:mushroom, +15:u05:Preparation, +12:u11:properly, +11:u12:whatman, +12:u00:Agaricus, +11:u03:Whatman, +9:u07:many), +12:u00:arvensis, +12:u01:mushroom, +15:u04:Preparation, +12:u10:properly, +11:u11:whatman, +12:u14:mushroom, +11:u02:Whatman, +9:u06:many), +15:u07:Afterwards,, +12:u00:mushroom, +15:u03:Preparation, +8:u08:UV-V, +11:u10:whatman, +12:u13:mushroom, +9:u14:many), +12:uI2:.(:-,,,-, +11:u01:Whatman, +9:u05:many), +15:u06:Afterwards,, +15:u02:Preparation, +8:u07:UV-V, +12:u12:mushroom, +9:u13:many), +15:u14:afterwards,, +8:u23:mush, +12:uI1:.(:-,,,-, +8:uI2:).,., +11:u00:Whatman, +9:u04:many), +15:u05:Afterwards,, +15:u01:Preparation, +8:u06:UV-V, +12:u11:mushroom, +9:u12:many), +15:u13:afterwards,, +12:uI0:.(:-,,,-, +8:uI1:).,., +9:u03:many), +15:u04:Afterwards,, +15:u00:Preparation, +8:u05:UV-V, +16:u08:Optimization, +12:u10:mushroom, +9:u11:many), +15:u12:afterwards,, +8:uI0:).,., +14:uI2:-(-,,,..)., +9:u02:many), +15:u03:Afterwards,, +10:u08:lative, +8:u04:UV-V, +16:u07:Optimization, +9:u10:many), +15:u11:afterwards,, +14:uI1:-(-,,,..)., +9:u01:many), +15:u02:Afterwards,, +11:u08:saline., +8:u03:UV-V, +16:u06:Optimization, +15:u10:afterwards,, +14:uI0:-(-,,,..)., +9:u00:many), +15:u01:Afterwards,, +10:u07:lative, +15:u08:investigate, +8:u02:UV-V, +16:u05:Optimization, +10:u08:Later,, +15:u00:Afterwards,, +10:u06:lative, +11:u07:saline., +7:u08:60,, +8:u01:UV-V, +16:u04:Optimization, +10:u07:Later,, +10:u14:lative, +8:uI2:(/)-, +10:u05:lative, +11:u06:saline., +15:u07:investigate, +8:u00:UV-V, +16:u03:Optimization, +10:u06:Later,, +7:u08:70,, +10:u13:lative, +11:u14:saline., +8:uI1:(/)-, +9:uI2:..(/), +10:u04:lative, +11:u05:saline., +15:u06:investigate, +7:u07:60,, +7:u08:2.4, +16:u02:Optimization, +10:u05:Later,, +7:u07:70,, +10:u12:lative, +11:u13:saline., +15:u14:investigate, +8:uI0:(/)-, +9:uI1:..(/), +16:uI2:.,./(.)./(.), +10:u03:lative, +11:u04:saline., +15:u05:investigate, +7:u06:60,, +16:u01:Optimization, +10:u04:Later,, +7:u06:70,, +11:u08:Aerobic, +10:u11:lative, +11:u12:saline., +15:u13:investigate, +7:u14:60,, +8:u23:sali, +9:uI0:..(/), +16:uI1:.,./(.)./(.), +10:u02:lative, +11:u03:saline., +15:u04:investigate, +7:u05:60,, +7:u07:2.4, +16:u00:Optimization, +10:u03:Later,, +7:u05:70,, +11:u07:Aerobic, +10:u10:lative, +11:u11:saline., +15:u12:investigate, +7:u13:60,, +16:uI0:.,./(.)./(.), +15:uI2:,,,,(-,,,)., +10:u01:lative, +11:u02:saline., +15:u03:investigate, +7:u04:60,, +7:u06:2.4, +14:u08:comprising, +10:u02:Later,, +7:u04:70,, +11:u06:Aerobic, +11:u10:saline., +15:u11:investigate, +7:u12:60,, +7:u14:2.4, +7:u22:60,, +7:u23:60,, +15:uI1:,,,,(-,,,)., +10:u00:lative, +11:u01:saline., +15:u02:investigate, +7:u03:60,, +7:u05:2.4, +10:u01:Later,, +7:u03:70,, +11:u05:Aerobic, +15:u10:investigate, +7:u11:60,, +7:u13:2.4, +15:uI0:,,,,(-,,,)., +11:u00:saline., +15:u01:investigate, +7:u02:60,, +7:u04:2.4, +14:u07:comprising, +13:u08:Germany)., +10:u00:Later,, +7:u02:70,, +11:u04:Aerobic, +7:u10:60,, +7:u12:2.4, +7:u23:2.4, +15:u00:investigate, +7:u01:60,, +7:u03:2.4, +14:u06:comprising, +7:u01:70,, +11:u03:Aerobic, +7:u11:2.4, +14:u14:comprising, +7:u00:60,, +7:u02:2.4, +14:u05:comprising, +13:u07:Germany)., +7:u00:70,, +11:u02:Aerobic, +17:u08:Centrifuges)., +7:u10:2.4, +14:u13:comprising, +11:uI2:./-,/-., +7:u01:2.4, +14:u04:comprising, +13:u06:Germany)., +9:u08:2.5.1, +11:u01:Aerobic, +17:u07:Centrifuges)., +14:u08:Analytical, +14:u12:comprising, +13:u14:germany)., +11:uI1:./-,/-., +9:uI2:(-,,,, +7:u00:2.4, +14:u03:comprising, +13:u05:Germany)., +11:u00:Aerobic, +17:u06:Centrifuges)., +14:u07:Analytical, +14:u11:comprising, +13:u13:germany)., +11:uI0:./-,/-., +9:uI1:(-,,,, +11:uI2:).(,)(,, +14:u02:comprising, +13:u04:Germany)., +9:u07:2.5.1, +14:u08:L-ascorbic, +17:u05:Centrifuges)., +14:u06:Analytical, +14:u10:comprising, +13:u12:germany)., +9:uI0:(-,,,, +11:uI1:).(,)(,, +14:u01:comprising, +13:u03:Germany)., +9:u06:2.5.1, +17:u04:Centrifuges)., +14:u05:Analytical, +13:u11:germany)., +9:u14:2.5.1, +11:uI0:).(,)(,, +14:u00:comprising, +13:u02:Germany)., +9:u05:2.5.1, +14:u07:L-ascorbic, +17:u03:Centrifuges)., +14:u04:Analytical, +13:u10:germany)., +9:u13:2.5.1, +13:u01:Germany)., +9:u04:2.5.1, +14:u06:L-ascorbic, +10:u08:enzyme, +17:u02:Centrifuges)., +14:u03:Analytical, +8:u08:till, +9:u12:2.5.1, +14:u14:l-ascorbic, +12:uI2:[,].(.)., +13:u00:Germany)., +9:u03:2.5.1, +14:u05:L-ascorbic, +17:u01:Centrifuges)., +14:u02:Analytical, +8:u07:till, +9:u11:2.5.1, +14:u13:l-ascorbic, +12:uI1:[,].(.)., +22:uI2:-(.),(.),-(.).(.,), +9:u02:2.5.1, +14:u04:L-ascorbic, +10:u07:enzyme, +17:u00:Centrifuges)., +14:u01:Analytical, +8:u06:till, +9:u10:2.5.1, +14:u12:l-ascorbic, +6:u21:L-, +7:u22:L-a, +8:u23:L-as, +12:uI0:[,].(.)., +22:uI1:-(.),(.),-(.).(.,), +9:u01:2.5.1, +14:u03:L-ascorbic, +10:u06:enzyme, +14:u00:Analytical, +8:u05:till, +14:u11:l-ascorbic, +22:uI0:-(.),(.),-(.).(.,), +9:u00:2.5.1, +14:u02:L-ascorbic, +10:u05:enzyme, +8:u04:till, +14:u10:l-ascorbic, +14:u01:L-ascorbic, +10:u04:enzyme, +8:u03:till, +8:uI2:--.:, +14:u00:L-ascorbic, +10:u03:enzyme, +8:u02:till, +8:uI1:--.:, +10:u02:enzyme, +8:u01:till, +8:uI0:--.:, +10:u01:enzyme, +9:u08:2.5.2, +8:u00:till, +10:u00:enzyme, +13:u08:Catalytic, +9:u07:2.5.2, +11:u08:bilized, +13:u07:Catalytic, +13:u08:catalytic, +9:u06:2.5.2, +9:u08:lized, +13:u06:Catalytic, +13:u07:catalytic, +11:u08:enzyme., +9:u14:2.5.2, +9:u05:2.5.2, +11:u07:bilized, +13:u05:Catalytic, +13:u06:catalytic, +11:u07:enzyme., +9:u13:2.5.2, +9:u04:2.5.2, +11:u06:bilized, +9:u07:lized, +14:u08:discarded., +13:u04:Catalytic, +13:u05:catalytic, +11:u06:enzyme., +9:u12:2.5.2, +11:u14:bilized, +9:u03:2.5.2, +11:u05:bilized, +9:u06:lized, +13:u03:Catalytic, +13:u04:catalytic, +11:u05:enzyme., +9:u11:2.5.2, +11:u13:bilized, +9:u14:lized, +9:u02:2.5.2, +11:u04:bilized, +9:u05:lized, +14:u07:discarded., +13:u02:Catalytic, +13:u03:catalytic, +11:u04:enzyme., +9:u10:2.5.2, +11:u12:bilized, +9:u13:lized, +11:uI2:,,,,.,., +9:u01:2.5.2, +11:u03:bilized, +9:u04:lized, +14:u06:discarded., +9:u08:2.5.3, +13:u01:Catalytic, +13:u02:catalytic, +11:u03:enzyme., +11:u11:bilized, +9:u12:lized, +14:u14:discarded., +7:u22:liz, +8:u23:lize, +11:uI1:,,,,.,., +9:u00:2.5.2, +11:u02:bilized, +9:u03:lized, +14:u05:discarded., +13:u00:Catalytic, +13:u01:catalytic, +11:u02:enzyme., +10:u08:L-Dopa, +11:u10:bilized, +9:u11:lized, +14:u13:discarded., +7:u14:25,, +11:uI0:,,,,.,., +10:uI2:..,,,,, +11:u01:bilized, +9:u02:lized, +14:u04:discarded., +9:u07:2.5.3, +13:u00:catalytic, +11:u01:enzyme., +10:u07:L-Dopa, +11:u08:enzymes, +9:u10:lized, +14:u12:discarded., +7:u13:25,, +10:uI1:..,,,,, +11:u00:bilized, +9:u01:lized, +14:u03:discarded., +9:u06:2.5.3, +11:u00:enzyme., +10:u06:L-Dopa, +11:u07:enzymes, +14:u08:synthesis., +14:u11:discarded., +7:u12:25,, +9:u14:2.5.3, +7:u23:25,, +10:uI0:..,,,,, +9:u00:lized, +14:u02:discarded., +9:u05:2.5.3, +10:u05:L-Dopa, +11:u06:enzymes, +14:u07:synthesis., +14:u10:discarded., +7:u11:25,, +9:u13:2.5.3, +14:u01:discarded., +9:u04:2.5.3, +11:u08:reagent, +10:u04:L-Dopa, +11:u05:enzymes, +14:u06:synthesis., +7:u10:25,, +9:u12:2.5.3, +10:u14:l-dopa, +14:u00:discarded., +9:u03:2.5.3, +10:u03:L-Dopa, +11:u04:enzymes, +14:u05:synthesis., +9:u11:2.5.3, +10:u13:l-dopa, +13:uI2:-.,,,,,,,, +9:u02:2.5.3, +11:u07:reagent, +8:u08:viz., +10:u02:L-Dopa, +11:u03:enzymes, +14:u04:synthesis., +9:u10:2.5.3, +10:u12:l-dopa, +7:u22:L-d, +8:u23:L-do, +13:uI1:-.,,,,,,,, +9:u01:2.5.3, +11:u06:reagent, +12:u08:y+0.0008, +10:u01:L-Dopa, +11:u02:enzymes, +14:u03:synthesis., +10:u11:l-dopa, +11:u14:reagent, +13:uI0:-.,,,,,,,, +8:uI2:.-.,, +9:u00:2.5.3, +11:u05:reagent, +8:u07:viz., +10:u00:L-Dopa, +11:u01:enzymes, +14:u02:synthesis., +10:u10:l-dopa, +11:u13:reagent, +8:uI1:.-.,, +11:u04:reagent, +8:u06:viz., +12:u07:y+0.0008, +11:u00:enzymes, +14:u01:synthesis., +11:u12:reagent, +8:u14:viz., +8:u23:reag, +8:uI0:.-.,, +11:u03:reagent, +8:u05:viz., +12:u06:y+0.0008, +14:u00:synthesis., +11:u11:reagent, +8:u13:viz., +12:u14:y+0.0008, +11:uI2:...,..,, +11:u02:reagent, +8:u04:viz., +12:u05:y+0.0008, +8:u08:NaOH, +11:u10:reagent, +8:u12:viz., +12:u13:y+0.0008, +7:u22:viz, +8:u23:viz., +11:uI1:...,..,, +11:u01:reagent, +8:u03:viz., +12:u04:y+0.0008, +8:u11:viz., +12:u12:y+0.0008, +6:u21:y+, +7:u22:y+0, +8:u23:y+0., +11:uI0:...,..,, +11:u00:reagent, +8:u02:viz., +12:u03:y+0.0008, +8:u07:NaOH, +8:u10:viz., +12:u11:y+0.0008, +8:u01:viz., +12:u02:y+0.0008, +8:u06:NaOH, +7:u08:2.6, +12:u10:y+0.0008, +8:u14:naoh, +8:u00:viz., +12:u01:y+0.0008, +8:u05:NaOH, +8:u13:naoh, +12:u00:y+0.0008, +8:u04:NaOH, +7:u07:2.6, +8:u12:naoh, +7:u22:NaO, +8:u23:NaOH, +8:u03:NaOH, +7:u06:2.6, +8:u11:naoh, +7:u14:2.6, +8:u02:NaOH, +7:u05:2.6, +7:u08:2.7, +8:u10:naoh, +7:u13:2.6, +8:u01:NaOH, +7:u04:2.6, +15:u08:Nano-silver, +7:u12:2.6, +7:u23:2.6, +8:u00:NaOH, +7:u03:2.6, +7:u07:2.7, +12:u08:Mushroom, +7:u11:2.6, +7:u02:2.6, +7:u06:2.7, +15:u07:Nano-silver, +7:u10:2.6, +7:u14:2.7, +9:uI2:..[]., +7:u01:2.6, +7:u05:2.7, +15:u06:Nano-silver, +12:u07:Mushroom, +16:u08:supernatant), +7:u13:2.7, +15:u14:nano-silver, +9:uI1:..[]., +7:u00:2.6, +7:u04:2.7, +15:u05:Nano-silver, +12:u06:Mushroom, +7:u12:2.7, +15:u13:nano-silver, +7:u23:2.7, +9:uI0:..[]., +12:uI2:--.()()., +7:u03:2.7, +15:u04:Nano-silver, +12:u05:Mushroom, +16:u07:supernatant), +7:u11:2.7, +15:u12:nano-silver, +12:uI1:--.()()., +7:u02:2.7, +15:u03:Nano-silver, +12:u04:Mushroom, +16:u06:supernatant), +7:u10:2.7, +15:u11:nano-silver, +16:u14:supernatant), +8:u23:Mush, +12:uI0:--.()()., +7:u01:2.7, +15:u02:Nano-silver, +12:u03:Mushroom, +16:u05:supernatant), +11:u08:pellet,, +15:u10:nano-silver, +16:u13:supernatant), +9:uI2:)-()., +7:u00:2.7, +15:u01:Nano-silver, +12:u02:Mushroom, +16:u04:supernatant), +10:u08:twice,, +18:u08:centrifugation, +16:u12:supernatant), +9:uI1:)-()., +15:u00:Nano-silver, +12:u01:Mushroom, +16:u03:supernatant), +11:u07:pellet,, +18:u07:centrifugation, +16:u11:supernatant), +9:uI0:)-()., +12:u00:Mushroom, +16:u02:supernatant), +11:u06:pellet,, +10:u07:twice,, +18:u06:centrifugation, +16:u10:supernatant), +11:u14:pellet,, +16:u01:supernatant), +11:u05:pellet,, +10:u06:twice,, +10:u08:ΔA310, +18:u05:centrifugation, +11:u13:pellet,, +10:u14:twice,, +16:u00:supernatant), +11:u04:pellet,, +10:u05:twice,, +18:u04:centrifugation, +12:u08:nm∕min, +11:u12:pellet,, +10:u13:twice,, +7:u22:pel, +8:u23:pell, +11:u03:pellet,, +10:u04:twice,, +10:u07:ΔA310, +18:u03:centrifugation, +12:u07:nm∕min, +6:u08:mg, +11:u11:pellet,, +10:u12:twice,, +11:u02:pellet,, +10:u03:twice,, +10:u06:ΔA310, +18:u02:centrifugation, +12:u06:nm∕min, +6:u07:mg, +11:u10:pellet,, +10:u11:twice,, +10:u14:δa310, +11:u01:pellet,, +10:u02:twice,, +10:u05:ΔA310, +10:u08:1.9945, +18:u01:centrifugation, +12:u05:nm∕min, +6:u06:mg, +10:u10:twice,, +10:u13:δa310, +9:uI2:()-(), +11:u00:pellet,, +10:u01:twice,, +10:u04:ΔA310, +18:u00:centrifugation, +12:u04:nm∕min, +6:u05:mg, +10:u12:δa310, +7:u21:ΔA, +8:u22:ΔA3, +9:u23:ΔA31, +9:uI1:()-(), +10:u00:twice,, +10:u03:ΔA310, +10:u07:1.9945, +12:u03:nm∕min, +6:u04:mg, +10:u11:δa310, +9:uI0:()-(), +10:u02:ΔA310, +10:u06:1.9945, +12:u02:nm∕min, +6:u03:mg, +10:u10:δa310, +10:u14:1.9945, +10:u01:ΔA310, +10:u05:1.9945, +12:u01:nm∕min, +6:u02:mg, +10:u13:1.9945, +10:u00:ΔA310, +10:u04:1.9945, +12:u00:nm∕min, +6:u01:mg, +10:u12:1.9945, +10:u03:1.9945, +6:u00:mg, +10:u11:1.9945, +10:u02:1.9945, +10:u10:1.9945, +10:u01:1.9945, +9:u08:2.8.1, +20:u08:Characterization, +10:u00:1.9945, +20:u07:Characterization, +14:u08:UV-Visible, +9:u07:2.8.1, +15:u08:immobilized, +20:u06:Characterization, +14:u07:UV-Visible, +17:u08:bio-reduction, +9:u06:2.8.1, +20:u05:Characterization, +14:u06:UV-Visible, +17:u07:bio-reduction, +10:u08:AgNPs', +9:u14:2.8.1, +9:u05:2.8.1, +15:u07:immobilized, +20:u04:Characterization, +14:u05:UV-Visible, +17:u06:bio-reduction, +10:u07:AgNPs', +21:u08:spectrophotometer, +9:u13:2.8.1, +10:uI2:..-(/), +9:u04:2.8.1, +15:u06:immobilized, +20:u03:Characterization, +14:u04:UV-Visible, +17:u05:bio-reduction, +10:u06:AgNPs', +21:u07:spectrophotometer, +8:u08:℃., +9:u12:2.8.1, +15:u14:immobilized, +8:u23:2.8., +10:uI1:..-(/), +8:uI2:-'.-, +9:u03:2.8.1, +15:u05:immobilized, +20:u02:Characterization, +14:u03:UV-Visible, +17:u04:bio-reduction, +10:u05:AgNPs', +21:u06:spectrophotometer, +8:u07:℃., +9:u11:2.8.1, +15:u13:immobilized, +14:u14:uv-visible, +10:uI0:..-(/), +8:uI1:-'.-, +9:u02:2.8.1, +15:u04:immobilized, +9:u08:2.8.2, +20:u01:Characterization, +14:u02:UV-Visible, +17:u03:bio-reduction, +10:u04:AgNPs', +21:u05:spectrophotometer, +8:u06:℃., +9:u10:2.8.1, +15:u12:immobilized, +14:u13:uv-visible, +8:uI0:-'.-, +9:uI2:-(,),, +9:u01:2.8.1, +15:u03:immobilized, +20:u00:Characterization, +14:u01:UV-Visible, +17:u02:bio-reduction, +10:u03:AgNPs', +21:u04:spectrophotometer, +8:u05:℃., +15:u11:immobilized, +14:u12:uv-visible, +6:u21:UV, +7:u22:UV-, +8:u23:UV-V, +9:uI1:-(,),, +9:u00:2.8.1, +15:u02:immobilized, +9:u07:2.8.2, +14:u00:UV-Visible, +17:u01:bio-reduction, +10:u02:AgNPs', +21:u03:spectrophotometer, +8:u04:℃., +15:u10:immobilized, +14:u11:uv-visible, +9:uI0:-(,),, +15:u01:immobilized, +9:u06:2.8.2, +17:u00:bio-reduction, +10:u01:AgNPs', +21:u02:spectrophotometer, +8:u03:℃., +14:u10:uv-visible, +9:u14:2.8.2, +9:uI2:',[]., +15:u00:immobilized, +9:u05:2.8.2, +12:u08:biogenic, +10:u00:AgNPs', +21:u01:spectrophotometer, +8:u02:℃., +9:u13:2.8.2, +9:uI1:',[]., +9:u04:2.8.2, +21:u00:spectrophotometer, +8:u01:℃., +9:u12:2.8.2, +9:uI0:',[]., +9:u03:2.8.2, +12:u07:biogenic, +12:u08:400-4000, +8:u00:℃., +18:u08:(Spectrum-100,, +9:u11:2.8.2, +9:u02:2.8.2, +12:u06:biogenic, +9:u08:2.8.3, +18:u07:(Spectrum-100,, +6:u08:cm, +9:u10:2.8.2, +12:u14:biogenic, +9:u01:2.8.2, +12:u05:biogenic, +12:u07:400-4000, +18:u06:(Spectrum-100,, +6:u07:cm, +9:u08:X-Ray, +12:u13:biogenic, +21:u14:spectrophotometer, +9:u00:2.8.2, +12:u04:biogenic, +12:u06:400-4000, +9:u07:2.8.3, +18:u05:(Spectrum-100,, +6:u06:cm, +9:u07:X-Ray, +12:u12:biogenic, +21:u13:spectrophotometer, +12:u14:400-4000, +8:u23:biog, +13:uI2:(-,-,.,)., +12:u03:biogenic, +12:u05:400-4000, +9:u06:2.8.3, +18:u04:(Spectrum-100,, +6:u05:cm, +9:u06:X-Ray, +12:u11:biogenic, +21:u12:spectrophotometer, +12:u13:400-4000, +9:u14:2.8.3, +13:uI1:(-,-,.,)., +9:uI2:--[]., +12:u02:biogenic, +12:u04:400-4000, +9:u05:2.8.3, +18:u03:(Spectrum-100,, +6:u04:cm, +9:u05:X-Ray, +10:u08:(LCWU), +12:u10:biogenic, +21:u11:spectrophotometer, +12:u12:400-4000, +9:u13:2.8.3, +8:u23:400-, +13:uI0:(-,-,.,)., +9:uI1:--[]., +9:uI2:..-(), +12:u01:biogenic, +12:u03:400-4000, +9:u04:2.8.3, +9:u08:2.8.4, +18:u02:(Spectrum-100,, +6:u03:cm, +9:u04:X-Ray, +10:u07:(LCWU), +21:u10:spectrophotometer, +12:u11:400-4000, +9:u12:2.8.3, +9:uI0:--[]., +9:uI1:..-(), +12:u00:biogenic, +12:u02:400-4000, +9:u03:2.8.3, +18:u01:(Spectrum-100,, +6:u02:cm, +9:u03:X-Ray, +10:u06:(LCWU), +17:u08:Metallurgical, +12:u10:400-4000, +9:u11:2.8.3, +9:uI0:..-(), +8:uI2:-.-,, +12:u01:400-4000, +9:u02:2.8.3, +9:u07:2.8.4, +18:u00:(Spectrum-100,, +6:u01:cm, +9:u02:X-Ray, +10:u05:(LCWU), +17:u07:Metallurgical, +9:u10:2.8.3, +8:uI1:-.-,, +11:uI2:().(,)-, +12:u00:400-4000, +9:u01:2.8.3, +9:u06:2.8.4, +6:u00:cm, +9:u01:X-Ray, +10:u04:(LCWU), +17:u06:Metallurgical, +9:u14:2.8.4, +8:uI0:-.-,, +11:uI1:().(,)-, +9:u00:2.8.3, +9:u05:2.8.4, +17:u08:metallurgical, +9:u00:X-Ray, +10:u03:(LCWU), +17:u05:Metallurgical, +9:u13:2.8.4, +13:u14:aga-agnps, +11:uI0:().(,)-, +9:u04:2.8.4, +9:u08:2.8.5, +10:u02:(LCWU), +17:u04:Metallurgical, +9:u12:2.8.4, +13:u13:aga-agnps, +10:uI2:-(,,,), +9:u03:2.8.4, +17:u07:metallurgical, +10:u01:(LCWU), +17:u03:Metallurgical, +8:u08:Zeta, +9:u11:2.8.4, +13:u12:aga-agnps, +7:u22:AgA, +8:u23:AgA-, +10:uI1:-(,,,), +10:uI2:(),,.-, +9:u02:2.8.4, +17:u06:metallurgical, +9:u07:2.8.5, +10:u00:(LCWU), +17:u02:Metallurgical, +8:u07:Zeta, +12:u08:powdered, +9:u10:2.8.4, +13:u11:aga-agnps, +17:u14:metallurgical, +10:uI0:-(,,,), +10:uI1:(),,.-, +9:u01:2.8.4, +17:u05:metallurgical, +9:u06:2.8.5, +17:u01:Metallurgical, +8:u06:Zeta, +12:u07:powdered, +14:u08:Management, +13:u10:aga-agnps, +17:u13:metallurgical, +9:u14:2.8.5, +10:uI0:(),,.-, +9:u00:2.8.4, +17:u04:metallurgical, +9:u05:2.8.5, +8:u08:zeta, +17:u00:Metallurgical, +8:u05:Zeta, +12:u06:powdered, +14:u07:Management, +9:u08:sizer, +17:u12:metallurgical, +9:u13:2.8.5, +17:u03:metallurgical, +9:u04:2.8.5, +8:u08:kcps, +8:u04:Zeta, +12:u05:powdered, +14:u06:Management, +9:u07:sizer, +14:u08:potential., +17:u11:metallurgical, +9:u12:2.8.5, +17:u02:metallurgical, +9:u03:2.8.5, +8:u07:zeta, +9:u08:2.8.6, +8:u03:Zeta, +12:u04:powdered, +14:u05:Management, +9:u06:sizer, +14:u07:potential., +17:u10:metallurgical, +9:u11:2.8.5, +8:u14:zeta, +17:u01:metallurgical, +9:u02:2.8.5, +8:u06:zeta, +8:u07:kcps, +8:u02:Zeta, +12:u03:powdered, +14:u04:Management, +9:u05:sizer, +14:u06:potential., +12:u08:Scanning, +9:u10:2.8.5, +8:u13:zeta, +12:uI2:(,..).-', +17:u00:metallurgical, +9:u01:2.8.5, +8:u05:zeta, +8:u06:kcps, +9:u07:2.8.6, +8:u01:Zeta, +12:u02:powdered, +14:u03:Management, +9:u04:sizer, +14:u05:potential., +12:u07:Scanning, +15:u08:dimensions,, +8:u12:zeta, +8:u14:kcps, +7:u22:Zet, +8:u23:Zeta, +12:uI1:(,..).-', +9:u00:2.8.5, +8:u04:zeta, +8:u05:kcps, +9:u06:2.8.6, +8:u00:Zeta, +12:u01:powdered, +14:u02:Management, +9:u03:sizer, +14:u04:potential., +12:u06:Scanning, +15:u07:dimensions,, +8:u11:zeta, +8:u13:kcps, +9:u14:2.8.6, +7:u22:zet, +8:u23:zeta, +12:uI0:(,..).-', +8:u03:zeta, +8:u04:kcps, +9:u05:2.8.6, +12:u00:powdered, +14:u01:Management, +9:u02:sizer, +14:u03:potential., +12:u05:Scanning, +15:u06:dimensions,, +8:u10:zeta, +8:u12:kcps, +9:u13:2.8.6, +7:u22:kcp, +8:u23:kcps, +8:u02:zeta, +8:u03:kcps, +9:u04:2.8.6, +14:u00:Management, +9:u01:sizer, +14:u02:potential., +12:u04:Scanning, +15:u05:dimensions,, +8:u11:kcps, +9:u12:2.8.6, +8:u01:zeta, +8:u02:kcps, +9:u03:2.8.6, +9:u00:sizer, +14:u01:potential., +12:u03:Scanning, +15:u04:dimensions,, +8:u10:kcps, +9:u11:2.8.6, +8:uI2:.-'-, +8:u00:zeta, +8:u01:kcps, +9:u02:2.8.6, +14:u00:potential., +12:u02:Scanning, +15:u03:dimensions,, +9:u10:2.8.6, +8:uI1:.-'-, +11:uI2:.(,)[]., +8:u00:kcps, +9:u01:2.8.6, +12:u01:Scanning, +15:u02:dimensions,, +8:uI0:.-'-, +11:uI1:.(,)[]., +9:u00:2.8.6, +12:u00:Scanning, +15:u01:dimensions,, +11:uI0:.(,)[]., +15:u00:dimensions,, +10:u08:(U/mg), +10:u07:(U/mg), +13:u08:phosphate, +10:u06:(U/mg), +10:u08:buffer, +10:u14:(u/mg), +9:uI2:[.].., +10:u05:(U/mg), +13:u07:phosphate, +8:u08:12.4, +10:u07:buffer, +10:u13:(u/mg), +9:uI1:[.].., +12:uI2:(/),,,.., +10:u04:(U/mg), +13:u06:phosphate, +10:u06:buffer, +8:u08:U/mg, +10:u12:(u/mg), +13:u14:phosphate, +7:u22:(U/, +8:u23:(U/m, +9:uI0:[.].., +12:uI1:(/),,,.., +10:u03:(U/mg), +13:u05:phosphate, +8:u07:12.4, +8:u08:55.7, +10:u05:buffer, +8:u07:U/mg, +10:u11:(u/mg), +13:u13:phosphate, +12:uI0:(/),,,.., +10:uI2:.[.].,, +10:u02:(U/mg), +13:u04:phosphate, +8:u06:12.4, +8:u08:33.5, +10:u04:buffer, +8:u06:U/mg, +10:u10:(u/mg), +13:u12:phosphate, +8:u14:12.4, +8:u23:phos, +10:uI1:.[.].,, +10:u01:(U/mg), +13:u03:phosphate, +8:u05:12.4, +8:u07:55.7, +10:u03:buffer, +8:u05:U/mg, +13:u11:phosphate, +8:u13:12.4, +10:uI0:.[.].,, +10:u00:(U/mg), +13:u02:phosphate, +8:u04:12.4, +8:u06:55.7, +8:u07:33.5, +10:u02:buffer, +8:u04:U/mg, +13:u10:phosphate, +8:u12:12.4, +8:u14:55.7, +8:uI2:../., +13:u01:phosphate, +8:u03:12.4, +8:u05:55.7, +8:u06:33.5, +10:u01:buffer, +8:u03:U/mg, +8:u11:12.4, +8:u13:55.7, +8:u14:33.5, +8:uI1:../., +9:uI2:./.,., +13:u00:phosphate, +8:u02:12.4, +8:u04:55.7, +8:u05:33.5, +10:u00:buffer, +8:u02:U/mg, +8:u10:12.4, +8:u12:55.7, +8:u13:33.5, +8:u23:55.7, +8:uI0:../., +9:uI1:./.,., +13:uI2:./,.,[.]., +8:u01:12.4, +8:u03:55.7, +8:u04:33.5, +8:u01:U/mg, +8:u11:55.7, +8:u12:33.5, +8:u23:33.5, +9:uI0:./.,., +13:uI1:./,.,[.]., +10:uI2:[].[],, +8:u00:12.4, +8:u02:55.7, +8:u03:33.5, +8:u00:U/mg, +8:u10:55.7, +8:u11:33.5, +13:uI0:./,.,[.]., +10:uI1:[].[],, +8:u01:55.7, +8:u02:33.5, +8:u10:33.5, +10:uI0:[].[],, +8:u00:55.7, +8:u01:33.5, +15:u08:wavelengths, +9:uI2:-(/)-, +8:u00:33.5, +15:u07:wavelengths, +8:u08:2.5%, +9:uI1:-(/)-, +12:uI2:.,.(/)-., +12:u08:biomass., +15:u06:wavelengths, +8:u07:2.5%, +9:uI0:-(/)-, +12:uI1:.,.(/)-., +15:u05:wavelengths, +8:u06:2.5%, +12:uI0:.,.(/)-., +8:uI2:.(/), +12:u07:biomass., +15:u04:wavelengths, +8:u05:2.5%, +8:uI1:.(/), +13:uI2:.(/).(.)., +12:u06:biomass., +9:u08:[36],, +15:u03:wavelengths, +8:u04:2.5%, +12:u14:biomass., +8:uI0:.(/), +13:uI1:.(/).(.)., +17:uI2:.(.,/).(.)..-, +12:u05:biomass., +15:u02:wavelengths, +8:u03:2.5%, +12:u13:biomass., +13:uI0:.(/).(.)., +17:uI1:.(.,/).(.)..-, +12:u04:biomass., +9:u07:[36],, +15:u01:wavelengths, +8:u02:2.5%, +12:u12:biomass., +17:uI0:.(.,/).(.)..-, +8:uI2:.,/., +12:u03:biomass., +9:u06:[36],, +15:u00:wavelengths, +8:u01:2.5%, +12:u11:biomass., +9:u14:[36],, +8:uI1:.,/., +12:u02:biomass., +9:u05:[36],, +8:u00:2.5%, +12:u10:biomass., +9:u13:[36],, +8:uI0:.,/., +15:uI2:[],.(-).[],, +12:u01:biomass., +9:u04:[36],, +9:u12:[36],, +15:uI1:[],.(-).[],, +12:u00:biomass., +9:u03:[36],, +9:u11:[36],, +15:uI0:[],.(-).[],, +9:u02:[36],, +9:u10:[36],, +9:u01:[36],, +9:u00:[36],, +9:u08:3.1.3, +9:u07:3.1.3, +9:u06:3.1.3, +13:u08:arvensis., +9:u14:3.1.3, +9:u05:3.1.3, +13:u07:arvensis., +7:u08:260, +9:u13:3.1.3, +9:u04:3.1.3, +13:u06:arvensis., +7:u07:260, +9:u12:3.1.3, +9:u03:3.1.3, +13:u05:arvensis., +7:u06:260, +9:u11:3.1.3, +12:uI2:../..(.), +9:u02:3.1.3, +13:u04:arvensis., +7:u05:260, +18:u08:peptone-saline, +9:u10:3.1.3, +12:uI1:../..(.), +11:uI2:.-.(.)., +9:u01:3.1.3, +8:u08:[8],, +13:u03:arvensis., +7:u04:260, +18:u07:peptone-saline, +14:u08:contradict, +12:uI0:../..(.), +11:uI1:.-.(.)., +12:uI2:-.-[.].,, +9:u00:3.1.3, +9:u08:3.1.4, +13:u02:arvensis., +7:u03:260, +18:u06:peptone-saline, +14:u07:contradict, +11:uI0:.-.(.)., +12:uI1:-.-[.].,, +8:u07:[8],, +10:u08:UV-Vis, +13:u01:arvensis., +7:u02:260, +18:u05:peptone-saline, +14:u06:contradict, +12:uI0:-.-[.].,, +8:uI2:,-.., +8:u06:[8],, +9:u07:3.1.4, +13:u00:arvensis., +7:u01:260, +18:u04:peptone-saline, +14:u05:contradict, +8:u14:[8],, +8:uI1:,-.., +8:u05:[8],, +9:u06:3.1.4, +10:u07:UV-Vis, +7:u00:260, +18:u03:peptone-saline, +14:u04:contradict, +8:u13:[8],, +9:u14:3.1.4, +8:uI0:,-.., +8:u04:[8],, +9:u05:3.1.4, +10:u06:UV-Vis, +18:u02:peptone-saline, +14:u03:contradict, +8:u12:[8],, +9:u13:3.1.4, +10:u14:uv-vis, +8:u23:[8],, +8:u03:[8],, +9:u04:3.1.4, +10:u05:UV-Vis, +11:u08:Enzymes, +18:u01:peptone-saline, +14:u02:contradict, +10:u08:(a.u)., +8:u11:[8],, +9:u12:3.1.4, +10:u13:uv-vis, +8:u02:[8],, +9:u03:3.1.4, +10:u04:UV-Vis, +18:u00:peptone-saline, +14:u01:contradict, +10:u07:(a.u)., +8:u10:[8],, +9:u11:3.1.4, +10:u12:uv-vis, +13:uI2:.(/).[.]., +8:u01:[8],, +9:u02:3.1.4, +10:u03:UV-Vis, +11:u07:Enzymes, +14:u00:contradict, +10:u06:(a.u)., +9:u10:3.1.4, +10:u11:uv-vis, +13:uI1:.(/).[.]., +11:uI2:-..(.)., +8:u00:[8],, +9:u01:3.1.4, +10:u02:UV-Vis, +11:u06:Enzymes, +10:u05:(a.u)., +10:u10:uv-vis, +11:u14:enzymes, +13:uI0:.(/).[.]., +11:uI1:-..(.)., +12:uI2:.(.)..-., +9:u00:3.1.4, +10:u01:UV-Vis, +11:u05:Enzymes, +10:u04:(a.u)., +11:u13:enzymes, +11:uI0:-..(.)., +12:uI1:.(.)..-., +10:u00:UV-Vis, +11:u04:Enzymes, +10:u03:(a.u)., +11:u12:enzymes, +12:uI0:.(.)..-., +11:u03:Enzymes, +10:u02:(a.u)., +11:u11:enzymes, +11:u02:Enzymes, +10:u01:(a.u)., +11:u10:enzymes, +11:u01:Enzymes, +10:u00:(a.u)., +11:u00:Enzymes, +8:u08:(TH), +8:u07:(TH), +8:u06:(TH), +15:u14:hydroxylase, +8:u05:(TH), +15:u13:hydroxylase, +8:u04:(TH), +15:u12:hydroxylase, +8:u03:(TH), +15:u11:hydroxylase, +8:u02:(TH), +15:u10:hydroxylase, +8:u01:(TH), +8:u00:(TH), +19:u08:polysaccharides, +19:u07:polysaccharides, +19:u06:polysaccharides, +10:uI2:[]..[], +19:u05:polysaccharides, +10:uI1:[]..[], +19:u04:polysaccharides, +10:uI0:[]..[], +19:u03:polysaccharides, +11:u08:orbital, +19:u02:polysaccharides, +11:u07:orbital, +19:u01:polysaccharides, +11:u06:orbital, +9:uI2:.--.., +19:u00:polysaccharides, +11:u05:orbital, +9:uI1:.--.., +10:uI2:[].---, +8:u08:AgNO, +11:u04:orbital, +9:uI0:.--.., +10:uI1:[].---, +11:u03:orbital, +10:uI0:[].---, +8:u07:AgNO, +11:u02:orbital, +11:uI2:[.].-.., +8:u06:AgNO, +11:u01:orbital, +8:u14:agno, +11:uI1:[.].-.., +8:u05:AgNO, +13:u08:grafted)., +11:u00:orbital, +8:u13:agno, +11:uI0:[.].-.., +8:u04:AgNO, +8:u12:agno, +8:u23:AgNO, +10:uI2:[].--., +8:u03:AgNO, +13:u07:grafted)., +8:u11:agno, +10:uI1:[].--., +9:uI2:[]-.., +8:u02:AgNO, +13:u06:grafted)., +16:u08:temperatures, +8:u10:agno, +13:u14:grafted)., +10:uI0:[].--., +9:uI1:[]-.., +10:uI2:[]--(-, +8:u01:AgNO, +13:u05:grafted)., +8:u08:lase, +16:u07:temperatures, +13:u13:grafted)., +9:uI0:[]-.., +10:uI1:[]--(-, +11:uI2:).[],.., +8:u00:AgNO, +13:u04:grafted)., +16:u06:temperatures, +13:u12:grafted)., +10:uI0:[]--(-, +11:uI1:).[],.., +13:u03:grafted)., +8:u07:lase, +14:u08:Absorption, +16:u05:temperatures, +13:u11:grafted)., +11:uI0:).[],.., +13:u02:grafted)., +8:u06:lase, +16:u04:temperatures, +11:u08:Spectra, +13:u10:grafted)., +8:u14:lase, +13:u01:grafted)., +8:u05:lase, +14:u07:Absorption, +16:u03:temperatures, +11:u07:Spectra, +8:u13:lase, +13:u00:grafted)., +8:u04:lase, +14:u06:Absorption, +16:u02:temperatures, +11:u06:Spectra, +8:u12:lase, +14:u14:absorption, +8:u03:lase, +14:u05:Absorption, +16:u01:temperatures, +11:u05:Spectra, +8:u11:lase, +14:u13:absorption, +8:u02:lase, +14:u04:Absorption, +16:u00:temperatures, +11:u04:Spectra, +8:u10:lase, +14:u12:absorption, +8:u23:Abso, +8:u01:lase, +14:u03:Absorption, +11:u03:Spectra, +14:u11:absorption, +8:u00:lase, +14:u02:Absorption, +11:u02:Spectra, +14:u10:absorption, +14:u01:Absorption, +11:u01:Spectra, +14:u00:Absorption, +11:u00:Spectra, +8:u08:FTIR, +8:u07:FTIR, +9:u08:[45]., +8:u06:FTIR, +14:u08:612.94459,, +7:uI2:'-., +8:u05:FTIR, +14:u07:612.94459,, +7:uI1:'-., +9:u07:[45]., +8:u04:FTIR, +14:u06:612.94459,, +7:uI0:'-., +8:uI2:-..-, +9:u06:[45]., +8:u03:FTIR, +14:u05:612.94459,, +9:u14:[45]., +8:uI1:-..-, +15:uI2:.,.,../..--, +9:u05:[45]., +8:u02:FTIR, +14:u04:612.94459,, +9:u13:[45]., +8:uI0:-..-, +15:uI1:.,.,../..--, +9:u04:[45]., +15:u08:2980.46036,, +8:u01:FTIR, +14:u03:612.94459,, +9:u12:[45]., +15:uI0:.,.,../..--, +12:uI2:[].,.-.,, +9:u03:[45]., +8:u00:FTIR, +14:u02:612.94459,, +9:u11:[45]., +12:uI1:[].,.-.,, +9:u02:[45]., +15:u07:2980.46036,, +14:u01:612.94459,, +9:u10:[45]., +12:uI0:[].,.-.,, +11:uI2:[]..---, +9:u01:[45]., +15:u06:2980.46036,, +14:u00:612.94459,, +15:u14:2980.46036,, +11:uI1:[]..---, +13:uI2:..,.,.,.,, +9:u00:[45]., +15:u05:2980.46036,, +9:u08:[48]., +15:u13:2980.46036,, +11:uI0:[]..---, +13:uI1:..,.,.,.,, +18:uI2:.,./-..'---[]., +15:u04:2980.46036,, +9:u08:3.2.3, +9:u07:[48]., +15:u12:2980.46036,, +7:u22:298, +8:u23:2980, +13:uI0:..,.,.,.,, +18:uI1:.,./-..'---[]., +17:uI2:./--()..,../-, +15:u03:2980.46036,, +9:u06:[48]., +15:u11:2980.46036,, +18:uI0:.,./-..'---[]., +17:uI1:./--()..,../-, +11:uI2:---,,-,, +15:u02:2980.46036,, +9:u07:3.2.3, +9:u05:[48]., +17:u08:nanoparticles, +15:u10:2980.46036,, +17:uI0:./--()..,../-, +11:uI1:---,,-,, +14:uI2:[].,./,'.-, +15:u01:2980.46036,, +9:u06:3.2.3, +9:u04:[48]., +17:u07:nanoparticles, +9:u14:3.2.3, +11:uI0:---,,-,, +14:uI1:[].,./,'.-, +9:uI2:,,[]., +15:u00:2980.46036,, +9:u05:3.2.3, +9:u03:[48]., +17:u06:nanoparticles, +14:u08:AgA-AgNPs., +9:u13:3.2.3, +10:u14:silver, +14:uI0:[].,./,'.-, +9:uI1:,,[]., +9:u04:3.2.3, +9:u08:[20]., +9:u02:[48]., +17:u05:nanoparticles, +14:u07:AgA-AgNPs., +9:u12:3.2.3, +10:u13:silver, +9:uI0:,,[]., +9:u03:3.2.3, +9:u01:[48]., +17:u04:nanoparticles, +14:u06:AgA-AgNPs., +9:u11:3.2.3, +10:u12:silver, +8:u23:Silv, +9:u02:3.2.3, +9:u07:[20]., +14:u08:confirming, +9:u00:[48]., +17:u03:nanoparticles, +14:u05:AgA-AgNPs., +9:u10:3.2.3, +10:u11:silver, +9:u01:3.2.3, +9:u06:[20]., +17:u02:nanoparticles, +14:u04:AgA-AgNPs., +10:u10:silver, +9:u14:[20]., +9:u00:3.2.3, +9:u05:[20]., +14:u07:confirming, +10:u08:Ledeti, +17:u01:nanoparticles, +14:u03:AgA-AgNPs., +9:u13:[20]., +17:u14:nanoparticles, +11:uI2:[].'.--, +9:u04:[20]., +14:u06:confirming, +17:u00:nanoparticles, +14:u02:AgA-AgNPs., +9:u12:[20]., +17:u13:nanoparticles, +11:uI1:[].'.--, +21:uI2:.,.,..(),(),()(),, +9:u03:[20]., +14:u05:confirming, +10:u07:Ledeti, +10:u08:silver, +14:u01:AgA-AgNPs., +10:u08:(111),, +9:u11:[20]., +17:u12:nanoparticles, +11:uI0:[].'.--, +21:uI1:.,.,..(),(),()(),, +9:u02:[20]., +14:u04:confirming, +10:u06:Ledeti, +10:u08:angles, +14:u00:AgA-AgNPs., +10:u07:(111),, +18:u08:nanoparticles., +9:u10:[20]., +17:u11:nanoparticles, +10:u14:ledeti, +21:uI0:.,.,..(),(),()(),, +9:u01:[20]., +14:u03:confirming, +10:u05:Ledeti, +10:u07:silver, +10:u06:(111),, +18:u07:nanoparticles., +17:u10:nanoparticles, +10:u13:ledeti, +9:u00:[20]., +14:u02:confirming, +10:u04:Ledeti, +10:u06:silver, +10:u07:angles, +10:u05:(111),, +18:u06:nanoparticles., +10:u12:ledeti, +7:u22:Led, +8:u23:Lede, +16:uI2:(),()(),.[],, +14:u01:confirming, +10:u03:Ledeti, +10:u05:silver, +10:u06:angles, +9:u08:3.2.4, +10:u04:(111),, +18:u05:nanoparticles., +9:u08:(311), +10:u11:ledeti, +10:u14:angles, +16:uI1:(),()(),.[],, +14:u00:confirming, +10:u02:Ledeti, +10:u04:silver, +10:u05:angles, +10:u03:(111),, +18:u04:nanoparticles., +9:u07:(311), +10:u10:ledeti, +10:u13:angles, +8:u23:silv, +16:uI0:(),()(),.[],, +19:uI2:(),(),(),().[],, +10:u01:Ledeti, +10:u03:silver, +10:u04:angles, +9:u07:3.2.4, +10:u02:(111),, +18:u03:nanoparticles., +9:u06:(311), +13:u08:undergone, +10:u12:angles, +19:uI1:(),(),(),().[],, +13:uI2:.(),(),(), +10:u00:Ledeti, +10:u02:silver, +10:u03:angles, +9:u06:3.2.4, +10:u01:(111),, +18:u02:nanoparticles., +9:u05:(311), +13:u07:undergone, +10:u11:angles, +9:u14:3.2.4, +19:uI0:(),(),(),().[],, +13:uI1:.(),(),(), +10:u01:silver, +10:u02:angles, +9:u05:3.2.4, +10:u00:(111),, +18:u01:nanoparticles., +9:u04:(311), +13:u06:undergone, +10:u10:angles, +9:u13:3.2.4, +13:uI0:.(),(),(), +10:u00:silver, +10:u01:angles, +9:u04:3.2.4, +18:u00:nanoparticles., +9:u03:(311), +13:u05:undergone, +9:u12:3.2.4, +9:u14:power, +10:u00:angles, +9:u03:3.2.4, +9:u02:(311), +13:u04:undergone, +9:u11:3.2.4, +9:u13:power, +9:u02:3.2.4, +9:u01:(311), +13:u03:undergone, +9:u10:3.2.4, +9:u12:power, +7:u22:pow, +8:u23:powe, +9:u01:3.2.4, +14:u08:Wavelength, +9:u00:(311), +13:u02:undergone, +9:u11:power, +9:u00:3.2.4, +8:u08:Bond, +13:u01:undergone, +7:u08:(cm, +9:u10:power, +14:u07:Wavelength, +13:u00:undergone, +7:u07:(cm, +14:u06:Wavelength, +8:u07:Bond, +7:u06:(cm, +14:u14:wavelength, +14:u05:Wavelength, +8:u06:Bond, +10:u08:592.12, +7:u05:(cm, +14:u13:wavelength, +14:u04:Wavelength, +8:u05:Bond, +11:u08:C-C-C-N, +7:u04:(cm, +14:u12:wavelength, +7:u22:Wav, +8:u23:Wave, +14:u03:Wavelength, +8:u04:Bond, +10:u07:592.12, +12:u08:Nitrites, +7:u03:(cm, +14:u11:wavelength, +8:u23:Bond, +14:u02:Wavelength, +8:u03:Bond, +10:u06:592.12, +11:u07:C-C-C-N, +11:u08:1064.75, +7:u02:(cm, +14:u10:wavelength, +10:u14:592.12, +14:u01:Wavelength, +8:u02:Bond, +10:u05:592.12, +11:u06:C-C-C-N, +12:u07:Nitrites, +7:u08:C-H, +7:u01:(cm, +10:u13:592.12, +11:u14:c-c-c-n, +14:u00:Wavelength, +8:u01:Bond, +10:u04:592.12, +11:u05:C-C-C-N, +12:u06:Nitrites, +11:u07:1064.75, +13:u08:Cellulose, +7:u00:(cm, +10:u12:592.12, +11:u13:c-c-c-n, +12:u14:nitrites, +7:u22:592, +8:u23:592., +8:u00:Bond, +10:u03:592.12, +11:u04:C-C-C-N, +12:u05:Nitrites, +11:u06:1064.75, +7:u07:C-H, +11:u08:1392.53, +10:u11:592.12, +11:u12:c-c-c-n, +12:u13:nitrites, +11:u14:1064.75, +6:u21:C-, +7:u22:C-C, +8:u23:C-C-, +10:u02:592.12, +11:u03:C-C-C-N, +12:u04:Nitrites, +11:u05:1064.75, +7:u06:C-H, +13:u07:Cellulose, +16:u08:-C-H-Bending, +10:u10:592.12, +11:u11:c-c-c-n, +12:u12:nitrites, +11:u13:1064.75, +7:u14:c-h, +7:u22:Nit, +8:u23:Nitr, +10:u01:592.12, +11:u02:C-C-C-N, +12:u03:Nitrites, +11:u04:1064.75, +7:u05:C-H, +13:u06:Cellulose, +11:u07:1392.53, +15:u08:Polyphenols, +11:u10:c-c-c-n, +12:u11:nitrites, +11:u12:1064.75, +7:u13:c-h, +13:u14:cellulose, +8:u23:1064, +10:u00:592.12, +11:u01:C-C-C-N, +12:u02:Nitrites, +11:u03:1064.75, +7:u04:C-H, +13:u05:Cellulose, +11:u06:1392.53, +16:u07:-C-H-Bending, +11:u08:1635.60, +12:u10:nitrites, +11:u11:1064.75, +7:u12:c-h, +13:u13:cellulose, +11:u14:1392.53, +7:u22:C-H, +7:u23:C-H, +11:u00:C-C-C-N, +12:u01:Nitrites, +11:u02:1064.75, +7:u03:C-H, +13:u04:Cellulose, +11:u05:1392.53, +16:u06:-C-H-Bending, +15:u07:Polyphenols, +12:u08:Carbonyl, +11:u10:1064.75, +7:u11:c-h, +13:u12:cellulose, +11:u13:1392.53, +16:u14:-c-h-bending, +12:u00:Nitrites, +11:u01:1064.75, +7:u02:C-H, +13:u03:Cellulose, +11:u04:1392.53, +16:u05:-C-H-Bending, +15:u06:Polyphenols, +11:u07:1635.60, +9:u08:Amide, +7:u10:c-h, +13:u11:cellulose, +11:u12:1392.53, +16:u13:-c-h-bending, +15:u14:polyphenols, +8:u23:1392, +11:u00:1064.75, +7:u01:C-H, +13:u02:Cellulose, +11:u03:1392.53, +16:u04:-C-H-Bending, +15:u05:Polyphenols, +11:u06:1635.60, +12:u07:Carbonyl, +11:u08:2980.46, +13:u10:cellulose, +11:u11:1392.53, +16:u12:-c-h-bending, +15:u13:polyphenols, +11:u14:1635.60, +6:u21:-C, +7:u22:-C-, +8:u23:-C-H, +7:u00:C-H, +13:u01:Cellulose, +11:u02:1392.53, +16:u03:-C-H-Bending, +15:u04:Polyphenols, +11:u05:1635.60, +12:u06:Carbonyl, +9:u07:Amide, +11:u10:1392.53, +16:u11:-c-h-bending, +15:u12:polyphenols, +11:u13:1635.60, +12:u14:carbonyl, +13:u00:Cellulose, +11:u01:1392.53, +16:u02:-C-H-Bending, +15:u03:Polyphenols, +11:u04:1635.60, +12:u05:Carbonyl, +9:u06:Amide, +11:u07:2980.46, +11:u08:Alkanes, +16:u10:-c-h-bending, +15:u11:polyphenols, +11:u12:1635.60, +12:u13:carbonyl, +9:u14:amide, +8:u23:1635, +11:u00:1392.53, +16:u01:-C-H-Bending, +15:u02:Polyphenols, +11:u03:1635.60, +12:u04:Carbonyl, +9:u05:Amide, +11:u06:2980.46, +11:u08:3345.67, +15:u10:polyphenols, +11:u11:1635.60, +12:u12:carbonyl, +9:u13:amide, +11:u14:2980.46, +8:u23:Carb, +16:u00:-C-H-Bending, +15:u01:Polyphenols, +11:u02:1635.60, +12:u03:Carbonyl, +9:u04:Amide, +11:u05:2980.46, +11:u07:Alkanes, +11:u10:1635.60, +12:u11:carbonyl, +9:u12:amide, +11:u13:2980.46, +8:u23:Amid, +15:u00:Polyphenols, +11:u01:1635.60, +12:u02:Carbonyl, +9:u03:Amide, +11:u04:2980.46, +11:u06:Alkanes, +11:u07:3345.67, +11:u08:Alkenes, +12:u10:carbonyl, +9:u11:amide, +11:u12:2980.46, +11:u00:1635.60, +12:u01:Carbonyl, +9:u02:Amide, +11:u03:2980.46, +11:u05:Alkanes, +11:u06:3345.67, +9:u10:amide, +11:u11:2980.46, +11:u14:3345.67, +12:u00:Carbonyl, +9:u01:Amide, +11:u02:2980.46, +11:u04:Alkanes, +11:u05:3345.67, +11:u07:Alkenes, +10:u08:612.94, +11:u10:2980.46, +11:u13:3345.67, +9:u00:Amide, +11:u01:2980.46, +11:u03:Alkanes, +11:u04:3345.67, +11:u06:Alkenes, +11:u12:3345.67, +11:u14:alkenes, +8:u23:3345, +11:u00:2980.46, +11:u02:Alkanes, +11:u03:3345.67, +11:u05:Alkenes, +10:u07:612.94, +11:u08:bending, +11:u11:3345.67, +11:u13:alkenes, +11:u01:Alkanes, +11:u02:3345.67, +11:u04:Alkenes, +10:u06:612.94, +11:u08:1636.43, +11:u07:bending, +11:u10:3345.67, +11:u12:alkenes, +10:u14:612.94, +8:u23:Alke, +11:u00:Alkanes, +11:u01:3345.67, +11:u03:Alkenes, +10:u05:612.94, +11:u06:bending, +11:u11:alkenes, +10:u13:612.94, +11:u00:3345.67, +11:u02:Alkenes, +10:u04:612.94, +11:u07:1636.43, +11:u05:bending, +11:u10:alkenes, +10:u12:612.94, +7:u22:612, +8:u23:612., +11:u01:Alkenes, +10:u03:612.94, +11:u06:1636.43, +11:u08:2123.79, +11:u04:bending, +10:u11:612.94, +11:u14:1636.43, +11:u00:Alkenes, +10:u02:612.94, +11:u05:1636.43, +9:u08:C≡C, +11:u03:bending, +10:u10:612.94, +11:u13:1636.43, +10:u01:612.94, +11:u04:1636.43, +11:u07:2123.79, +11:u08:Alkynes, +11:u02:bending, +11:u12:1636.43, +8:u23:1636, +10:u00:612.94, +11:u03:1636.43, +11:u06:2123.79, +9:u07:C≡C, +11:u08:3330.56, +11:u01:bending, +11:u11:1636.43, +11:u14:2123.79, +11:u02:1636.43, +11:u05:2123.79, +9:u06:C≡C, +11:u07:Alkynes, +9:u08:H-O-H, +11:u00:bending, +11:u10:1636.43, +11:u13:2123.79, +9:u14:c≡c, +11:u01:1636.43, +11:u04:2123.79, +9:u05:C≡C, +11:u06:Alkynes, +11:u07:3330.56, +11:u12:2123.79, +9:u13:c≡c, +11:u14:alkynes, +7:u22:212, +8:u23:2123, +11:u00:1636.43, +11:u03:2123.79, +9:u04:C≡C, +11:u05:Alkynes, +11:u06:3330.56, +9:u07:H-O-H, +11:u11:2123.79, +9:u12:c≡c, +11:u13:alkynes, +11:u14:3330.56, +8:u21:C≡, +9:u22:C≡C, +9:u23:C≡C, +11:u02:2123.79, +9:u03:C≡C, +11:u04:Alkynes, +11:u05:3330.56, +9:u06:H-O-H, +11:u10:2123.79, +9:u11:c≡c, +11:u12:alkynes, +11:u13:3330.56, +9:u14:h-o-h, +8:u23:Alky, +11:u01:2123.79, +9:u02:C≡C, +11:u03:Alkynes, +11:u04:3330.56, +9:u05:H-O-H, +9:u10:c≡c, +11:u11:alkynes, +11:u12:3330.56, +9:u13:h-o-h, +7:u22:333, +8:u23:3330, +11:u00:2123.79, +9:u01:C≡C, +11:u02:Alkynes, +11:u03:3330.56, +9:u04:H-O-H, +11:u10:alkynes, +11:u11:3330.56, +9:u12:h-o-h, +6:u21:H-, +7:u22:H-O, +8:u23:H-O-, +9:u00:C≡C, +11:u01:Alkynes, +11:u02:3330.56, +9:u03:H-O-H, +11:u10:3330.56, +9:u11:h-o-h, +11:u00:Alkynes, +11:u01:3330.56, +9:u02:H-O-H, +9:u10:h-o-h, +11:u00:3330.56, +9:u01:H-O-H, +9:u00:H-O-H, +17:u08:magnification, +17:u07:magnification, +7:u08:10X, +17:u06:magnification, +9:u08:3.2.5, +7:u07:10X, +11:u08:nature., +10:uI2:..-[]., +17:u05:magnification, +7:u06:10X, +11:u07:nature., +10:uI1:..-[]., +17:u04:magnification, +9:u07:3.2.5, +7:u05:10X, +11:u06:nature., +10:uI0:..-[]., +17:u03:magnification, +9:u06:3.2.5, +7:u04:10X, +11:u05:nature., +13:u08:Zetasizer, +9:u14:3.2.5, +17:u02:magnification, +9:u05:3.2.5, +11:u08:enzyme,, +7:u03:10X, +11:u04:nature., +13:u07:Zetasizer, +9:u13:3.2.5, +17:u01:magnification, +9:u04:3.2.5, +7:u02:10X, +11:u03:nature., +13:u06:Zetasizer, +9:u12:3.2.5, +17:u00:magnification, +9:u03:3.2.5, +11:u07:enzyme,, +7:u01:10X, +11:u02:nature., +13:u05:Zetasizer, +9:u11:3.2.5, +9:u02:3.2.5, +11:u06:enzyme,, +7:u00:10X, +11:u01:nature., +13:u04:Zetasizer, +9:u10:3.2.5, +11:u14:enzyme,, +9:u01:3.2.5, +11:u05:enzyme,, +11:u00:nature., +13:u03:Zetasizer, +11:u13:enzyme,, +9:u00:3.2.5, +11:u04:enzyme,, +13:u02:Zetasizer, +11:u12:enzyme,, +11:u03:enzyme,, +13:u01:Zetasizer, +11:u11:enzyme,, +11:u02:enzyme,, +13:u00:Zetasizer, +11:u10:enzyme,, +11:u01:enzyme,, +11:u00:enzyme,, +10:u08:tivity, +10:u08:0.0213, +13:uI2:-(.)....,, +10:u07:tivity, +10:u07:0.0213, +13:uI1:-(.)....,, +8:uI2:.-.., +10:u06:tivity, +14:u08:Flammulina, +10:u06:0.0213, +10:u14:tivity, +13:uI0:-(.)....,, +8:uI1:.-.., +10:u05:tivity, +10:u05:0.0213, +14:u08:velutipes., +10:u13:tivity, +8:uI0:.-.., +10:u04:tivity, +14:u07:Flammulina, +10:u04:0.0213, +14:u07:velutipes., +10:u12:tivity, +10:u03:tivity, +14:u06:Flammulina, +10:u03:0.0213, +14:u06:velutipes., +10:u11:tivity, +14:u14:flammulina, +10:u02:tivity, +14:u05:Flammulina, +10:u02:0.0213, +14:u05:velutipes., +10:u10:tivity, +14:u13:flammulina, +10:uI2:.-.[]., +10:u01:tivity, +14:u04:Flammulina, +10:u01:0.0213, +14:u04:velutipes., +14:u12:flammulina, +8:u23:Flam, +10:uI1:.-.[]., +10:u00:tivity, +14:u03:Flammulina, +10:u00:0.0213, +14:u03:velutipes., +14:u11:flammulina, +10:uI0:.-.[]., +14:u02:Flammulina, +14:u02:velutipes., +14:u10:flammulina, +8:u14:copy, +14:u01:Flammulina, +14:u01:velutipes., +8:u13:copy, +14:u00:Flammulina, +14:u00:velutipes., +8:u12:copy, +8:u11:copy, +8:u10:copy, +9:u08:(74)., +9:u08:3.2.6, +9:u07:(74)., +13:u14:synthesis, +11:uI2:-..-[]., +9:u06:(74)., +9:u07:3.2.6, +13:u13:synthesis, +9:u14:(74)., +11:uI1:-..-[]., +9:u05:(74)., +9:u06:3.2.6, +13:u12:synthesis, +9:u13:(74)., +9:u14:3.2.6, +11:uI0:-..-[]., +14:uI2:().[](-.)., +9:u04:(74)., +9:u05:3.2.6, +14:u08:AgA-AgNPs,, +13:u11:synthesis, +9:u12:(74)., +9:u13:3.2.6, +7:u22:(74, +8:u23:(74), +14:uI1:().[](-.)., +9:u03:(74)., +9:u04:3.2.6, +14:u07:AgA-AgNPs,, +9:u08:228.8, +13:u10:synthesis, +9:u11:(74)., +9:u12:3.2.6, +14:uI0:().[](-.)., +9:u02:(74)., +9:u03:3.2.6, +14:u06:AgA-AgNPs,, +9:u07:228.8, +9:u10:(74)., +9:u11:3.2.6, +10:uI2:,,...,, +9:u01:(74)., +9:u02:3.2.6, +14:u05:AgA-AgNPs,, +9:u06:228.8, +9:u10:3.2.6, +10:uI1:,,...,, +11:uI2:-,[].-., +9:u00:(74)., +9:u01:3.2.6, +14:u04:AgA-AgNPs,, +9:u05:228.8, +11:u08:avoided, +10:uI0:,,...,, +11:uI1:-,[].-., +9:u00:3.2.6, +14:u03:AgA-AgNPs,, +9:u04:228.8, +11:u07:avoided, +11:uI0:-,[].-., +14:u02:AgA-AgNPs,, +9:u03:228.8, +11:u06:avoided, +8:u08:law., +14:u01:AgA-AgNPs,, +9:u02:228.8, +11:u05:avoided, +14:u00:AgA-AgNPs,, +9:u01:228.8, +11:u04:avoided, +8:u07:law., +9:u00:228.8, +11:u03:avoided, +8:u06:law., +11:u02:avoided, +8:u14:law., +8:u05:law., +9:u08:3.2.7, +11:u01:avoided, +8:u13:law., +10:uI2:.,().., +8:u04:law., +11:u00:avoided, +8:u12:law., +7:u22:law, +8:u23:law., +10:uI1:.,().., +9:uI2:...[], +8:u03:law., +9:u07:3.2.7, +15:u08:reusability, +8:u11:law., +10:uI0:.,().., +9:uI1:...[], +8:u02:law., +9:u06:3.2.7, +15:u07:reusability, +8:u10:law., +9:u14:3.2.7, +9:uI0:...[], +8:u01:law., +9:u05:3.2.7, +15:u06:reusability, +9:u13:3.2.7, +8:u00:law., +9:u04:3.2.7, +15:u05:reusability, +9:u12:3.2.7, +11:uI2:-[.]..., +9:u03:3.2.7, +15:u04:reusability, +9:u11:3.2.7, +11:uI1:-[.]..., +10:uI2:,,,,.-, +9:u02:3.2.7, +15:u03:reusability, +10:u08:cycle., +9:u10:3.2.7, +11:uI0:-[.]..., +10:uI1:,,,,.-, +8:uI2:.../, +9:u01:3.2.7, +15:u02:reusability, +10:u07:cycle., +10:uI0:,,,,.-, +8:uI1:.../, +9:u00:3.2.7, +15:u01:reusability, +10:u06:cycle., +8:uI0:.../, +15:u00:reusability, +10:u05:cycle., +12:uI2:..,../,-, +10:u04:cycle., +12:uI1:..,../,-, +9:uI2:,../., +10:u03:cycle., +12:uI0:..,../,-, +9:uI1:,../., +10:uI2:.,././, +18:u08:immobilization, +10:u02:cycle., +9:uI0:,../., +10:uI1:.,././, +9:u08:3.2.8, +10:u01:cycle., +10:uI0:.,././, +14:uI2:../,././,,, +18:u07:immobilization, +10:u00:cycle., +14:uI1:../,././,,, +18:u06:immobilization, +9:u07:3.2.8, +13:u08:intervals, +18:u14:immobilization, +14:uI0:../,././,,, +18:u05:immobilization, +9:u06:3.2.8, +18:u13:immobilization, +9:u14:3.2.8, +18:u04:immobilization, +9:u05:3.2.8, +13:u07:intervals, +18:u12:immobilization, +9:u13:3.2.8, +18:u03:immobilization, +9:u04:3.2.8, +13:u06:intervals, +18:u11:immobilization, +9:u12:3.2.8, +13:u14:intervals, +18:u02:immobilization, +9:u03:3.2.8, +13:u05:intervals, +10:u08:mg/ml,, +18:u10:immobilization, +9:u11:3.2.8, +13:u13:intervals, +10:uI2:[.]..., +18:u01:immobilization, +9:u02:3.2.8, +13:u04:intervals, +10:u07:mg/ml,, +9:u10:3.2.8, +13:u12:intervals, +10:uI1:[.]..., +15:uI2:,,,,,,.-(/), +18:u00:immobilization, +9:u01:3.2.8, +13:u03:intervals, +10:u06:mg/ml,, +13:u11:intervals, +10:uI0:[.]..., +15:uI1:,,,,,,.-(/), +10:uI2:-.--./, +9:u00:3.2.8, +13:u02:intervals, +10:u05:mg/ml,, +13:u10:intervals, +15:uI0:,,,,,,.-(/), +10:uI1:-.--./, +10:uI2:./,.--, +13:u01:intervals, +10:u04:mg/ml,, +10:uI0:-.--./, +10:uI1:./,.--, +10:uI2:.-././, +13:u00:intervals, +10:u03:mg/ml,, +10:uI0:./,.--, +10:uI1:.-././, +11:uI2:,.--.-., +10:u02:mg/ml,, +10:uI0:.-././, +11:uI1:,.--.-., +10:u01:mg/ml,, +11:uI0:,.--.-., +12:uI2:-././,.,, +10:u00:mg/ml,, +12:uI1:-././,.,, +13:uI2:--././,.-, +12:uI0:-././,.,, +13:uI1:--././,.-, +13:uI0:--././,.-, +15:u08:tyrosinase., +15:u07:tyrosinase., +9:u08:3.2.9, +15:u06:tyrosinase., +15:u14:tyrosinase., +15:u05:tyrosinase., +9:u07:3.2.9, +15:u13:tyrosinase., +13:uI2:.-//[].,-, +15:u04:tyrosinase., +9:u06:3.2.9, +15:u12:tyrosinase., +9:u14:3.2.9, +13:uI1:.-//[].,-, +15:u03:tyrosinase., +9:u05:3.2.9, +7:u08:ml), +15:u11:tyrosinase., +9:u13:3.2.9, +13:uI0:.-//[].,-, +15:u02:tyrosinase., +9:u04:3.2.9, +15:u10:tyrosinase., +9:u12:3.2.9, +15:u01:tyrosinase., +9:u03:3.2.9, +7:u07:ml), +9:u11:3.2.9, +15:u00:tyrosinase., +9:u02:3.2.9, +7:u06:ml), +9:u10:3.2.9, +7:u14:ml), +14:uI2:,,,,,,.-(/, +9:u01:3.2.9, +7:u05:ml), +7:u13:ml), +14:uI1:,,,,,,.-(/, +10:uI2:)-.-./, +9:u00:3.2.9, +7:u04:ml), +7:u12:ml), +7:u22:ml), +7:u23:ml), +14:uI0:,,,,,,.-(/, +10:uI1:)-.-./, +7:u03:ml), +7:u11:ml), +10:uI0:)-.-./, +7:u02:ml), +7:u10:ml), +7:u01:ml), +7:u00:ml), +14:u08:incubation, +11:u08:duction, +14:u07:incubation, +15:u14:reusability, +14:u06:incubation, +15:u13:reusability, +11:u07:duction, +14:u05:incubation, +15:u12:reusability, +11:u06:duction, +14:u04:incubation, +15:u11:reusability, +11:u14:duction, +11:u05:duction, +14:u03:incubation, +15:u10:reusability, +11:u13:duction, +11:u04:duction, +14:u02:incubation, +11:u12:duction, +11:u03:duction, +14:u01:incubation, +11:u11:duction, +11:u02:duction, +14:u00:incubation, +11:u10:duction, +11:u01:duction, +11:u00:duction, +8:u08:min., +8:u07:min., +8:u06:min., +14:u08:L-Tyrosine, +8:u05:min., +14:u07:L-Tyrosine, +8:u04:min., +14:u06:L-Tyrosine, +8:uI2:-./., +8:u03:min., +14:u05:L-Tyrosine, +8:uI1:-./., +12:uI2:-.,--./., +8:u02:min., +14:u04:L-Tyrosine, +10:u08:chiral, +8:uI0:-./., +12:uI1:-.,--./., +12:uI2:--./..--, +8:u01:min., +14:u03:L-Tyrosine, +10:u07:chiral, +12:uI0:-.,--./., +12:uI1:--./..--, +9:uI2:-.-./, +8:u00:min., +14:u02:L-Tyrosine, +10:u06:chiral, +12:uI0:--./..--, +9:uI1:-.-./, +11:uI2:./,.()-, +14:u01:L-Tyrosine, +10:u05:chiral, +9:uI0:-.-./, +11:uI1:./,.()-, +10:uI2:-..[]-, +14:u00:L-Tyrosine, +10:u04:chiral, +11:uI0:./,.()-, +10:uI1:-..[]-, +10:u03:chiral, +10:uI0:-..[]-, +10:u02:chiral, +22:u08:spectrophotometry,, +10:u01:chiral, +10:u00:chiral, +9:u08:FTIR,, +22:u07:spectrophotometry,, +9:u07:FTIR,, +22:u06:spectrophotometry,, +9:u06:FTIR,, +22:u14:spectrophotometry,, +9:uI2:,-'.-, +22:u05:spectrophotometry,, +9:u05:FTIR,, +22:u13:spectrophotometry,, +9:uI1:,-'.-, +9:uI2:,,,-., +22:u04:spectrophotometry,, +9:u04:FTIR,, +22:u12:spectrophotometry,, +9:uI0:,-'.-, +9:uI1:,,,-., +22:u03:spectrophotometry,, +9:u03:FTIR,, +22:u11:spectrophotometry,, +9:uI0:,,,-., +22:u02:spectrophotometry,, +9:u02:FTIR,, +22:u10:spectrophotometry,, +22:u01:spectrophotometry,, +10:u08:Qaiser, +9:u01:FTIR,, +9:uI2:.,--., +22:u00:spectrophotometry,, +9:u00:FTIR,, +9:u08:Farid, +9:uI1:.,--., +10:u07:Qaiser, +7:u08:med, +9:u07:Farid, +9:u08:Shah., +9:uI0:.,--., +10:u06:Qaiser, +9:u06:Farid, +9:u07:Shah., +12:u08:Bourhia., +10:u14:qaiser, +11:uI2:,,,:,,,, +10:u05:Qaiser, +7:u07:med, +9:u05:Farid, +9:u06:Shah., +12:u07:Bourhia., +10:u13:qaiser, +11:uI1:,,,:,,,, +12:uI2:.,,,,:,,, +10:u04:Qaiser, +7:u06:med, +16:u08:Declarations, +9:u04:Farid, +9:u05:Shah., +12:u06:Bourhia., +16:u08:availability, +10:u12:qaiser, +6:u21:Qa, +7:u22:Qai, +8:u23:Qais, +11:uI0:,,,:,,,, +12:uI1:.,,,,:,,, +14:uI2:.,,,:.,,,-, +10:u03:Qaiser, +7:u05:med, +9:u03:Farid, +9:u04:Shah., +12:u05:Bourhia., +16:u07:availability, +10:u11:qaiser, +7:u23:Ali, +12:uI0:.,,,,:,,, +14:uI1:.,,,:.,,,-, +10:u02:Qaiser, +7:u04:med, +16:u07:Declarations, +9:u02:Farid, +9:u03:Shah., +12:u04:Bourhia., +16:u06:availability, +10:u10:qaiser, +7:u23:med, +14:uI0:.,,,:.,,,-, +10:uI2:().,,., +10:u01:Qaiser, +7:u03:med, +16:u06:Declarations, +12:u08:sumption, +9:u01:Farid, +9:u02:Shah., +12:u03:Bourhia., +16:u05:availability, +10:uI1:().,,., +10:u00:Qaiser, +7:u02:med, +16:u05:Declarations, +9:u00:Farid, +9:u01:Shah., +12:u02:Bourhia., +16:u04:availability, +10:uI0:().,,., +7:u01:med, +16:u04:Declarations, +12:u07:sumption, +9:u00:Shah., +12:u01:Bourhia., +16:u03:availability, +7:u00:med, +16:u03:Declarations, +12:u06:sumption, +12:u00:Bourhia., +16:u02:availability, +12:u14:sumption, +16:u02:Declarations, +12:u05:sumption, +16:u01:availability, +21:u08:biotransformation, +12:u13:sumption, +16:u01:Declarations, +12:u04:sumption, +16:u00:availability, +21:u07:biotransformation, +12:u12:sumption, +16:u00:Declarations, +12:u03:sumption, +21:u06:biotransformation, +12:u11:sumption, +12:u02:sumption, +21:u05:biotransformation, +12:u10:sumption, +12:u01:sumption, +21:u04:biotransformation, +12:u00:sumption, +21:u03:biotransformation, +21:u02:biotransformation, +21:u01:biotransformation, +21:u00:biotransformation, +9:uI2:.,,,-, +13:u08:article's, +9:uI1:.,,,-, +9:uI2:,,(),, +13:u07:article's, +9:uI0:.,,,-, +9:uI1:,,(),, +13:u06:article's, +9:uI0:,,(),, +20:u08:2022;234:111878., +13:u05:article's, +6:u08:Du, +13:u04:article's, +6:u07:Du, +20:u07:2022;234:111878., +13:u03:article's, +6:u06:Du, +11:u08:Nagatsu, +20:u06:2022;234:111878., +11:u08:Transm., +13:u02:article's, +6:u05:Du, +11:u07:Nagatsu, +20:u14:2022;234:111878., +15:uI2:.,,,,,,.-.., +20:u05:2022;234:111878., +13:u01:article's, +6:u04:Du, +11:u06:Nagatsu, +21:u08:2016;123:1255-78., +20:u13:2022;234:111878., +15:uI1:.,,,,,,.-.., +20:u04:2022;234:111878., +11:u07:Transm., +13:u08:overview., +13:u00:article's, +6:u03:Du, +11:u05:Nagatsu, +21:u07:2016;123:1255-78., +10:u08:Rausch, +20:u12:2022;234:111878., +15:uI0:.,,,,,,.-.., +15:uI2:.,.(),(),-,, +20:u03:2022;234:111878., +11:u06:Transm., +6:u02:Du, +11:u04:Nagatsu, +21:u06:2016;123:1255-78., +10:u07:Rausch, +20:u11:2022;234:111878., +11:u14:transm., +15:uI1:.,.(),(),-,, +9:uI2:'():., +20:u02:2022;234:111878., +11:u05:Transm., +13:u07:overview., +6:u01:Du, +11:u03:Nagatsu, +21:u05:2016;123:1255-78., +10:u06:Rausch, +20:u10:2022;234:111878., +11:u13:transm., +15:uI0:.,.(),(),-,, +9:uI1:'():., +20:u01:2022;234:111878., +11:u04:Transm., +13:u06:overview., +6:u00:Du, +11:u02:Nagatsu, +21:u04:2016;123:1255-78., +10:u05:Rausch, +11:u12:transm., +13:u14:overview., +9:uI0:'():., +10:uI2:.,,.':, +20:u00:2022;234:111878., +11:u03:Transm., +13:u05:overview., +11:u01:Nagatsu, +21:u03:2016;123:1255-78., +10:u04:Rausch, +9:u08:Ghazy, +11:u11:transm., +13:u13:overview., +10:uI1:.,,.':, +11:u02:Transm., +13:u04:overview., +13:u08:carbidopa, +11:u00:Nagatsu, +21:u02:2016;123:1255-78., +10:u03:Rausch, +9:u07:Ghazy, +8:u08:Baba, +11:u10:transm., +13:u12:overview., +10:uI0:.,,.':, +13:uI2:.,,,,.':., +11:u01:Transm., +13:u03:overview., +21:u01:2016;123:1255-78., +10:u02:Rausch, +9:u06:Ghazy, +8:u07:Baba, +13:u11:overview., +13:uI1:.,,,,.':., +11:u00:Transm., +13:u02:overview., +13:u07:carbidopa, +21:u00:2016;123:1255-78., +10:u01:Rausch, +9:u05:Ghazy, +8:u06:Baba, +10:u08:O'Neil, +13:u10:overview., +13:uI0:.,,,,.':., +15:uI2:.,,,.:..;:., +13:u01:overview., +13:u06:carbidopa, +10:u00:Rausch, +9:u04:Ghazy, +8:u05:Baba, +10:u07:O'Neil, +8:u08:Co.,, +13:u14:carbidopa, +15:uI1:.,,,.:..;:., +13:u00:overview., +13:u05:carbidopa, +14:u08:excipients, +9:u03:Ghazy, +8:u04:Baba, +10:u06:O'Neil, +8:u07:Co.,, +13:u13:carbidopa, +15:uI0:.,,,.:..;:., +11:uI2:':..;:., +13:u04:carbidopa, +9:u02:Ghazy, +8:u03:Baba, +10:u05:O'Neil, +8:u06:Co.,, +13:u12:carbidopa, +11:uI1:':..;:., +15:uI2:.'.:,,..,,:, +13:u03:carbidopa, +14:u07:excipients, +9:u01:Ghazy, +8:u02:Baba, +10:u04:O'Neil, +8:u05:Co.,, +16:u08:Dhanasekaran, +13:u11:carbidopa, +11:uI0:':..;:., +15:uI1:.'.:,,..,,:, +9:uI2:.,.;., +13:u02:carbidopa, +14:u06:excipients, +9:u00:Ghazy, +8:u01:Baba, +10:u03:O'Neil, +8:u04:Co.,, +16:u07:Dhanasekaran, +13:u10:carbidopa, +14:u14:excipients, +15:uI0:.'.:,,..,,:, +9:uI1:.,.;., +13:u01:carbidopa, +14:u05:excipients, +17:u08:2020;10:8996., +8:u00:Baba, +10:u02:O'Neil, +8:u03:Co.,, +16:u06:Dhanasekaran, +6:u08:Xu, +14:u13:excipients, +9:uI0:.,.;., +13:u00:carbidopa, +14:u04:excipients, +10:u01:O'Neil, +8:u02:Co.,, +16:u05:Dhanasekaran, +6:u07:Xu, +14:u12:excipients, +14:u03:excipients, +17:u07:2020;10:8996., +14:u08:liferative, +10:u00:O'Neil, +8:u01:Co.,, +16:u04:Dhanasekaran, +6:u06:Xu, +15:u08:Chakraborty, +14:u11:excipients, +14:u02:excipients, +17:u06:2020;10:8996., +8:u00:Co.,, +16:u03:Dhanasekaran, +6:u05:Xu, +15:u07:Chakraborty, +14:u10:excipients, +17:u14:2020;10:8996., +15:uI2:.,,,,,.:,.., +14:u01:excipients, +17:u05:2020;10:8996., +14:u07:liferative, +16:u02:Dhanasekaran, +6:u04:Xu, +15:u06:Chakraborty, +12:u08:Rudrappa, +17:u13:2020;10:8996., +15:uI1:.,,,,,.:,.., +14:u00:excipients, +17:u04:2020;10:8996., +14:u06:liferative, +16:u08:Antibiotics., +16:u01:Dhanasekaran, +6:u03:Xu, +15:u05:Chakraborty, +12:u07:Rudrappa, +15:u08:Penicillium, +17:u12:2020;10:8996., +14:u14:liferative, +15:uI0:.,,,,,.:,.., +14:uI2:.,,,,,,.,-, +17:u03:2020;10:8996., +14:u05:liferative, +16:u00:Dhanasekaran, +6:u02:Xu, +15:u04:Chakraborty, +12:u06:Rudrappa, +15:u07:Penicillium, +16:u08:2023;12:567., +17:u11:2020;10:8996., +14:u13:liferative, +14:uI1:.,,,,,,.,-, +17:u02:2020;10:8996., +14:u04:liferative, +16:u07:Antibiotics., +6:u01:Xu, +15:u03:Chakraborty, +12:u05:Rudrappa, +15:u06:Penicillium, +16:u07:2023;12:567., +17:u10:2020;10:8996., +14:u12:liferative, +14:uI0:.,,,,,,.,-, +17:u01:2020;10:8996., +14:u03:liferative, +16:u06:Antibiotics., +16:u08:2022;12:493., +6:u00:Xu, +15:u02:Chakraborty, +12:u04:Rudrappa, +15:u05:Penicillium, +16:u06:2023;12:567., +14:u11:liferative, +16:u14:antibiotics., +17:u00:2020;10:8996., +14:u02:liferative, +16:u05:Antibiotics., +15:u01:Chakraborty, +12:u03:Rudrappa, +15:u04:Penicillium, +16:u05:2023;12:567., +14:u10:liferative, +16:u13:antibiotics., +14:u01:liferative, +16:u04:Antibiotics., +16:u07:2022;12:493., +15:u00:Chakraborty, +12:u02:Rudrappa, +15:u03:Penicillium, +16:u04:2023;12:567., +16:u08:Balakrishnan, +16:u12:antibiotics., +14:u00:liferative, +16:u03:Antibiotics., +16:u06:2022;12:493., +12:u01:Rudrappa, +15:u02:Penicillium, +16:u03:2023;12:567., +16:u07:Balakrishnan, +16:u11:antibiotics., +16:u14:2022;12:493., +16:u02:Antibiotics., +16:u05:2022;12:493., +12:u00:Rudrappa, +15:u01:Penicillium, +16:u02:2023;12:567., +16:u06:Balakrishnan, +8:u08:Gopu, +16:u10:antibiotics., +16:u13:2022;12:493., +16:u01:Antibiotics., +16:u04:2022;12:493., +15:u00:Penicillium, +16:u01:2023;12:567., +16:u05:Balakrishnan, +8:u07:Gopu, +16:u08:cytotoxicity, +16:u12:2022;12:493., +12:uI2:.,,,.()-, +16:u00:Antibiotics., +16:u03:2022;12:493., +11:u08:Environ, +16:u00:2023;12:567., +16:u04:Balakrishnan, +8:u06:Gopu, +16:u07:cytotoxicity, +13:u08:Muthusamy, +16:u11:2022;12:493., +12:uI1:.,,,.()-, +13:uI2:-()..;:-., +16:u02:2022;12:493., +16:u03:Balakrishnan, +8:u05:Gopu, +16:u06:cytotoxicity, +13:u07:Muthusamy, +16:u10:2022;12:493., +12:uI0:.,,,.()-, +13:uI1:-()..;:-., +16:u01:2022;12:493., +11:u07:Environ, +12:u08:particle, +16:u02:Balakrishnan, +8:u04:Gopu, +16:u05:cytotoxicity, +13:u06:Muthusamy, +11:u08:Mythili, +13:uI0:-()..;:-., +16:u00:2022;12:493., +11:u06:Environ, +16:u01:Balakrishnan, +8:u03:Gopu, +16:u04:cytotoxicity, +13:u05:Muthusamy, +11:u07:Mythili, +11:u14:environ, +10:uI2:.,,,.., +11:u05:Environ, +12:u07:particle, +16:u00:Balakrishnan, +8:u02:Gopu, +16:u03:cytotoxicity, +13:u04:Muthusamy, +11:u06:Mythili, +14:u08:Chinnappan, +11:u13:environ, +10:uI1:.,,,.., +11:u04:Environ, +12:u06:particle, +8:u01:Gopu, +16:u02:cytotoxicity, +13:u03:Muthusamy, +11:u05:Mythili, +14:u07:Chinnappan, +11:u12:environ, +12:u14:particle, +10:uI0:.,,,.., +15:uI2:.,,-,,,-,.-, +11:u03:Environ, +12:u05:particle, +10:u08:capped, +8:u00:Gopu, +16:u01:cytotoxicity, +13:u02:Muthusamy, +11:u04:Mythili, +14:u06:Chinnappan, +11:u11:environ, +12:u13:particle, +15:uI1:.,,-,,,-,.-, +11:u02:Environ, +12:u04:particle, +16:u00:cytotoxicity, +13:u01:Muthusamy, +11:u03:Mythili, +14:u05:Chinnappan, +11:u10:environ, +12:u12:particle, +15:uI0:.,,-,,,-,.-, +11:u01:Environ, +12:u03:particle, +10:u07:capped, +13:u00:Muthusamy, +11:u02:Mythili, +14:u04:Chinnappan, +8:u08:Bhat, +12:u11:particle, +11:u00:Environ, +12:u02:particle, +10:u06:capped, +11:u01:Mythili, +14:u03:Chinnappan, +8:u07:Bhat, +12:u10:particle, +10:u14:capped, +12:u01:particle, +10:u05:capped, +12:u08:lakoocha, +11:u00:Mythili, +14:u02:Chinnappan, +8:u06:Bhat, +10:u13:capped, +10:uI2:...;:., +12:u00:particle, +10:u04:capped, +20:u08:2023;13:3041-51., +14:u01:Chinnappan, +8:u05:Bhat, +9:u08:fruit, +10:u12:capped, +8:u23:capp, +10:uI1:...;:., +13:uI2:.,,,,,,.,, +10:u03:capped, +12:u07:lakoocha, +14:u00:Chinnappan, +8:u04:Bhat, +9:u07:fruit, +10:u11:capped, +10:uI0:...;:., +13:uI1:.,,,,,,.,, +12:uI2:--..;:-., +10:u02:capped, +12:u06:lakoocha, +20:u07:2023;13:3041-51., +8:u03:Bhat, +9:u06:fruit, +9:u08:Hasan, +10:u10:capped, +12:u14:lakoocha, +13:uI0:.,,,,,,.,, +12:uI1:--..;:-., +10:u01:capped, +12:u05:lakoocha, +20:u06:2023;13:3041-51., +8:u02:Bhat, +9:u05:fruit, +9:u07:Hasan, +12:u13:lakoocha, +20:u14:2023;13:3041-51., +12:uI0:--..;:-., +10:u00:capped, +12:u04:lakoocha, +20:u05:2023;13:3041-51., +8:u01:Bhat, +9:u04:fruit, +9:u06:Hasan, +12:u12:lakoocha, +20:u13:2023;13:3041-51., +7:u22:lak, +8:u23:lako, +12:u03:lakoocha, +20:u04:2023;13:3041-51., +8:u08:org/, +8:u00:Bhat, +9:u03:fruit, +9:u05:Hasan, +10:u08:Rauwel, +12:u11:lakoocha, +20:u12:2023;13:3041-51., +8:u23:2023, +13:uI2:..:..;:-., +12:u02:lakoocha, +20:u03:2023;13:3041-51., +9:u02:fruit, +9:u04:Hasan, +10:u07:Rauwel, +12:u10:lakoocha, +20:u11:2023;13:3041-51., +13:uI1:..:..;:-., +14:uI2:.,,,.:,,,,, +12:u01:lakoocha, +20:u02:2023;13:3041-51., +8:u07:org/, +9:u01:fruit, +9:u03:Hasan, +10:u06:Rauwel, +20:u10:2023;13:3041-51., +13:uI0:..:..;:-., +14:uI1:.,,,.:,,,,, +12:u00:lakoocha, +20:u01:2023;13:3041-51., +8:u06:org/, +9:u00:fruit, +9:u02:Hasan, +10:u05:Rauwel, +8:u14:org/, +14:uI0:.,,,.:,,,,, +19:uI2:.,,,.:,,...://., +20:u00:2023;13:3041-51., +8:u05:org/, +9:u01:Hasan, +10:u04:Rauwel, +8:u13:org/, +19:uI1:.,,,.:,,...://., +9:uI2:/.//., +8:u04:org/, +9:u00:Hasan, +10:u03:Rauwel, +8:u12:org/, +19:uI0:.,,,.:,,...://., +9:uI1:/.//., +8:u03:org/, +10:u02:Rauwel, +8:u11:org/, +9:uI0:/.//., +8:u02:org/, +10:u01:Rauwel, +8:u10:org/, +8:u01:org/, +12:u08:bisporus, +10:u00:Rauwel, +9:u08:Owaid, +8:u00:org/, +9:u07:Owaid, +11:u08:pileus., +12:u07:bisporus, +9:u06:Owaid, +11:u07:pileus., +9:u08:Arnow, +12:u06:bisporus, +9:u05:Owaid, +11:u06:pileus., +9:u07:Arnow, +10:u08:Bhatia, +12:u14:bisporus, +12:u05:bisporus, +9:u04:Owaid, +11:u05:pileus., +9:u06:Arnow, +10:u07:Bhatia, +17:u08:2019;10:4274., +12:u13:bisporus, +12:u04:bisporus, +9:u03:Owaid, +11:u04:pileus., +9:u05:Arnow, +10:u06:Bhatia, +17:u07:2019;10:4274., +11:u08:Petkova, +12:u12:bisporus, +7:u22:bis, +8:u23:bisp, +16:uI2:..-,--..;:-., +12:u03:bisporus, +9:u02:Owaid, +11:u03:pileus., +9:u04:Arnow, +10:u05:Bhatia, +17:u06:2019;10:4274., +11:u07:Petkova, +12:u11:bisporus, +16:uI1:..-,--..;:-., +12:uI2:.,,,,.,., +12:u02:bisporus, +13:u08:Pleurotus, +9:u01:Owaid, +11:u02:pileus., +9:u03:Arnow, +10:u04:Bhatia, +17:u05:2019;10:4274., +11:u06:Petkova, +12:u10:bisporus, +16:uI0:..-,--..;:-., +12:uI1:.,,,,.,., +12:u01:bisporus, +9:u00:Owaid, +11:u01:pileus., +9:u02:Arnow, +10:u03:Bhatia, +17:u04:2019;10:4274., +11:u05:Petkova, +11:u08:florida, +12:uI0:.,,,,.,., +12:u00:bisporus, +13:u07:Pleurotus, +11:u00:pileus., +9:u01:Arnow, +10:u02:Bhatia, +17:u03:2019;10:4274., +11:u04:Petkova, +11:u07:florida, +9:u08:Aygun, +13:u06:Pleurotus, +9:u00:Arnow, +10:u01:Bhatia, +17:u02:2019;10:4274., +11:u03:Petkova, +11:u06:florida, +9:u07:Aygun, +13:u14:pleurotus, +11:uI2:.,,,,.-, +13:u05:Pleurotus, +8:u08:jhar, +10:u00:Bhatia, +17:u01:2019;10:4274., +11:u02:Petkova, +11:u05:florida, +9:u06:Aygun, +16:u08:Daspattanaik, +13:u13:pleurotus, +11:uI1:.,,,,.-, +16:uI2:...://././/., +13:u04:Pleurotus, +17:u00:2019;10:4274., +11:u01:Petkova, +11:u04:florida, +9:u05:Aygun, +16:u07:Daspattanaik, +17:u08:experiment-1., +13:u12:pleurotus, +8:u23:Pleu, +11:uI0:.,,,,.-, +16:uI1:...://././/., +13:u03:Pleurotus, +8:u07:jhar, +9:u08:Ceram, +11:u00:Petkova, +11:u03:florida, +9:u04:Aygun, +16:u06:Daspattanaik, +17:u07:experiment-1., +18:u08:Doostmohammadi, +13:u11:pleurotus, +16:uI0:...://././/., +13:u02:Pleurotus, +8:u06:jhar, +11:u02:florida, +9:u03:Aygun, +16:u05:Daspattanaik, +17:u06:experiment-1., +18:u07:Doostmohammadi, +13:u10:pleurotus, +8:u14:jhar, +13:u01:Pleurotus, +8:u05:jhar, +9:u07:Ceram, +7:u08:dye, +11:u01:florida, +9:u02:Aygun, +16:u04:Daspattanaik, +17:u05:experiment-1., +18:u06:Doostmohammadi, +8:u13:jhar, +13:u00:Pleurotus, +8:u04:jhar, +9:u06:Ceram, +11:u00:florida, +9:u01:Aygun, +16:u03:Daspattanaik, +17:u04:experiment-1., +18:u05:Doostmohammadi, +9:u08:photo, +8:u12:jhar, +9:u14:ceram, +6:u21:jh, +7:u22:jha, +8:u23:jhar, +12:uI2:.,,,,,.., +8:u03:jhar, +9:u05:Ceram, +7:u07:dye, +9:u00:Aygun, +16:u02:Daspattanaik, +17:u03:experiment-1., +18:u04:Doostmohammadi, +9:u07:photo, +10:u08:Winder, +8:u11:jhar, +9:u13:ceram, +12:uI1:.,,,,,.., +8:u02:jhar, +9:u04:Ceram, +7:u06:dye, +15:u08:2014;5:1-6., +16:u01:Daspattanaik, +17:u02:experiment-1., +18:u03:Doostmohammadi, +9:u06:photo, +10:u07:Winder, +9:u08:Zaidi, +8:u10:jhar, +9:u12:ceram, +7:u14:dye, +8:u23:Cera, +12:uI0:.,,,,,.., +13:uI2:.,,,,,.--, +8:u01:jhar, +9:u03:Ceram, +7:u05:dye, +16:u00:Daspattanaik, +17:u01:experiment-1., +18:u02:Doostmohammadi, +9:u05:photo, +10:u06:Winder, +9:u07:Zaidi, +9:u11:ceram, +7:u13:dye, +13:uI1:.,,,,,.--, +8:u00:jhar, +9:u02:Ceram, +7:u04:dye, +15:u07:2014;5:1-6., +17:u00:experiment-1., +18:u01:Doostmohammadi, +9:u04:photo, +10:u05:Winder, +9:u06:Zaidi, +18:u08:Manzoor-ul-Haq, +9:u10:ceram, +7:u12:dye, +7:u22:dye, +7:u23:dye, +13:uI0:.,,,,,.--, +13:uI2:.,...;:-., +9:u01:Ceram, +7:u03:dye, +15:u06:2014;5:1-6., +12:u08:strains., +18:u00:Doostmohammadi, +9:u03:photo, +10:u04:Winder, +9:u05:Zaidi, +18:u07:Manzoor-ul-Haq, +7:u11:dye, +15:u14:2014;5:1-6., +13:uI1:.,...;:-., +10:uI2:.,,..., +9:u00:Ceram, +7:u02:dye, +15:u05:2014;5:1-6., +9:u02:photo, +10:u03:Winder, +9:u04:Zaidi, +18:u06:Manzoor-ul-Haq, +7:u10:dye, +15:u13:2014;5:1-6., +13:uI0:.,...;:-., +10:uI1:.,,..., +7:u01:dye, +15:u04:2014;5:1-6., +12:u07:strains., +9:u01:photo, +10:u02:Winder, +9:u03:Zaidi, +18:u05:Manzoor-ul-Haq, +13:u08:Bamigboye, +15:u12:2014;5:1-6., +10:uI0:.,,..., +12:uI2:.--,,,,., +7:u00:dye, +15:u03:2014;5:1-6., +12:u06:strains., +19:u08:2019;21:311-22., +9:u00:photo, +10:u01:Winder, +9:u02:Zaidi, +18:u04:Manzoor-ul-Haq, +13:u07:Bamigboye, +8:u08:king, +15:u11:2014;5:1-6., +12:u14:strains., +12:uI1:.--,,,,., +15:u02:2014;5:1-6., +12:u05:strains., +10:u00:Winder, +9:u01:Zaidi, +18:u03:Manzoor-ul-Haq, +13:u06:Bamigboye, +8:u07:king, +15:u10:2014;5:1-6., +12:u13:strains., +12:uI0:.--,,,,., +15:u01:2014;5:1-6., +12:u04:strains., +19:u07:2019;21:311-22., +12:u08:removal., +9:u00:Zaidi, +18:u02:Manzoor-ul-Haq, +13:u05:Bamigboye, +8:u06:king, +10:u08:Kameda, +12:u12:strains., +15:u00:2014;5:1-6., +12:u03:strains., +19:u06:2019;21:311-22., +18:u01:Manzoor-ul-Haq, +13:u04:Bamigboye, +8:u05:king, +10:u07:Kameda, +12:u11:strains., +19:u14:2019;21:311-22., +11:uI2:,-(),.., +12:u02:strains., +19:u05:2019;21:311-22., +12:u07:removal., +18:u00:Manzoor-ul-Haq, +13:u03:Bamigboye, +8:u04:king, +10:u06:Kameda, +12:u08:Peterson, +12:u10:strains., +19:u13:2019;21:311-22., +11:uI1:,-(),.., +12:u01:strains., +19:u04:2019;21:311-22., +12:u06:removal., +13:u02:Bamigboye, +8:u03:king, +10:u05:Kameda, +12:u07:Peterson, +11:u08:Biochem, +19:u12:2019;21:311-22., +12:u14:removal., +8:u23:2019, +11:uI0:,-(),.., +12:u00:strains., +19:u03:2019;21:311-22., +12:u05:removal., +13:u01:Bamigboye, +8:u02:king, +10:u04:Kameda, +12:u06:Peterson, +11:u07:Biochem, +12:u08:Jagadish, +19:u11:2019;21:311-22., +12:u13:removal., +19:u02:2019;21:311-22., +12:u04:removal., +13:u00:Bamigboye, +8:u01:king, +10:u03:Kameda, +12:u05:Peterson, +11:u06:Biochem, +12:u07:Jagadish, +19:u10:2019;21:311-22., +12:u12:removal., +19:u01:2019;21:311-22., +12:u03:removal., +8:u00:king, +10:u02:Kameda, +12:u04:Peterson, +11:u05:Biochem, +12:u06:Jagadish, +9:u08:Awwad, +12:u11:removal., +19:u00:2019;21:311-22., +12:u02:removal., +16:u08:methodology., +10:u01:Kameda, +12:u03:Peterson, +11:u04:Biochem, +12:u05:Jagadish, +9:u07:Awwad, +9:u08:XuJie, +12:u10:removal., +12:u01:removal., +10:u00:Kameda, +12:u02:Peterson, +11:u03:Biochem, +12:u04:Jagadish, +9:u06:Awwad, +9:u07:XuJie, +13:u08:Carbohydr, +12:u00:removal., +16:u07:methodology., +14:u08:terization, +12:u01:Peterson, +11:u02:Biochem, +12:u03:Jagadish, +9:u05:Awwad, +9:u06:XuJie, +13:u07:Carbohydr, +13:u08:Narasimha, +16:u06:methodology., +12:u00:Peterson, +11:u01:Biochem, +12:u02:Jagadish, +9:u04:Awwad, +9:u05:XuJie, +13:u06:Carbohydr, +13:u07:Narasimha, +16:u05:methodology., +14:u07:terization, +11:u00:Biochem, +12:u01:Jagadish, +9:u03:Awwad, +9:u04:XuJie, +13:u05:Carbohydr, +13:u06:Narasimha, +16:u04:methodology., +14:u06:terization, +12:u00:Jagadish, +9:u02:Awwad, +9:u03:XuJie, +13:u04:Carbohydr, +13:u05:Narasimha, +14:u14:terization, +11:uI2:.,,,.,-, +16:u03:methodology., +14:u05:terization, +8:u08:leaf, +9:u01:Awwad, +9:u02:XuJie, +13:u03:Carbohydr, +13:u04:Narasimha, +17:u08:Anandalakshmi, +14:u13:terization, +11:uI1:.,,,.,-, +16:u02:methodology., +14:u04:terization, +9:u00:Awwad, +9:u01:XuJie, +13:u02:Carbohydr, +13:u03:Narasimha, +17:u07:Anandalakshmi, +14:u12:terization, +11:uI0:.,,,.,-, +16:u01:methodology., +14:u03:terization, +8:u07:leaf, +9:u00:XuJie, +13:u01:Carbohydr, +13:u02:Narasimha, +17:u06:Anandalakshmi, +12:u08:Kutsevol, +14:u11:terization, +18:uI2:...://././...., +16:u00:methodology., +14:u02:terization, +8:u06:leaf, +13:u00:Carbohydr, +13:u01:Narasimha, +17:u05:Anandalakshmi, +12:u07:Kutsevol, +9:u08:Micro, +14:u10:terization, +8:u14:leaf, +18:uI1:...://././...., +14:u01:terization, +8:u05:leaf, +16:u08:paramagnetic, +13:u00:Narasimha, +17:u04:Anandalakshmi, +12:u06:Kutsevol, +9:u07:Micro, +13:u08:Abdollahi, +8:u13:leaf, +18:uI0:...://././...., +14:u00:terization, +8:u04:leaf, +17:u03:Anandalakshmi, +12:u05:Kutsevol, +9:u06:Micro, +13:u07:Abdollahi, +18:u08:nanoparticles:, +8:u12:leaf, +8:u23:leaf, +12:uI2:.,,,.---, +8:u03:leaf, +16:u07:paramagnetic, +16:u08:antioxidant,, +17:u02:Anandalakshmi, +12:u04:Kutsevol, +9:u05:Micro, +13:u06:Abdollahi, +18:u07:nanoparticles:, +8:u11:leaf, +12:uI1:.,,,.---, +8:u02:leaf, +16:u06:paramagnetic, +17:u01:Anandalakshmi, +12:u03:Kutsevol, +9:u04:Micro, +13:u05:Abdollahi, +18:u06:nanoparticles:, +17:u08:cytotoxicity,, +8:u10:leaf, +16:u14:paramagnetic, +12:uI0:.,,,.---, +8:u01:leaf, +16:u05:paramagnetic, +16:u07:antioxidant,, +17:u00:Anandalakshmi, +12:u02:Kutsevol, +9:u03:Micro, +13:u04:Abdollahi, +18:u05:nanoparticles:, +17:u07:cytotoxicity,, +13:u08:Salayová, +16:u13:paramagnetic, +11:uI2::..;:-., +8:u00:leaf, +16:u04:paramagnetic, +16:u06:antioxidant,, +12:u01:Kutsevol, +9:u02:Micro, +13:u03:Abdollahi, +18:u04:nanoparticles:, +17:u06:cytotoxicity,, +13:u07:Salayová, +16:u12:paramagnetic, +16:u14:antioxidant,, +11:uI1::..;:-., +16:u03:paramagnetic, +16:u05:antioxidant,, +12:u00:Kutsevol, +9:u01:Micro, +13:u02:Abdollahi, +18:u03:nanoparticles:, +17:u05:cytotoxicity,, +13:u06:Salayová, +8:u08:Jain, +16:u11:paramagnetic, +16:u13:antioxidant,, +11:uI0::..;:-., +12:uI2:,,..;:-., +16:u02:paramagnetic, +16:u04:antioxidant,, +9:u00:Micro, +13:u01:Abdollahi, +18:u02:nanoparticles:, +17:u04:cytotoxicity,, +13:u05:Salayová, +8:u07:Jain, +13:u08:property., +16:u10:paramagnetic, +16:u12:antioxidant,, +12:uI1:,,..;:-., +16:u01:paramagnetic, +16:u03:antioxidant,, +11:u08:promote, +13:u00:Abdollahi, +18:u01:nanoparticles:, +17:u03:cytotoxicity,, +13:u04:Salayová, +8:u06:Jain, +13:u07:property., +6:u08:Hu, +16:u11:antioxidant,, +12:uI0:,,..;:-., +10:uI2::..;:., +16:u00:paramagnetic, +16:u02:antioxidant,, +18:u00:nanoparticles:, +17:u02:cytotoxicity,, +13:u03:Salayová, +8:u05:Jain, +13:u06:property., +6:u07:Hu, +16:u08:osteogenesis, +16:u10:antioxidant,, +10:uI1::..;:., +16:u01:antioxidant,, +11:u07:promote, +19:u08:2013;25:284-98., +17:u01:cytotoxicity,, +13:u02:Salayová, +8:u04:Jain, +13:u05:property., +6:u06:Hu, +16:u07:osteogenesis, +10:uI0::..;:., +16:u00:antioxidant,, +11:u06:promote, +17:u00:cytotoxicity,, +13:u01:Salayová, +8:u03:Jain, +13:u04:property., +6:u05:Hu, +16:u06:osteogenesis, +11:u14:promote, +11:u05:promote, +19:u07:2013;25:284-98., +16:u08:nanoparticle, +13:u00:Salayová, +8:u02:Jain, +13:u03:property., +6:u04:Hu, +16:u05:osteogenesis, +11:u13:promote, +11:u04:promote, +19:u06:2013;25:284-98., +8:u01:Jain, +13:u02:property., +6:u03:Hu, +16:u04:osteogenesis, +11:u12:promote, +19:u14:2013;25:284-98., +16:uI2:.,,-,,,,.-.., +11:u03:promote, +19:u05:2013;25:284-98., +16:u07:nanoparticle, +8:u00:Jain, +13:u01:property., +6:u02:Hu, +16:u03:osteogenesis, +10:u08:Faisal, +11:u11:promote, +19:u13:2013;25:284-98., +16:uI1:.,,-,,,,.-.., +11:u02:promote, +19:u04:2013;25:284-98., +16:u06:nanoparticle, +13:u00:property., +6:u01:Hu, +16:u02:osteogenesis, +10:u07:Faisal, +11:u10:promote, +19:u12:2013;25:284-98., +16:u14:nanoparticle, +16:uI0:.,,-,,,,.-.., +11:u01:promote, +19:u03:2013;25:284-98., +16:u05:nanoparticle, +17:u08:albidoflavus., +6:u00:Hu, +16:u01:osteogenesis, +10:u06:Faisal, +13:u08:Prakasham, +19:u11:2013;25:284-98., +16:u13:nanoparticle, +11:u00:promote, +19:u02:2013;25:284-98., +16:u04:nanoparticle, +16:u00:osteogenesis, +10:u05:Faisal, +13:u07:Prakasham, +19:u10:2013;25:284-98., +16:u12:nanoparticle, +15:uI2:.,,,,,,.():, +19:u01:2013;25:284-98., +16:u03:nanoparticle, +17:u07:albidoflavus., +10:u04:Faisal, +13:u06:Prakasham, +11:u08:Mohanta, +16:u11:nanoparticle, +15:uI1:.,,,,,,.():, +19:u00:2013;25:284-98., +16:u02:nanoparticle, +17:u06:albidoflavus., +18:u08:2016;10:184-9., +10:u03:Faisal, +13:u05:Prakasham, +11:u07:Mohanta, +8:u08:wild, +16:u10:nanoparticle, +17:u14:albidoflavus., +15:uI0:.,,,,,,.():, +16:u01:nanoparticle, +17:u05:albidoflavus., +10:u02:Faisal, +13:u04:Prakasham, +11:u06:Mohanta, +8:u07:wild, +17:u13:albidoflavus., +16:u00:nanoparticle, +17:u04:albidoflavus., +18:u07:2016;10:184-9., +11:u08:Bioeng., +10:u01:Faisal, +13:u03:Prakasham, +11:u05:Mohanta, +8:u06:wild, +15:u08:Loshchinina, +17:u12:albidoflavus., +8:u23:albi, +17:u03:albidoflavus., +18:u06:2016;10:184-9., +10:u00:Faisal, +13:u02:Prakasham, +11:u04:Mohanta, +8:u05:wild, +15:u07:Loshchinina, +19:u08:2018;126:44-52., +17:u11:albidoflavus., +18:u14:2016;10:184-9., +12:uI2:(.).,,.., +17:u02:albidoflavus., +18:u05:2016;10:184-9., +11:u07:Bioeng., +13:u01:Prakasham, +11:u03:Mohanta, +8:u04:wild, +15:u06:Loshchinina, +19:u07:2018;126:44-52., +17:u10:albidoflavus., +18:u13:2016;10:184-9., +12:uI1:(.).,,.., +17:u01:albidoflavus., +18:u04:2016;10:184-9., +11:u06:Bioeng., +13:u00:Prakasham, +11:u02:Mohanta, +8:u03:wild, +15:u05:Loshchinina, +19:u06:2018;126:44-52., +18:u12:2016;10:184-9., +11:u14:bioeng., +12:uI0:(.).,,.., +11:uI2:.,,,,.., +17:u00:albidoflavus., +18:u03:2016;10:184-9., +11:u05:Bioeng., +11:u01:Mohanta, +8:u02:wild, +15:u04:Loshchinina, +19:u05:2018;126:44-52., +18:u11:2016;10:184-9., +11:u13:bioeng., +11:uI1:.,,,,.., +18:u02:2016;10:184-9., +11:u04:Bioeng., +11:u00:Mohanta, +8:u01:wild, +15:u03:Loshchinina, +19:u04:2018;126:44-52., +18:u10:2016;10:184-9., +11:u12:bioeng., +8:u23:Bioe, +11:uI0:.,,,,.., +18:u01:2016;10:184-9., +11:u03:Bioeng., +8:u00:wild, +15:u02:Loshchinina, +19:u03:2018;126:44-52., +11:u11:bioeng., +18:u00:2016;10:184-9., +11:u02:Bioeng., +15:u01:Loshchinina, +19:u02:2018;126:44-52., +11:u10:bioeng., +11:u01:Bioeng., +10:u08:phytic, +15:u00:Loshchinina, +19:u01:2018;126:44-52., +12:u08:Hulikere, +11:u00:Bioeng., +19:u00:2018;126:44-52., +12:u07:Hulikere, +23:u08:fungus-Cladosporium, +10:u07:phytic, +10:u08:Microb, +12:u06:Hulikere, +23:u07:fungus-Cladosporium, +10:u08:Munjal, +10:u06:phytic, +12:u05:Hulikere, +23:u06:fungus-Cladosporium, +10:u07:Munjal, +10:u14:phytic, +9:uI2:.,.,-, +10:u05:phytic, +10:u07:Microb, +12:u04:Hulikere, +23:u05:fungus-Cladosporium, +10:u06:Munjal, +17:u08:Marín-Zamora, +10:u13:phytic, +9:uI1:.,.,-, +10:u04:phytic, +10:u06:Microb, +12:u03:Hulikere, +23:u04:fungus-Cladosporium, +10:u05:Munjal, +17:u07:Marín-Zamora, +10:u12:phytic, +10:u14:microb, +9:uI0:.,.,-, +10:u03:phytic, +10:u05:Microb, +11:u08:crobium, +12:u02:Hulikere, +23:u03:fungus-Cladosporium, +10:u04:Munjal, +17:u06:Marín-Zamora, +7:u08:Tan, +10:u11:phytic, +10:u13:microb, +10:u02:phytic, +10:u04:Microb, +12:u01:Hulikere, +23:u02:fungus-Cladosporium, +10:u03:Munjal, +17:u05:Marín-Zamora, +7:u07:Tan, +12:u08:spinosum, +10:u10:phytic, +10:u12:microb, +13:uI2:.-,-,-,-., +10:u01:phytic, +10:u03:Microb, +11:u07:crobium, +12:u00:Hulikere, +23:u01:fungus-Cladosporium, +10:u02:Munjal, +17:u04:Marín-Zamora, +7:u06:Tan, +12:u07:spinosum, +10:u11:microb, +13:uI1:.-,-,-,-., +10:u00:phytic, +10:u02:Microb, +11:u06:crobium, +23:u00:fungus-Cladosporium, +10:u01:Munjal, +17:u03:Marín-Zamora, +7:u05:Tan, +12:u06:spinosum, +10:u10:microb, +11:u14:crobium, +13:uI0:.-,-,-,-., +17:uI2:.,-,-,-,,-.--, +10:u01:Microb, +11:u05:crobium, +10:u00:Munjal, +17:u02:Marín-Zamora, +7:u04:Tan, +12:u05:spinosum, +11:u13:crobium, +17:uI1:.,-,-,-,,-.--, +10:u00:Microb, +11:u04:crobium, +17:u01:Marín-Zamora, +7:u03:Tan, +12:u04:spinosum, +11:u12:crobium, +8:u23:crob, +17:uI0:.,-,-,-,,-.--, +11:u03:crobium, +17:u00:Marín-Zamora, +7:u02:Tan, +12:u03:spinosum, +11:u11:crobium, 16:u05:Associations, 8:u06:post, 13:u07:epilepsy:, @@ -241660,7 +246785,6 @@ 14:u01:Biomedical, 11:u02:Bristol, 12:u03:Bristol., -13:u08:Materials, 7:u02:NHS, 8:u05:NHS,, 11:u10:bristol, @@ -241673,20 +246797,16 @@ 12:u10:bristol., 11:u00:Bristol, 12:u01:Bristol., -13:u07:Materials, 13:u08:2,650,219, 7:u00:NHS, 8:u03:NHS,, 12:u00:Bristol., -13:u06:Materials, 8:u02:NHS,, 12:u08:eligible, -13:u05:Materials, 13:u07:2,650,219, 8:u01:NHS,, 12:u07:eligible, 14:u08:congenital, -13:u04:Materials, 13:u06:2,650,219, 11:u08:cohort,, 8:u00:NHS,, @@ -241695,13 +246815,11 @@ 10:u08:mother, 13:u14:2,650,219, 8:u23:Mate, -13:u03:Materials, 13:u05:2,650,219, 12:u05:eligible, 14:u06:congenital, 10:u07:mother, 13:u13:2,650,219, -13:u02:Materials, 13:u04:2,650,219, 11:u07:cohort,, 12:u04:eligible, @@ -241711,7 +246829,6 @@ 13:u12:2,650,219, 7:u22:2,6, 8:u23:2,65, -13:u01:Materials, 13:u03:2,650,219, 11:u06:cohort,, 12:u03:eligible, @@ -241720,7 +246837,6 @@ 8:u07:1983, 13:u11:2,650,219, 11:u14:cohort,, -13:u00:Materials, 13:u02:2,650,219, 11:u05:cohort,, 13:u08:Perinatal, @@ -242088,37 +247204,28 @@ 9:u00:nosis, 10:u04:(grams, 12:u02:(social,, -15:u08:investigate, 10:u12:(grams, 7:u22:(gr, 8:u23:(gra, 10:u03:(grams, 12:u01:(social,, -15:u07:investigate, 10:u11:(grams, 10:u02:(grams, 12:u00:(social,, -15:u06:investigate, 10:u10:(grams, 10:u01:(grams, 10:u08:(above, -15:u05:investigate, 10:u00:(grams, -15:u04:investigate, 10:u07:(above, -15:u03:investigate, 10:u08:mean),, 10:u06:(above, -15:u02:investigate, 10:u07:mean),, 10:u14:(above, 10:u05:(above, -15:u01:investigate, 10:u06:mean),, 10:u13:(above, 11:uI2:(),(()-, 10:u04:(above, -15:u00:investigate, 10:u05:mean),, 10:u12:(above, 7:u22:(ab, @@ -243654,8 +248761,6 @@ 11:u11:101,451, 9:u13:4,178, 9:u14:1,426, -7:u22:Hig, -8:u23:High, 11:u00:206,238, 10:u01:72,269, 11:u02:101,451, @@ -244351,7 +249456,6 @@ 13:uI1:(((-)())., 13:u02:1�28)),, 16:u07:(1.03-1.10),, -11:u08:groups,, 7:u03:(OR, 13:u07:p<0.001)., 13:u08:repeating, @@ -244365,59 +249469,47 @@ 16:u14:(1.03-1.10),, 13:u00:1�28)),, 16:u05:(1.03-1.10),, -11:u07:groups,, 7:u01:(OR, 13:u05:p<0.001)., 13:u06:repeating, 16:u13:(1.03-1.10),, 13:uI2:(.-.),.)., 16:u04:(1.03-1.10),, -11:u06:groups,, 12:u08:onstrate, 7:u00:(OR, 13:u04:p<0.001)., 13:u05:repeating, 16:u12:(1.03-1.10),, -11:u14:groups,, 8:u23:(1.0, 13:uI1:(.-.),.)., 16:u03:(1.03-1.10),, -11:u05:groups,, 13:u03:p<0.001)., 13:u04:repeating, 16:u11:(1.03-1.10),, -11:u13:groups,, 13:uI0:(.-.),.)., 16:u02:(1.03-1.10),, -11:u04:groups,, 12:u07:onstrate, 13:u08:Repeating, 13:u02:p<0.001)., 13:u03:repeating, 16:u10:(1.03-1.10),, -11:u12:groups,, 16:u01:(1.03-1.10),, -11:u03:groups,, 12:u06:onstrate, 13:u01:p<0.001)., 13:u02:repeating, -11:u11:groups,, 12:u14:onstrate, 17:uI2:(.(.-.),.).,-, 16:u00:(1.03-1.10),, -11:u02:groups,, 12:u05:onstrate, 13:u07:Repeating, 12:u08:1�11),, 13:u00:p<0.001)., 13:u01:repeating, -11:u10:groups,, 12:u13:onstrate, 7:u22:(OR, 7:u23:(OR, 17:uI1:(.(.-.),.).,-, 14:uI2:(.(.-.),.), -11:u01:groups,, 12:u04:onstrate, 13:u06:Repeating, 13:u08:exclusion, @@ -244429,7 +249521,6 @@ 8:u23:onst, 17:uI0:(.(.-.),.).,-, 14:uI1:(.(.-.),.), -11:u00:groups,, 12:u03:onstrate, 13:u05:Repeating, 12:u07:1�11),, @@ -245106,7 +250197,6 @@ 19:u00:(1�01-1�08), 12:u11:0�0053, 10:u14:��, -9:uI2:,,,-., 12:u00:0�0037, 12:u02:0�0053, 10:u05:��, @@ -245114,7 +250204,6 @@ 12:u10:0�0053, 10:u13:��, 53:u14:https://doi.org/10.1371/journal.pone.0210181.t003, -9:uI1:,,,-., 12:uI2:,;,-,,,., 12:u01:0�0053, 10:u04:��, @@ -245124,7 +250213,6 @@ 10:u21:��, 10:u22:��, 10:u23:��, -9:uI0:,,,-., 12:uI1:,;,-,,,., 12:u00:0�0053, 10:u03:��, @@ -245653,7 +250741,6 @@ 11:u01:Kingdon, 15:u04:Davies-Tuck, 11:u07:Grobman, -14:u08:Management, 44:u11:doi.org/10.1111/j.1471-0528.2009.02119.x, 10:u13:birth:, 28:u14:1016/j.wombi.2018.08.168, @@ -245667,7 +250754,6 @@ 11:u00:Kingdon, 15:u03:Davies-Tuck, 11:u06:Grobman, -14:u07:Management, 41:u08:https://doi.org/10.1056/NEJMoa1800566, 44:u10:doi.org/10.1111/j.1471-0528.2009.02119.x, 10:u12:birth:, @@ -245682,7 +250768,6 @@ 12:u07:513-523., 15:u02:Davies-Tuck, 11:u05:Grobman, -14:u06:Management, 41:u07:https://doi.org/10.1056/NEJMoa1800566, 10:u11:birth:, 28:u12:1016/j.wombi.2018.08.168, @@ -245698,7 +250783,6 @@ 17:u08:CD004945.pub3, 15:u01:Davies-Tuck, 11:u04:Grobman, -14:u05:Management, 41:u06:https://doi.org/10.1056/NEJMoa1800566, 10:u10:birth:, 28:u11:1016/j.wombi.2018.08.168, @@ -245712,7 +250796,6 @@ 12:u05:513-523., 15:u00:Davies-Tuck, 11:u03:Grobman, -14:u04:Management, 41:u05:https://doi.org/10.1056/NEJMoa1800566, 28:u10:1016/j.wombi.2018.08.168, 13:u12:expectant, @@ -245725,7 +250808,6 @@ 12:u04:513-523., 17:u07:CD004945.pub3, 11:u02:Grobman, -14:u03:Management, 41:u04:https://doi.org/10.1056/NEJMoa1800566, 13:u11:expectant, 12:u12:513-523., @@ -245739,7 +250821,6 @@ 17:u06:CD004945.pub3, 36:u08:10.1111/j.1651-2227.2008.00862.x, 11:u01:Grobman, -14:u02:Management, 41:u03:https://doi.org/10.1056/NEJMoa1800566, 13:u08:position:, 13:u10:expectant, @@ -245751,7 +250832,6 @@ 12:u02:513-523., 17:u05:CD004945.pub3, 11:u00:Grobman, -14:u01:Management, 41:u02:https://doi.org/10.1056/NEJMoa1800566, 13:u07:position:, 12:u10:513-523., @@ -245762,7 +250842,6 @@ 17:u04:CD004945.pub3, 36:u07:10.1111/j.1651-2227.2008.00862.x, 11:u08:Events., -14:u00:Management, 41:u01:https://doi.org/10.1056/NEJMoa1800566, 13:u06:position:, 17:u12:cd004945.pub3, @@ -245946,7 +251025,6 @@ 8:u23:ies), 7:uI0::(-, 9:uI1:)..;., -10:uI2:.,,,.., 7:u00:Obs, 11:u02:extreme, 9:u03:ies)., @@ -245959,7 +251037,6 @@ 9:u11:ies)., 9:u13:jama., 9:uI0:)..;., -10:uI1:.,,,.., 19:uI2:.;:-.://././..:, 11:u01:extreme, 9:u02:ies)., @@ -245973,7 +251050,6 @@ 9:u12:jama., 7:u22:JAM, 8:u23:JAMA, -10:uI0:.,,,.., 19:uI1:.;:-.://././..:, 11:u00:extreme, 9:u01:ies)., @@ -246774,7 +251850,6 @@ 7:u11:fax, 10:u00:e-mail, 7:u02:fax, -14:u08:electronic, 17:u05:self-assembly, 10:u06:Grimme, 7:u10:fax, @@ -246782,43 +251857,31 @@ 17:u04:self-assembly, 10:u05:Grimme, 7:u00:fax, -14:u07:electronic, 17:u03:self-assembly, 10:u04:Grimme, -14:u06:electronic, 18:u08:intermolecular, 17:u02:self-assembly, 10:u03:Grimme, -14:u14:electronic, -14:u05:electronic, 10:u08:index., 17:u01:self-assembly, 10:u02:Grimme, -14:u13:electronic, -14:u04:electronic, 18:u07:intermolecular, 17:u00:self-assembly, 10:u01:Grimme, -14:u12:electronic, 9:u14:metal, -14:u03:electronic, 18:u06:intermolecular, 10:u07:index., 10:u00:Grimme, 12:u08:diagonal, -14:u11:electronic, 9:u13:metal, 18:u14:intermolecular, -14:u02:electronic, 18:u05:intermolecular, 10:u06:index., 12:u07:diagonal, 7:u08:H-H, -14:u10:electronic, 9:u12:metal, 18:u13:intermolecular, 10:u14:index., -14:u01:electronic, 18:u04:intermolecular, 10:u05:index., 12:u06:diagonal, @@ -246827,7 +251890,6 @@ 9:u11:metal, 18:u12:intermolecular, 10:u13:index., -14:u00:electronic, 18:u03:intermolecular, 10:u04:index., 12:u05:diagonal, @@ -246863,50 +251925,38 @@ 8:u02:SAM,, 7:u00:H-H, 8:u01:SAM,, -9:uI2:,,[]., 8:u00:SAM,, -9:uI1:,,[]., 13:u08:stabilize, -17:u08:nanoparticles, -9:uI0:,,[]., -17:u07:nanoparticles, 11:uI2:,/-(),-, 13:u07:stabilize, 17:u08:nanocrystals,, -17:u06:nanoparticles, 11:uI1:,/-(),-, 13:u06:stabilize, -17:u05:nanoparticles, 13:u14:stabilize, 11:uI0:,/-(),-, 13:u05:stabilize, 17:u07:nanocrystals,, -17:u04:nanoparticles, 13:u13:stabilize, 11:uI2:[,].,-:, 13:u04:stabilize, 17:u06:nanocrystals,, -17:u03:nanoparticles, 13:u12:stabilize, 17:u14:nanocrystals,, 11:uI1:[,].,-:, 13:u03:stabilize, 17:u05:nanocrystals,, 21:u08:molecule-molecule, -17:u02:nanoparticles, 13:u11:stabilize, 17:u13:nanocrystals,, 11:uI0:[,].,-:, 13:u02:stabilize, 17:u04:nanocrystals,, -17:u01:nanoparticles, 14:u08:strengths., 13:u10:stabilize, 17:u12:nanocrystals,, 13:u01:stabilize, 17:u03:nanocrystals,, 21:u07:molecule-molecule, -17:u00:nanoparticles, 14:u07:strengths., 17:u11:nanocrystals,, 13:u00:stabilize, @@ -247044,18 +252094,15 @@ 16:u01:dramatically, 9:u03:(NCI), 12:u05:platinum, -9:uI2:()-(), 14:u07:surfactant, 16:u00:dramatically, 9:u02:(NCI), 12:u04:platinum, -9:uI1:()-(), 14:u06:surfactant, 9:u07:cubic, 9:u01:(NCI), 12:u03:platinum, 14:u14:surfactant, -9:uI0:()-(), 14:u05:surfactant, 9:u06:cubic, 9:u00:(NCI), @@ -247193,7 +252240,6 @@ 6:u04:A+, 14:u06:Dispersion, 15:u07:(parameters, -8:u08:[8],, 14:u10:constrains, 12:u11:formula:, 6:u12:a+, @@ -247206,7 +252252,6 @@ 6:u03:A+, 14:u05:Dispersion, 15:u06:(parameters, -8:u07:[8],, 12:u10:formula:, 6:u11:a+, 10:uI0:[][]--, @@ -247215,39 +252260,32 @@ 14:u04:Dispersion, 9:u08:dimer, 15:u05:(parameters, -8:u06:[8],, 6:u10:a+, 13:uI2:(:..-[])., 12:u00:formula:, 6:u01:A+, 14:u03:Dispersion, 15:u04:(parameters, -8:u05:[8],, 13:uI1:(:..-[])., 6:u00:A+, 14:u02:Dispersion, 9:u07:dimer, 15:u03:(parameters, -8:u04:[8],, 13:uI0:(:..-[])., 14:u01:Dispersion, 9:u06:dimer, 15:u02:(parameters, -8:u03:[8],, 9:u14:dimer, 14:u00:Dispersion, 9:u05:dimer, 15:u01:(parameters, -8:u02:[8],, 9:u13:dimer, 11:uI2:/-(,),,, 9:u04:dimer, 15:u00:(parameters, -8:u01:[8],, 9:u12:dimer, 11:uI1:/-(,),,, 9:u03:dimer, -8:u00:[8],, 9:u11:dimer, 11:uI0:/-(,),,, 9:u02:dimer, @@ -247910,7 +252948,6 @@ 9:u02:3.975, 15:u03:2.024(21.0), 14:u07:2.187(5.5), -7:u08:(20, 8:u11:1.24, 9:u12:3.985, 9:u13:-0.59, @@ -247928,7 +252965,6 @@ 9:u01:3.975, 15:u02:2.024(21.0), 14:u06:2.187(5.5), -7:u07:(20, 9:u08:5.653, 8:u10:1.24, 9:u11:3.985, @@ -247945,7 +252981,6 @@ 9:u00:3.975, 15:u01:2.024(21.0), 14:u05:2.187(5.5), -7:u06:(20, 9:u07:5.653, 9:u10:3.985, 9:u11:-0.59, @@ -247964,7 +252999,6 @@ 9:u08:-1.26, 15:u00:2.024(21.0), 14:u04:2.187(5.5), -7:u05:(20, 9:u06:5.653, 9:u10:-0.59, 14:u11:2.190(5.5), @@ -247980,7 +253014,6 @@ 9:u07:5.635, 9:u08:-1.14, 14:u03:2.187(5.5), -7:u04:(20, 9:u05:5.653, 15:u08:2.142(26.0), 14:u10:2.190(5.5), @@ -247999,7 +253032,6 @@ 9:u06:5.635, 9:u07:-1.26, 14:u02:2.187(5.5), -7:u03:(20, 9:u04:5.653, 15:u07:2.142(26.0), 15:u08:2.134(26.0), @@ -248016,7 +253048,6 @@ 9:u07:-1.14, 9:u08:0.125, 14:u01:2.187(5.5), -7:u02:(20, 9:u03:5.653, 15:u06:2.142(26.0), 15:u07:2.134(26.0), @@ -248034,7 +253065,6 @@ 9:u06:-1.14, 8:u08:8.00, 14:u00:2.187(5.5), -7:u01:(20, 9:u02:5.653, 15:u05:2.142(26.0), 15:u06:2.134(26.0), @@ -248052,7 +253082,6 @@ 9:u05:-1.14, 9:u07:0.125, 15:u08:2.151(29.7), -7:u00:(20, 9:u01:5.653, 15:u04:2.142(26.0), 15:u05:2.134(26.0), @@ -249330,7 +254359,6 @@ 12:u08:Johnson,, 8:u11:p.e., 15:uI0:..,-,..()-., -9:uI2:.,.,-, 17:u00:semiconductor, 8:u02:P.E., 8:u07:E.R., @@ -249338,14 +254366,12 @@ 12:u07:Johnson,, 15:u08:Noncovalent, 8:u10:p.e., -9:uI1:.,.,-, 8:u01:P.E., 8:u06:E.R., 11:u01:Blochl,, 12:u06:Johnson,, 15:u07:Noncovalent, 8:u14:e.r., -9:uI0:.,.,-, 8:u00:P.E., 8:u05:E.R., 11:u00:Blochl,, @@ -249642,7 +254668,6 @@ 11:u03:Dunitz,, 11:u06:Poater,, 8:u11:j.d., -8:u23:Bond, 10:uI0:..,.,:, 14:uI1:?,....()-., 8:u02:J.D., @@ -249723,7 +254748,6 @@ 15:u07:Netherlands, 9:u08:Kumar, 11:u13:sumanth, -8:u23:Acro, 6:uI2:,*, 10:u03:Across, 11:u04:Sumanth, @@ -252964,20 +257988,17 @@ 10:u05:BLASTP, 13:u10:proteomes, 12:u14:interpro, -9:uI2:...[], 41:u00:(https://www.uniprot.org/proteomes/)., 13:u01:proteomes, 12:u05:InterPro, 10:u04:BLASTP, 12:u13:interpro, -9:uI1:...[], 17:uI2:.-.(://...//), 13:u00:proteomes, 12:u04:InterPro, 12:u08:MycoCosm, 10:u03:BLASTP, 12:u12:interpro, -9:uI0:...[], 17:uI1:.-.(://...//), 12:u03:InterPro, 10:u02:BLASTP, @@ -253923,19 +258944,16 @@ 17:u06:co-expression, 9:u08:Nanao, 12:u11:complex., -11:uI2:.,,,,.-, 16:u08:2014;5:3617., 12:u00:Takemoto, 8:u04:Piya, 17:u05:co-expression, 9:u07:Nanao, 12:u10:complex., -11:uI1:.,,,,.-, 11:uI2:-/..;:-, 8:u03:Piya, 17:u04:co-expression, 9:u06:Nanao, -11:uI0:.,,,,.-, 11:uI1:-/..;:-, 16:u07:2014;5:3617., 9:u08:Biol., @@ -254036,7 +259054,6 @@ 10:u05:Trehin, 9:u08:Burke, 15:u12:2019;19:90., -8:u23:2019, 15:uI2:.,,,-,-,-,., 15:u03:2019;19:90., 21:u00:2017;114:2419-24., @@ -254173,7 +259190,6 @@ 10:u05:Hirano, 11:u08:Breiman, 12:u12:qa-snare, -6:u21:Qa, 7:u22:Qa-, 8:u23:Qa-S, 12:u03:Qa-SNARE, @@ -255175,7 +260191,6 @@ 12:u02:protons., 16:u03:polarisation, 12:u04:dilution, -6:u08:cm, 11:u10:larised, 11:u11:nuclear, 10:u13:isable, @@ -255186,7 +260201,6 @@ 12:u01:protons., 16:u02:polarisation, 12:u03:dilution, -6:u07:cm, 11:u10:nuclear, 10:u12:isable, 7:u22:isa, @@ -255198,43 +260212,36 @@ 12:u00:protons., 16:u01:polarisation, 12:u02:dilution, -6:u06:cm, 10:u11:isable, 11:u00:nuclear, 10:u02:isable, 11:u06:bouring, 16:u00:polarisation, 12:u01:dilution, -6:u05:cm, 10:u10:isable, 11:u14:bouring, 10:u01:isable, 11:u05:bouring, 12:u00:dilution, -6:u04:cm, 11:u13:bouring, 10:u00:isable, 11:u04:bouring, 11:u08:imising, -6:u03:cm, 11:u12:bouring, 16:u14:polarisation, 8:u23:bour, 11:u03:bouring, -6:u02:cm, 11:u11:bouring, 16:u13:polarisation, 11:u02:bouring, 11:u07:imising, 18:u08:repolarisation, -6:u01:cm, 11:u10:bouring, 16:u12:polarisation, 14:u14:acceptance, 11:u01:bouring, 11:u06:imising, 12:u08:changed., -6:u00:cm, 16:u11:polarisation, 14:u13:acceptance, 11:u14:imising, @@ -255544,7 +260551,6 @@ 9:u02:tered, 8:u04:ergy, 10:u07:muons., -11:u08:duction, 9:u02:muon,, 9:u10:tered, 8:u12:ergy, @@ -255561,7 +260567,6 @@ 9:u00:tered, 8:u02:ergy, 10:u05:muons., -11:u07:duction, 9:u00:muon,, 8:u10:ergy, 10:u13:muons., @@ -255569,36 +260574,24 @@ 10:uI2:.""[]-, 8:u01:ergy, 10:u04:muons., -11:u06:duction, 10:u12:muons., -11:u14:duction, 7:u22:muo, 8:u23:muon, 10:uI1:.""[]-, 8:u00:ergy, 10:u03:muons., -11:u05:duction, 10:u11:muons., -11:u13:duction, 10:uI0:.""[]-, 10:u02:muons., -11:u04:duction, 10:u10:muons., -11:u12:duction, 10:u01:muons., -11:u03:duction, 9:u08:mass., -11:u11:duction, 9:u14:muons, 10:u00:muons., -11:u02:duction, -11:u10:duction, 9:u13:muons, -11:u01:duction, 9:u07:mass., 14:u08:(negative), 9:u12:muons, -11:u00:duction, 9:u06:mass., 9:u11:muons, 9:u14:mass., @@ -259741,13 +264734,10 @@ 7:u08:472, 11:u01:Present, 11:u00:Present, -10:uI2:().()., 7:u07:472, -10:uI1:().()., 18:uI2:-,,//,//-//()., 7:u06:472, 7:u14:472, -10:uI0:().()., 18:uI1:-,,//,//-//()., 11:uI2:,,,,()., 7:u05:472, @@ -259869,7 +264859,6 @@ 10:u04:Allard, 11:u05:Yousefi, 10:u07:Bohlin, -6:u08:Xu, 9:u10:lucas, 10:u11:claire, 8:u14:todd, @@ -259883,7 +264872,6 @@ 10:u03:Allard, 11:u04:Yousefi, 10:u06:Bohlin, -6:u07:Xu, 10:u10:claire, 8:u13:todd, 9:u00:Lucas, @@ -259896,7 +264884,6 @@ 10:u02:Allard, 11:u03:Yousefi, 10:u05:Bohlin, -6:u06:Xu, 8:u12:todd, 10:u14:zongli, 7:u22:Tod, @@ -259911,7 +264898,6 @@ 10:u01:Allard, 11:u02:Yousefi, 10:u04:Bohlin, -6:u05:Xu, 8:u11:todd, 10:u13:zongli, 11:u14:rae-chi, @@ -259924,7 +264910,6 @@ 10:u00:Allard, 11:u01:Yousefi, 10:u03:Bohlin, -6:u04:Xu, 9:u08:Baïz, 8:u10:todd, 10:u12:zongli, @@ -259940,7 +264925,6 @@ 11:u08:Golareh, 11:u00:Yousefi, 10:u02:Bohlin, -6:u03:Xu, 9:u07:Baïz, 8:u08:Hoyo, 10:u11:zongli, @@ -259958,7 +264942,6 @@ 12:u07:Cathrine, 8:u08:Ritu, 10:u01:Bohlin, -6:u02:Xu, 9:u06:Baïz, 8:u07:Hoyo, 8:u08:Agha, @@ -259976,7 +264959,6 @@ 12:u06:Cathrine, 11:u07:Golareh, 10:u00:Bohlin, -6:u01:Xu, 9:u05:Baïz, 8:u06:Hoyo, 8:u07:Agha, @@ -259995,7 +264977,6 @@ 11:u06:Golareh, 8:u07:Ritu, 9:u08:Akram, -6:u00:Xu, 9:u04:Baïz, 8:u05:Hoyo, 8:u06:Agha, @@ -260282,7 +265263,6 @@ 9:u05:Karen, 10:u06:Sheryl, 10:u07:Carlos, -10:u08:Faisal, 19:u04:Williams-DeVane, 8:u05:Huen, 15:u07:Ruiz-Arenas, @@ -260318,7 +265298,6 @@ 10:u04:Sheryl, 10:u05:Carlos, 10:u06:Semira, -10:u07:Faisal, 10:u08:Sandra, 19:u02:Williams-DeVane, 8:u03:Huen, @@ -260337,7 +265316,6 @@ 10:u03:Sheryl, 10:u04:Carlos, 10:u05:Semira, -10:u06:Faisal, 10:u07:Zdenko, 19:u01:Williams-DeVane, 8:u02:Huen, @@ -260356,7 +265334,6 @@ 10:u02:Sheryl, 10:u03:Carlos, 10:u04:Semira, -10:u05:Faisal, 10:u06:Zdenko, 10:u07:Sandra, 11:u08:Fahimeh, @@ -260378,7 +265355,6 @@ 10:u01:Sheryl, 10:u02:Carlos, 10:u03:Semira, -10:u04:Faisal, 10:u05:Zdenko, 10:u06:Sandra, 11:u08:Patrice, @@ -260399,7 +265375,6 @@ 10:u00:Sheryl, 10:u01:Carlos, 10:u02:Semira, -10:u03:Faisal, 10:u04:Zdenko, 10:u05:Sandra, 11:u07:Fahimeh, @@ -260420,7 +265395,6 @@ 8:u23:Zden, 10:u00:Carlos, 10:u01:Semira, -10:u02:Faisal, 10:u03:Zdenko, 10:u04:Sandra, 11:u06:Fahimeh, @@ -260439,7 +265413,6 @@ 11:u14:fahimeh, 8:u23:Sand, 10:u00:Semira, -10:u01:Faisal, 10:u02:Zdenko, 10:u03:Sandra, 11:u05:Fahimeh, @@ -260452,12 +265425,10 @@ 9:u04:Croen, 10:u05:Falahi, 10:u06:Perron, -12:u08:Mohammed, 10:u10:zdenko, 10:u11:sandra, 11:u13:fahimeh, 11:u14:patrice, -10:u00:Faisal, 10:u01:Zdenko, 10:u02:Sandra, 11:u04:Fahimeh, @@ -260469,7 +265440,6 @@ 9:u03:Croen, 10:u04:Falahi, 10:u05:Perron, -12:u07:Mohammed, 12:u08:Suderman, 10:u10:sandra, 11:u12:fahimeh, @@ -260490,7 +265460,6 @@ 9:u02:Croen, 10:u03:Falahi, 10:u04:Perron, -12:u06:Mohammed, 12:u07:Suderman, 11:u11:fahimeh, 11:u12:patrice, @@ -260508,7 +265477,6 @@ 9:u01:Croen, 10:u02:Falahi, 10:u03:Perron, -12:u05:Mohammed, 12:u06:Suderman, 6:u08:WV, 11:u10:fahimeh, @@ -260527,7 +265495,6 @@ 9:u00:Croen, 10:u01:Falahi, 10:u02:Perron, -12:u04:Mohammed, 12:u05:Suderman, 6:u07:WV, 11:u10:patrice, @@ -260544,7 +265511,6 @@ 12:u08:Shanshan, 10:u00:Falahi, 10:u01:Perron, -12:u03:Mohammed, 12:u04:Suderman, 6:u06:WV, 12:u10:margaret, @@ -260561,7 +265527,6 @@ 10:u07:Denise, 13:u08:Henriette, 10:u00:Perron, -12:u02:Mohammed, 12:u03:Suderman, 6:u05:WV, 8:u08:Zhao, @@ -260577,7 +265542,6 @@ 10:u06:Denise, 12:u07:Shanshan, 11:u08:Michele, -12:u01:Mohammed, 12:u02:Suderman, 6:u04:WV, 8:u07:Zhao, @@ -260593,7 +265557,6 @@ 12:u06:Shanshan, 13:u07:Henriette, 7:u08:Asa, -12:u00:Mohammed, 12:u01:Suderman, 6:u03:WV, 8:u06:Zhao, @@ -260983,7 +265946,6 @@ 16:u04:Marie-France, 10:u05:Harold, 8:u07:Erik, -9:u08:Hasan, 9:u00:Davey, 12:u01:Eskenazi, 11:u02:Karmaus, @@ -261021,7 +265983,6 @@ 10:u03:Harold, 8:u05:Erik, 10:u06:Monica, -9:u07:Hasan, 12:u08:Isabella, 11:u00:Karmaus, 10:u02:Hivert, @@ -261038,7 +265999,6 @@ 10:u02:Harold, 8:u04:Erik, 10:u05:Monica, -9:u06:Hasan, 10:u07:Joseph, 11:u08:Martine, 10:u01:Hivert, @@ -261057,7 +266017,6 @@ 10:u01:Harold, 8:u03:Erik, 10:u04:Monica, -9:u05:Hasan, 12:u07:Isabella, 9:u08:Emily, 10:u00:Hivert, @@ -261075,7 +266034,6 @@ 10:u00:Harold, 8:u02:Erik, 10:u03:Monica, -9:u04:Hasan, 12:u06:Isabella, 11:u07:Martine, 8:u08:Nina, @@ -261094,7 +266052,6 @@ 8:u23:Hasa, 8:u01:Erik, 10:u02:Monica, -9:u03:Hasan, 12:u05:Isabella, 11:u06:Martine, 9:u07:Emily, @@ -261114,7 +266071,6 @@ 8:u23:Jose, 8:u00:Erik, 10:u01:Monica, -9:u02:Hasan, 12:u04:Isabella, 11:u05:Martine, 9:u06:Emily, @@ -261132,7 +266088,6 @@ 11:u13:martine, 9:u14:emily, 10:u00:Monica, -9:u01:Hasan, 12:u03:Isabella, 11:u04:Martine, 9:u05:Emily, @@ -261149,7 +266104,6 @@ 11:u12:martine, 9:u13:emily, 8:u14:nina, -9:u00:Hasan, 12:u02:Isabella, 11:u03:Martine, 9:u04:Emily, @@ -261625,28 +266579,22 @@ 13:u07:Australia, 10:u03:Curtin, 10:u12:curtin, -11:u14:faculty, 8:u23:Curt, 13:u06:Australia, 10:u02:Curtin, 10:u11:curtin, -11:u13:faculty, 13:u14:australia, 13:u05:Australia, 12:u08:Southern, 10:u01:Curtin, 10:u10:curtin, -11:u12:faculty, 13:u13:australia, -8:u23:Facu, 13:u04:Australia, 10:u00:Curtin, -11:u11:faculty, 13:u12:australia, 13:u03:Australia, 12:u07:Southern, 11:u08:Obesity, -11:u10:faculty, 13:u11:australia, 13:u02:Australia, 12:u06:Southern, @@ -262433,7 +267381,6 @@ 16:u03:methylation., 10:u07:(PACE), 16:u11:differential, -14:u14:comprising, 20:u00:globally[22,23],, 16:u02:differential, 14:u05:Comprising, @@ -262441,7 +267388,6 @@ 10:u06:(PACE), 14:u08:harmonised, 16:u10:differential, -14:u13:comprising, 16:u01:differential, 14:u04:Comprising, 17:u07:meta-analysed, @@ -262449,7 +267395,6 @@ 10:u05:(PACE), 14:u07:harmonised, 7:u08:BMI, -14:u12:comprising, 16:u00:differential, 14:u03:Comprising, 17:u06:meta-analysed, @@ -262458,14 +267403,12 @@ 10:u04:(PACE), 14:u06:harmonised, 7:u07:BMI, -14:u11:comprising, 17:u14:meta-analysed, 14:u02:Comprising, 17:u05:meta-analysed, 10:u03:(PACE), 14:u05:harmonised, 7:u06:BMI, -14:u10:comprising, 17:u13:meta-analysed, 14:u01:Comprising, 17:u04:meta-analysed, @@ -263055,7 +267998,6 @@ 10:u05:Forest, 10:u06:agreed, 22:u07:disproportionately, -14:u08:comprising, 9:u03:2.8)., 9:u04:20/86, 14:u11:estimates:, @@ -263078,7 +268020,6 @@ 10:u03:Forest, 10:u04:agreed, 22:u05:disproportionately, -14:u07:comprising, 9:u01:2.8)., 9:u02:20/86, 10:u11:forest, @@ -263088,7 +268029,6 @@ 10:u02:Forest, 10:u03:agreed, 22:u04:disproportionately, -14:u06:comprising, 9:u00:2.8)., 9:u01:20/86, 10:u10:forest, @@ -263097,25 +268037,19 @@ 10:u01:Forest, 10:u02:agreed, 22:u03:disproportionately, -14:u05:comprising, 9:u00:20/86, 10:u10:agreed, 22:u11:disproportionately, 10:u00:Forest, 10:u01:agreed, 22:u02:disproportionately, -14:u04:comprising, 22:u10:disproportionately, 10:u00:agreed, 22:u01:disproportionately, -14:u03:comprising, 12:u08:ancestry, 22:u00:disproportionately, -14:u02:comprising, 12:u07:ancestry, -14:u01:comprising, 12:u06:ancestry, -14:u00:comprising, 12:u05:ancestry, 9:u08:Naeem, 12:u04:ancestry, @@ -264445,19 +269379,14 @@ 13:u00:platforms, 14:u00:epigenetic, 17:u08:epidemiology., -14:u14:highlights, 17:u07:epidemiology., -14:u13:highlights, 17:u06:epidemiology., 17:u08:Participating, -14:u12:highlights, 17:u14:epidemiology., 17:u05:epidemiology., -14:u11:highlights, 17:u13:epidemiology., 17:u04:epidemiology., 17:u07:Participating, -14:u10:highlights, 17:u12:epidemiology., 8:u23:epid, 17:u03:epidemiology., @@ -265180,7 +270109,6 @@ 11:u14:(n=65),, 7:u22:Era, 8:u23:Eras, -9:uI2:..[]., 14:u02:METAL[94]., 11:u03:Erasmus, 11:u05:(N=65),, @@ -265189,7 +270117,6 @@ 14:u10:metal[94]., 11:u11:erasmus, 11:u13:(n=65),, -9:uI1:..[]., 13:uI2:(),(,)()., 14:u01:METAL[94]., 11:u02:Erasmus, @@ -265200,7 +270127,6 @@ 11:u12:(n=65),, 7:u22:(N=, 8:u23:(N=6, -9:uI0:..[]., 13:uI1:(),(,)()., 9:uI2:,(,(), 14:u00:METAL[94]., @@ -265901,7 +270827,6 @@ 12:u08:Heijmans, 11:u10:cohort., 13:uI1:..().;:-., -13:uI2:..:..;:-., 11:u01:Cohort., 14:u06:nutrition:, 19:u00:anthropometrics, @@ -265912,7 +270837,6 @@ 12:u07:Heijmans, 14:u14:nutrition:, 13:uI0:..().;:-., -13:uI1:..:..;:-., 11:u00:Cohort., 14:u05:nutrition:, 13:u01:Lillycrop, @@ -265921,8 +270845,6 @@ 11:u05:shaping, 12:u06:Heijmans, 14:u13:nutrition:, -13:uI0:..:..;:-., -11:uI2::..;:-., 14:u04:nutrition:, 13:u00:Lillycrop, 9:u01:Obes., @@ -265931,7 +270853,6 @@ 12:u05:Heijmans, 8:u08:Tobi, 14:u12:nutrition:, -11:uI1::..;:-., 14:u03:nutrition:, 9:u00:Obes., 11:u01:Mathers, @@ -265939,7 +270860,6 @@ 12:u04:Heijmans, 8:u07:Tobi, 14:u11:nutrition:, -11:uI0::..;:-., 14:u02:nutrition:, 11:u00:Mathers, 11:u02:shaping, @@ -266069,14 +270989,12 @@ 9:u06:Sharp, 8:u10:nat., 11:u13:surgery, -10:uI2:...;:., 11:u04:surgery, 13:u00:nutrition, 11:u01:Commun., 12:u02:Guénard, 9:u05:Sharp, 11:u12:surgery, -10:uI1:...;:., 11:u03:surgery, 14:u08:Predictors, 11:u00:Commun., @@ -266084,7 +271002,6 @@ 9:u04:Sharp, 13:u08:Herbstman, 11:u11:surgery, -10:uI0:...;:., 11:u02:surgery, 10:u08:Maarri, 12:u00:Guénard, @@ -266399,7 +271316,6 @@ 10:u03:Burris, 10:u06:Murphy, 8:u13:bmi,, -12:uI2:,,..;:-., 14:u01:Framework., 8:u04:BMI,, 19:u07:2012;494:36-43., @@ -266410,7 +271326,6 @@ 10:u08:Breton, 8:u12:bmi,, 8:u23:BMI,, -12:uI1:,,..;:-., 14:u00:Framework., 8:u03:BMI,, 19:u06:2012;494:36-43., @@ -266420,7 +271335,6 @@ 10:u07:Breton, 8:u11:bmi,, 19:u14:2012;494:36-43., -12:uI0:,,..;:-., 8:u02:BMI,, 19:u05:2012;494:36-43., 13:u07:Magnitude, @@ -266704,20 +271618,17 @@ 10:u02:Benton, 9:u05:Smemo, 16:u08:Gonzalez-Rey, -15:uI2:.,,-,,,-,.-, 20:u08:2007;13:1113-39., 18:u00:2015;97:75-85., 10:u01:Benton, 9:u04:Smemo, 16:u07:Gonzalez-Rey, 14:u08:Intestinal, -15:uI1:.,,-,,,-,.-, 14:u07:Vasoactive, 10:u00:Benton, 9:u03:Smemo, 16:u06:Gonzalez-Rey, 14:u07:Intestinal, -15:uI0:.,,-,,,-,.-, 14:u06:Vasoactive, 20:u07:2007;13:1113-39., 9:u02:Smemo, @@ -266835,7 +271746,6 @@ 15:u05:Psychiatry., 15:u08:prospective, 12:u12:salivary, -8:u23:sali, 15:u00:genome-wide, 12:u03:salivary, 16:u08:emotionality, @@ -268322,7 +273232,6 @@ 7:u03:98., 7:u05:99., 8:u07:100., -16:u08:Declarations, 15:u00:Viechtbauer, 12:u02:Hartigan, 10:u03:Triche, @@ -268351,7 +273260,6 @@ 7:u01:98., 7:u03:99., 8:u05:100., -16:u07:Declarations, 12:u00:Hartigan, 10:u01:Triche, 7:u03:Xin, @@ -268362,7 +273270,6 @@ 7:u00:98., 7:u02:99., 8:u04:100., -16:u06:Declarations, 10:u00:Triche, 7:u02:Xin, 11:u04:Phipson, @@ -268372,7 +273279,6 @@ 8:u23:100., 7:u01:99., 8:u03:100., -16:u05:Declarations, 7:u08:GCS, 7:u01:Xin, 11:u03:Phipson, @@ -268380,35 +273286,30 @@ 8:u11:100., 7:u00:99., 8:u02:100., -16:u04:Declarations, 7:u00:Xin, 11:u02:Phipson, 14:u03:Illumina's, 6:u08:CR, 8:u10:100., 8:u01:100., -16:u03:Declarations, 7:u07:GCS, 11:u01:Phipson, 14:u02:Illumina's, 6:u07:CR, 13:u08:analyses., 8:u00:100., -16:u02:Declarations, 7:u06:GCS, 11:u00:Phipson, 14:u01:Illumina's, 6:u06:CR, 13:u07:analyses., 7:u14:gcs, -16:u01:Declarations, 7:u05:GCS, 32:u08:(gemma.sharp@bristol.ac.uk)., 14:u00:Illumina's, 6:u05:CR, 13:u06:analyses., 7:u13:gcs, -16:u00:Declarations, 7:u04:GCS, 6:u04:CR, 13:u05:analyses., @@ -280883,7 +285784,6 @@ 13:u08:ANALYSIS:, 12:u11:(n=1817), 9:u13:genr,, -9:uI2:,,(),, 12:u02:(n=1817), 9:u04:GENR,, 12:u06:(n=3202), @@ -280893,7 +285793,6 @@ 12:u10:(n=1817), 9:u12:genr,, 12:u14:(n=3202), -9:uI1:,,(),, 12:u01:(n=1817), 9:u03:GENR,, 12:u05:(n=3202), @@ -280902,7 +285801,6 @@ 13:u06:ANALYSIS:, 9:u11:genr,, 12:u13:(n=3202), -9:uI0:,,(),, 12:u00:(n=1817), 9:u02:GENR,, 12:u04:(n=3202), @@ -282276,7 +287174,6 @@ 7:u05:hit, 11:u06:2012))., 13:u12:albifrons, -8:u23:albi, 11:uI0:)..,()., 15:uI1:(.;(.,)),.,, 12:uI2:(.).(.;(, @@ -282333,7 +287230,6 @@ 13:u02:paleatus,, 13:u05:"exemplar, 9:u06:0.05., -13:u08:intervals, 10:u05:taxa"), 13:u10:paleatus,, 13:u13:"exemplar, @@ -282358,7 +287254,6 @@ 13:u03:"exemplar, 9:u04:0.05., 11:u06:genome., -13:u07:intervals, 10:u03:taxa"), 13:u11:"exemplar, 9:u12:0.05., @@ -282368,56 +287263,44 @@ 13:u02:"exemplar, 9:u03:0.05., 11:u05:genome., -13:u06:intervals, 10:u02:taxa"), 13:u10:"exemplar, 9:u11:0.05., 11:u13:genome., -13:u14:intervals, 9:uI0:..,,,, 13:u01:"exemplar, 9:u02:0.05., 11:u04:genome., -13:u05:intervals, 10:u01:taxa"), 13:u08:assembly;, 9:u10:0.05., 11:u12:genome., -13:u13:intervals, 9:u14:taxa., 13:u00:"exemplar, 9:u01:0.05., 11:u03:genome., -13:u04:intervals, 10:u00:taxa"), 13:u07:assembly;, 11:u08:phyluce, 11:u11:genome., -13:u12:intervals, 9:u13:taxa., 9:u00:0.05., 11:u02:genome., -13:u03:intervals, 13:u06:assembly;, 11:u07:phyluce, 11:u10:genome., -13:u11:intervals, 9:u12:taxa., 8:u23:taxa, 11:u01:genome., -13:u02:intervals, 13:u05:assembly;, 11:u06:phyluce, 7:u08:85%, -13:u10:intervals, 9:u11:taxa., 11:u00:genome., -13:u01:intervals, 13:u04:assembly;, 11:u05:phyluce, 7:u07:85%, 9:u10:taxa., -13:u00:intervals, 13:u03:assembly;, 11:u04:phyluce, 7:u06:85%, @@ -288591,7 +293474,6 @@ 10:u10:charax, 9:u12:21217, 16:u14:citharinidae, -7:u22:212, 8:u23:2121, 10:u01:Charax, 9:u03:21217, @@ -293025,7 +297907,6 @@ 7:u02:455, 10:u06:11,347, 13:u07:5,078,669, -7:u08:2.7, 7:u10:455, 10:u14:11,347, 9:u00:7,107, @@ -293039,7 +297920,6 @@ 10:u04:11,347, 13:u05:5,078,669, 9:u06:447.6, -7:u07:2.7, 9:u08:2,220, 10:u12:11,347, 13:u13:5,078,669, @@ -293047,57 +297927,45 @@ 10:u03:11,347, 13:u04:5,078,669, 9:u05:447.6, -7:u06:2.7, 7:u08:816, 10:u11:11,347, 13:u12:5,078,669, 9:u13:447.6, -7:u14:2.7, 10:u02:11,347, 13:u03:5,078,669, 9:u04:447.6, -7:u05:2.7, 9:u07:2,220, 10:u10:11,347, 13:u11:5,078,669, 9:u12:447.6, -7:u13:2.7, 7:u22:447, 8:u23:447., 10:u01:11,347, 13:u02:5,078,669, 9:u03:447.6, -7:u04:2.7, 9:u06:2,220, 7:u07:816, 13:u10:5,078,669, 9:u11:447.6, -7:u12:2.7, 9:u14:2,220, -7:u23:2.7, 10:u00:11,347, 13:u01:5,078,669, 9:u02:447.6, -7:u03:2.7, 9:u05:2,220, 7:u06:816, 9:u10:447.6, -7:u11:2.7, 9:u13:2,220, 7:u14:816, 13:u00:5,078,669, 9:u01:447.6, -7:u02:2.7, 9:u04:2,220, 7:u05:816, 9:u08:2,008, -7:u10:2.7, 9:u12:2,220, 7:u13:816, 7:u22:2,2, 8:u23:2,22, 9:u00:447.6, -7:u01:2.7, 9:u03:2,220, 7:u04:816, 9:u08:429.6, @@ -293105,7 +297973,6 @@ 7:u12:816, 7:u22:816, 7:u23:816, -7:u00:2.7, 9:u02:2,220, 7:u03:816, 9:u07:2,008, @@ -293488,7 +298355,6 @@ 7:u02:443, 10:u06:21,322, 13:u07:7,950,573, -7:u08:2.6, 7:u10:443, 10:u14:21,322, 10:u00:16,702, @@ -293502,7 +298368,6 @@ 10:u04:21,322, 13:u05:7,950,573, 9:u06:372.9, -7:u07:2.6, 10:u08:16,572, 10:u12:21,322, 13:u13:7,950,573, @@ -293511,58 +298376,46 @@ 10:u03:21,322, 13:u04:7,950,573, 9:u05:372.9, -7:u06:2.6, 7:u08:774, 10:u11:21,322, 13:u12:7,950,573, 9:u13:372.9, -7:u14:2.6, 7:u22:7,9, 8:u23:7,95, 10:u02:21,322, 13:u03:7,950,573, 9:u04:372.9, -7:u05:2.6, 10:u07:16,572, 10:u10:21,322, 13:u11:7,950,573, 9:u12:372.9, -7:u13:2.6, 7:u22:372, 8:u23:372., 10:u01:21,322, 13:u02:7,950,573, 9:u03:372.9, -7:u04:2.6, 10:u06:16,572, 7:u07:774, 13:u10:7,950,573, 9:u11:372.9, -7:u12:2.6, 10:u14:16,572, -7:u23:2.6, 10:u00:21,322, 13:u01:7,950,573, 9:u02:372.9, -7:u03:2.6, 10:u05:16,572, 7:u06:774, 9:u10:372.9, -7:u11:2.6, 10:u13:16,572, 7:u14:774, 13:u00:7,950,573, 9:u01:372.9, -7:u02:2.6, 10:u04:16,572, 7:u05:774, 10:u08:35,699, -7:u10:2.6, 10:u12:16,572, 7:u13:774, 8:u23:16,5, 9:u00:372.9, -7:u01:2.6, 10:u03:16,572, 7:u04:774, 14:u08:14,067,296, @@ -293570,7 +298423,6 @@ 7:u12:774, 7:u22:774, 7:u23:774, -7:u00:2.6, 10:u02:16,572, 7:u03:774, 10:u07:35,699, @@ -296109,7 +300961,6 @@ 7:u02:766, 10:u06:13,219, 13:u07:5,634,895, -7:u08:2.4, 7:u10:766, 10:u14:13,219, 9:u00:4,791, @@ -296123,7 +300974,6 @@ 10:u04:13,219, 13:u05:5,634,895, 9:u06:426.3, -7:u07:2.4, 9:u08:5,205, 10:u12:13,219, 13:u13:5,634,895, @@ -296132,57 +300982,45 @@ 10:u03:13,219, 13:u04:5,634,895, 9:u05:426.3, -7:u06:2.4, 7:u08:703, 10:u11:13,219, 13:u12:5,634,895, 9:u13:426.3, -7:u14:2.4, 8:u23:5,63, 10:u02:13,219, 13:u03:5,634,895, 9:u04:426.3, -7:u05:2.4, 9:u07:5,205, 10:u10:13,219, 13:u11:5,634,895, 9:u12:426.3, -7:u13:2.4, 7:u22:426, 8:u23:426., 10:u01:13,219, 13:u02:5,634,895, 9:u03:426.3, -7:u04:2.4, 9:u06:5,205, 7:u07:703, 13:u10:5,634,895, 9:u11:426.3, -7:u12:2.4, 9:u14:5,205, -7:u23:2.4, 10:u00:13,219, 13:u01:5,634,895, 9:u02:426.3, -7:u03:2.4, 9:u05:5,205, 7:u06:703, 9:u10:426.3, -7:u11:2.4, 9:u13:5,205, 7:u14:703, 13:u00:5,634,895, 9:u01:426.3, -7:u02:2.4, 9:u04:5,205, 7:u05:703, 9:u08:9,086, -7:u10:2.4, 9:u12:5,205, 7:u13:703, 8:u23:5,20, 9:u00:426.3, -7:u01:2.4, 9:u03:5,205, 7:u04:703, 13:u08:4,331,667, @@ -296190,7 +301028,6 @@ 7:u12:703, 7:u22:703, 7:u23:703, -7:u00:2.4, 9:u02:5,205, 7:u03:703, 9:u07:9,086, @@ -298339,7 +303176,6 @@ 7:u05:441, 8:u12:1392, 7:u13:441, -8:u23:1392, 9:u00:460.1, 8:u03:1392, 7:u04:441, @@ -302065,7 +306901,6 @@ 9:u05:Adv.,, 24:u11:www.rsc.org/advances, 7:u13:rsc, -9:uI2:.,,,-, 24:u02:www.rsc.org/advances, 7:u04:RSC, 9:u06:PAPER, @@ -302076,14 +306911,12 @@ 7:u12:rsc, 7:u22:RSC, 7:u23:RSC, -9:uI1:.,,,-, 24:u01:www.rsc.org/advances, 7:u03:RSC, 9:u05:PAPER, 22:u00:10.1039/c6ra16486b, 9:u03:Adv.,, 7:u11:rsc, -9:uI0:.,,,-, 24:u00:www.rsc.org/advances, 7:u02:RSC, 9:u04:PAPER, @@ -302128,7 +306961,6 @@ 9:u05:(1/c), 9:uI2:(/)(), 8:u07:(8.0, -16:u08:temperatures, 9:u04:(1/c), 9:uI1:(/)(), 10:uI2:..,/--, @@ -302140,7 +306972,6 @@ 10:uI1:..,/--, 8:u05:(8.0, 9:u06:(7.94, -16:u07:temperatures, 9:u02:(1/c), 7:u08:M-H, 8:u13:(8.0, @@ -302149,7 +306980,6 @@ 10:uI2:(./..), 8:u04:(8.0, 9:u05:(7.94, -16:u06:temperatures, 9:u01:(1/c), 7:u07:M-H, 8:u12:(8.0, @@ -302161,7 +306991,6 @@ 11:uI2:(.).(-), 8:u03:(8.0, 9:u04:(7.94, -16:u05:temperatures, 9:u00:(1/c), 7:u06:M-H, 8:u11:(8.0, @@ -302173,7 +307002,6 @@ 11:uI1:(.).(-), 8:u02:(8.0, 9:u03:(7.94, -16:u04:temperatures, 7:u05:M-H, 8:u10:(8.0, 9:u11:(7.94, @@ -302181,21 +307009,17 @@ 11:uI0:(.).(-), 8:u01:(8.0, 9:u02:(7.94, -16:u03:temperatures, 7:u04:M-H, 9:u10:(7.94, 16:u11:temperatures, 8:u00:(8.0, 9:u01:(7.94, -16:u02:temperatures, 9:u08:Arrot, 7:u03:M-H, 16:u10:temperatures, 9:u00:(7.94, -16:u01:temperatures, 7:u02:M-H, 9:u08:plot), -16:u00:temperatures, 9:u07:Arrot, 7:u01:M-H, 9:u07:plot), @@ -302519,42 +307343,33 @@ 7:u03:FM), 7:u11:fm), 7:u02:FM), -13:u08:materials, 7:u10:fm), 7:u01:FM), 13:u08:presently, 12:uI2:-,-,--,., 7:u00:FM), -13:u07:materials, 12:uI1:-,-,--,., -13:u06:materials, 13:u07:presently, 12:uI0:-,-,--,., -13:u05:materials, 13:u06:presently, 13:u14:presently, -13:u04:materials, 13:u05:presently, 13:u13:presently, 7:u14:mce, -13:u03:materials, 13:u04:presently, 8:u08:ÀDS, 13:u12:presently, 7:u13:mce, -13:u02:materials, 13:u03:presently, 13:u11:presently, 7:u12:mce, 7:u22:MCE, 7:u23:MCE, -13:u01:materials, 13:u02:presently, 8:u07:ÀDS, 7:u08:0-2, 13:u10:presently, 7:u11:mce, -13:u00:materials, 13:u01:presently, 8:u06:ÀDS, 7:u10:mce, @@ -302878,22 +307693,15 @@ 13:u02:universal, 9:u06:(RCP), 13:u10:universal, -9:u14:power, 13:u01:universal, 6:u08:(J, 9:u05:(RCP), -9:u13:power, 13:u00:universal, 9:u04:(RCP), -9:u12:power, -7:u22:pow, -8:u23:powe, 6:u07:(J, 9:u03:(RCP), -9:u11:power, 6:u06:(J, 9:u02:(RCP), -9:u10:power, 6:u14:(j, 6:u05:(J, 9:u01:(RCP), @@ -306845,22 +311653,13 @@ 8:u02:ESRD, 8:u10:esrd, 8:u01:ESRD, -7:u08:260, 8:u00:ESRD, -7:u07:260, -7:u06:260, 7:u14:260, -7:u05:260, 7:u13:260, -7:u04:260, 7:u12:260, 7:u23:260, -7:u03:260, 7:u11:260, -7:u02:260, 7:u10:260, -7:u01:260, -7:u00:260, 7:u08:7.9, 7:u07:7.9, 7:u06:7.9, @@ -307075,65 +311874,51 @@ 8:u05:0.47, 8:u13:0.47, 8:u04:0.47, -8:u08:33.5, 8:u12:0.47, 8:u03:0.47, 8:u08:38.8, 8:u08:(87), 8:u11:0.47, 8:u02:0.47, -8:u07:33.5, 8:u07:(87), 8:u08:(73), 8:u10:0.47, 8:u01:0.47, -8:u06:33.5, 8:u07:38.8, 8:u08:34.6, 8:u06:(87), 8:u07:(73), -8:u14:33.5, 8:u00:0.47, -8:u05:33.5, 8:u06:38.8, 8:u08:41.4, 8:u05:(87), 8:u06:(73), 9:u08:(144), -8:u13:33.5, 8:u14:38.8, -8:u04:33.5, 8:u05:38.8, 8:u07:34.6, 8:u04:(87), 8:u05:(73), 9:u07:(144), -8:u12:33.5, 8:u13:38.8, -8:u23:33.5, -8:u03:33.5, 8:u04:38.8, 8:u06:34.6, 8:u07:41.4, 8:u03:(87), 8:u04:(73), 9:u06:(144), -8:u11:33.5, 8:u12:38.8, 8:u14:34.6, 8:u23:38.8, -8:u02:33.5, 8:u03:38.8, 8:u05:34.6, 8:u06:41.4, 8:u02:(87), 8:u03:(73), 9:u05:(144), -8:u10:33.5, 8:u11:38.8, 8:u13:34.6, 8:u14:41.4, -8:u01:33.5, 8:u02:38.8, 8:u04:34.6, 8:u05:41.4, @@ -307144,7 +311929,6 @@ 8:u12:34.6, 8:u13:41.4, 8:u23:34.6, -8:u00:33.5, 8:u01:38.8, 8:u03:34.6, 8:u04:41.4, @@ -307331,7 +312115,6 @@ 8:u05:72.7, 8:u00:16.5, 8:u04:10.5, -8:u08:12.4, 8:u12:71.1, 8:u13:72.7, 8:u23:71.1, @@ -307339,7 +312122,6 @@ 8:u04:72.7, 8:u07:77.9, 8:u03:10.5, -8:u07:12.4, 8:u11:71.1, 8:u12:72.7, 8:u23:72.7, @@ -307347,7 +312129,6 @@ 8:u03:72.7, 8:u06:77.9, 8:u02:10.5, -8:u06:12.4, 8:u10:71.1, 8:u11:72.7, 8:u14:77.9, @@ -307356,33 +312137,27 @@ 8:u05:77.9, 8:u08:13.8, 8:u01:10.5, -8:u05:12.4, 8:u10:72.7, 8:u13:77.9, 8:u00:71.1, 8:u01:72.7, 8:u04:77.9, 8:u00:10.5, -8:u04:12.4, 8:u12:77.9, 8:u23:77.9, 8:u00:72.7, 8:u03:77.9, 8:u07:13.8, -8:u03:12.4, 8:u11:77.9, 8:u02:77.9, 8:u06:13.8, -8:u02:12.4, 8:u10:77.9, 8:u14:13.8, 8:u01:77.9, 8:u05:13.8, -8:u01:12.4, 8:u13:13.8, 8:u00:77.9, 8:u04:13.8, -8:u00:12.4, 8:u12:13.8, 8:u23:13.8, 8:u03:13.8, @@ -309200,7 +313975,6 @@ 6:u13:g,, 11:u14:vitamin, 8:uI0:.;:-, -10:uI2:,,,,-., 6:u04:G,, 11:u05:vitamin, 13:u07:substudy., @@ -309214,7 +313988,6 @@ 6:u21:G,, 6:u22:G,, 6:u23:G,, -10:uI1:,,,,-., 6:u03:G,, 11:u04:vitamin, 13:u06:substudy., @@ -309229,7 +314002,6 @@ 13:u14:substudy., 7:u22:vit, 8:u23:vita, -10:uI0:,,,,-., 6:u02:G,, 11:u03:vitamin, 13:u05:substudy., @@ -311198,7 +315970,6 @@ 13:u14:predation, 13:u05:Predation, 9:u06:prey,, -11:u08:promote, 9:u07:life,, 12:u10:rational, 13:u13:predation, @@ -311212,7 +315983,6 @@ 9:u13:prey,, 13:u03:Predation, 9:u04:prey,, -11:u07:promote, 9:u05:life,, 14:u07:reciprocal, 13:u11:predation, @@ -311220,66 +315990,51 @@ 8:u23:prey, 13:u02:Predation, 9:u03:prey,, -11:u06:promote, 17:u07:interspecific, 9:u04:life,, 14:u06:reciprocal, 13:u08:predators, 13:u10:predation, 9:u11:prey,, -11:u14:promote, 13:u01:Predation, 9:u02:prey,, -11:u05:promote, 17:u06:interspecific, 10:u08:small,, 9:u03:life,, 14:u05:reciprocal, 13:u07:predators, 9:u10:prey,, -11:u13:promote, 17:u14:interspecific, 13:u00:Predation, 9:u01:prey,, -11:u04:promote, 17:u05:interspecific, 9:u02:life,, 14:u04:reciprocal, 13:u06:predators, -11:u12:promote, 17:u13:interspecific, 9:u00:prey,, -11:u03:promote, 17:u04:interspecific, 10:u07:small,, -11:u08:nature., 9:u01:life,, 14:u03:reciprocal, 13:u05:predators, -11:u11:promote, 17:u12:interspecific, -11:u02:promote, 17:u03:interspecific, 10:u06:small,, 9:u00:life,, 14:u02:reciprocal, 13:u04:predators, -11:u10:promote, 17:u11:interspecific, 10:u14:small,, -11:u01:promote, 17:u02:interspecific, 10:u05:small,, -11:u07:nature., 10:u08:member, 14:u01:reciprocal, 13:u03:predators, 17:u10:interspecific, 10:u13:small,, -11:u00:promote, 17:u01:interspecific, 10:u04:small,, -11:u06:nature., 14:u00:reciprocal, 13:u02:predators, 10:u12:small,, @@ -311287,7 +316042,6 @@ 9:uI2:-.[],, 17:u00:interspecific, 10:u03:small,, -11:u05:nature., 10:u07:member, 13:u01:predators, 8:u08:109J, @@ -311295,7 +316049,6 @@ 11:u13:nature., 9:uI1:-.[],, 10:u02:small,, -11:u04:nature., 10:u06:member, 13:u00:predators, 8:u07:109J, @@ -311304,25 +316057,21 @@ 9:uI0:-.[],, 10:uI2:[][].., 10:u01:small,, -11:u03:nature., 10:u05:member, 13:u08:so-called, 8:u06:109J, 11:u11:nature., 10:uI1:[][].., 10:u00:small,, -11:u02:nature., 10:u04:member, 8:u05:109J, 15:u08:bdelloplast, 11:u10:nature., 10:uI0:[][].., -11:u01:nature., 10:u03:member, 13:u07:so-called, 8:u04:109J, 15:u07:bdelloplast, -11:u00:nature., 10:u02:member, 13:u06:so-called, 8:u03:109J, @@ -311385,43 +316134,29 @@ 11:uI0:[].,-(), 12:u01:daughter, 12:u00:daughter, -12:u08:strains., 6:u08:HI, 6:u07:HI, 9:u14:favor, -12:u07:strains., 6:u06:HI, 9:u13:favor, -12:u06:strains., 6:u05:HI, 9:u12:favor, -12:u14:strains., -12:u05:strains., 6:u04:HI, 9:u11:favor, -12:u13:strains., -12:u04:strains., 6:u03:HI, 9:u10:favor, -12:u12:strains., 9:uI2:..):., -12:u03:strains., 6:u02:HI, -12:u11:strains., 9:uI1:..):., 9:uI2:-.):,, -12:u02:strains., 6:u01:HI, -12:u10:strains., 9:uI0:..):., 9:uI1:-.):,, 9:uI2:.):.., -12:u01:strains., 10:u08:attack, 6:u00:HI, 9:uI0:-.):,, 9:uI1:.):.., -12:u00:strains., 14:u08:initiating, 9:uI0:.):.., 10:u07:attack, @@ -311527,38 +316262,29 @@ 13:u00:excellent, 17:u01:intracellular, 16:u07:consequence,, -9:u08:[20]., 9:uI1:[,].', 17:u00:intracellular, 16:u06:consequence,, -9:u07:[20]., 16:u14:consequence,, 9:uI0:[,].', 16:u05:consequence,, -9:u06:[20]., 16:u13:consequence,, 16:u04:consequence,, -9:u05:[20]., 20:u08:biotechnological, 16:u12:consequence,, 16:u03:consequence,, -9:u04:[20]., 20:u07:biotechnological, 16:u11:consequence,, 16:u02:consequence,, 19:u08:high-throughput, -9:u03:[20]., 20:u06:biotechnological, 16:u10:consequence,, 16:u01:consequence,, -9:u02:[20]., 20:u05:biotechnological, 16:u00:consequence,, 19:u07:high-throughput, -9:u01:[20]., 20:u04:biotechnological, 19:u06:high-throughput, -9:u00:[20]., 20:u03:biotechnological, 19:u14:high-throughput, 19:u05:high-throughput, @@ -313312,7 +318038,6 @@ 10:u04:silico, 12:u05:presumes, 7:u07:FBA, -9:u08:[45]., 13:u00:glutamine, 12:u13:presumes, 17:u00:discrepancies, @@ -313324,51 +318049,35 @@ 10:u02:silico, 12:u03:presumes, 7:u05:FBA, -9:u07:[45]., 12:u11:presumes, 7:u13:fba, 10:u01:silico, 12:u02:presumes, 7:u04:FBA, -9:u06:[45]., 12:u10:presumes, 7:u12:fba, -9:u14:[45]., 7:u22:FBA, 7:u23:FBA, 10:u00:silico, 12:u01:presumes, 7:u03:FBA, -9:u05:[45]., 9:u08:Davis, 7:u11:fba, -9:u13:[45]., 16:u14:high-quality, 12:u00:presumes, 7:u02:FBA, -9:u04:[45]., 7:u10:fba, -9:u12:[45]., 16:u13:high-quality, -9:uI2:--[]., 7:u01:FBA, -9:u03:[45]., 9:u07:Davis, -9:u11:[45]., 16:u12:high-quality, -9:uI1:--[]., 7:u00:FBA, -9:u02:[45]., 9:u06:Davis, -9:u10:[45]., 16:u11:high-quality, 9:u14:davis, -9:uI0:--[]., -9:u01:[45]., 9:u05:Davis, 16:u10:high-quality, 9:u13:davis, -9:u00:[45]., 9:u04:Davis, 14:u08:(Ishiguro,, 9:u12:davis, @@ -313736,7 +318445,6 @@ 7:u11:305, 7:u12:333, 7:u13:264, -7:u22:333, 7:u23:333, 7:u00:404, 7:u02:305, @@ -314194,7 +318902,6 @@ 7:u07:GP., 14:u12:phosphate,, 8:u13:hubs, -8:u23:phos, 14:u03:phosphate,, 8:u04:hubs, 8:u08:all., @@ -314259,7 +318966,6 @@ 17:u12:biosynthesis., 16:u13:exclusively,, 18:u14:dehydrogenase,, -8:u23:bios, 8:u02:all., 16:u04:exclusively,, 18:u05:dehydrogenase,, @@ -314515,25 +319221,21 @@ 12:u06:uniform., 9:u08:iCHAP, 11:u05:thought, -16:u08:availability, 12:u14:uniform., 12:u05:uniform., 12:u07:Nutrient, 11:u04:thought, -16:u07:availability, 12:u13:uniform., 12:u04:uniform., 12:u06:Nutrient, 9:u07:iCHAP, 11:u03:thought, -16:u06:availability, 12:u12:uniform., 12:u14:nutrient, 12:u03:uniform., 12:u05:Nutrient, 9:u06:iCHAP, 11:u02:thought, -16:u05:availability, 12:u11:uniform., 12:u13:nutrient, 9:u14:ichap, @@ -314541,7 +319243,6 @@ 12:u04:Nutrient, 9:u05:iCHAP, 11:u01:thought, -16:u04:availability, 12:u10:uniform., 12:u12:nutrient, 9:u13:ichap, @@ -314549,28 +319250,24 @@ 12:u03:Nutrient, 9:u04:iCHAP, 11:u00:thought, -16:u03:availability, 12:u11:nutrient, 9:u12:ichap, 8:u23:iCHA, 12:u00:uniform., 12:u02:Nutrient, 9:u03:iCHAP, -16:u02:availability, 22:u08:specific-condition, 12:u10:nutrient, 9:u11:ichap, 12:u01:Nutrient, 9:u02:iCHAP, 13:u08:flagellum, -16:u01:availability, 22:u07:specific-condition, 11:u08:invests, 9:u10:ichap, 17:u14:distribution,, 12:u00:Nutrient, 9:u01:iCHAP, -16:u00:availability, 22:u06:specific-condition, 11:u07:invests, 17:u13:distribution,, @@ -316114,7 +320811,6 @@ 10:u06:67-73., 30:u11:doi:10.1073/pnas.93.3.1071, 11:u14:2007;2:, -8:uI2:.-.., 12:u00:Margulis, 30:u02:doi:10.1073/pnas.93.3.1071, 11:u05:2007;2:, @@ -316122,7 +320818,6 @@ 10:u05:67-73., 30:u10:doi:10.1073/pnas.93.3.1071, 11:u13:2007;2:, -8:uI1:.-.., 30:u01:doi:10.1073/pnas.93.3.1071, 11:u04:2007;2:, 11:u06:Lambert, @@ -316130,7 +320825,6 @@ 10:u04:67-73., 11:u12:2007;2:, 11:u14:lambert, -8:uI0:.-.., 30:u00:doi:10.1073/pnas.93.3.1071, 11:u03:2007;2:, 11:u05:Lambert, @@ -316569,7 +321263,6 @@ 26:u11:doi:10.1038/msb4100131, 11:u13:flowers, 12:u14:captures, -10:uI2:,,,,.-, 11:u00:Stolyar, 26:u02:doi:10.1038/msb4100131, 11:u04:Flowers, @@ -316581,7 +321274,6 @@ 11:u12:flowers, 12:u13:captures, 12:u14:190-201., -10:uI1:,,,,.-, 26:u01:doi:10.1038/msb4100131, 11:u03:Flowers, 12:u05:190-201., @@ -316591,7 +321283,6 @@ 11:u11:flowers, 12:u12:captures, 12:u13:190-201., -10:uI0:,,,,.-, 11:uI2:-.:./-., 26:u00:doi:10.1038/msb4100131, 11:u02:Flowers, @@ -318193,7 +322884,6 @@ 8:u08:LDH,, 26:u10:doi:10.1093/nar/gkw952, 12:u14:2016;44:, -8:uI2:,-.., 9:u00:2017:, 26:u01:doi:10.1093/nar/gkw952, 12:u05:2016;44:, @@ -318202,7 +322892,6 @@ 14:u05:D515-D522., 8:u07:LDH,, 12:u13:2016;44:, -8:uI1:,-.., 12:uI2:;:-.:.//, 26:u00:doi:10.1093/nar/gkw952, 12:u04:2016;44:, @@ -318213,7 +322902,6 @@ 12:u08:2017;45:, 12:u12:2016;44:, 12:u14:elbourne, -8:uI0:,-.., 12:uI1:;:-.:.//, 12:u03:2016;44:, 12:u05:Elbourne, @@ -318288,7 +322976,6 @@ 13:u04:networks:, 37:u05:doi:10.1016/S0167-7799(97)01067-6, 9:u07:Varma, -11:u08:Environ, 12:u01:2017;45:, 8:u03:HPJ,, 12:u11:bonarius, @@ -318308,7 +322995,6 @@ 13:u02:networks:, 37:u03:doi:10.1016/S0167-7799(97)01067-6, 9:u05:Varma, -11:u07:Environ, 9:u08:1994;, 8:u01:HPJ,, 13:u10:networks:, @@ -318318,45 +323004,34 @@ 13:u01:networks:, 37:u02:doi:10.1016/S0167-7799(97)01067-6, 9:u04:Varma, -11:u06:Environ, 14:u08:3724-3731., 8:u00:HPJ,, 37:u10:doi:10.1016/s0167-7799(97)01067-6, 9:u12:varma, -11:u14:environ, 8:u23:Varm, 13:u00:networks:, 37:u01:doi:10.1016/S0167-7799(97)01067-6, 9:u03:Varma, -11:u05:Environ, 9:u07:1994;, 9:u11:varma, -11:u13:environ, 37:u00:doi:10.1016/S0167-7799(97)01067-6, 9:u02:Varma, -11:u04:Environ, 9:u06:1994;, 14:u07:3724-3731., 70:u08:http://cepac.cheme.cmu.edu/pasilectures/costas/varma-palsson94.pdf, 9:u10:varma, -11:u12:environ, 9:u14:1994;, 9:u01:Varma, -11:u03:Environ, 9:u05:1994;, 14:u06:3724-3731., -11:u11:environ, 9:u13:1994;, 14:u14:3724-3731., 9:u00:Varma, -11:u02:Environ, 9:u04:1994;, 14:u05:3724-3731., 70:u07:http://cepac.cheme.cmu.edu/pasilectures/costas/varma-palsson94.pdf, -11:u10:environ, 9:u12:1994;, 14:u13:3724-3731., -11:u01:Environ, 9:u03:1994;, 14:u04:3724-3731., 70:u06:http://cepac.cheme.cmu.edu/pasilectures/costas/varma-palsson94.pdf, @@ -318365,7 +323040,6 @@ 14:u12:3724-3731., 70:u14:http://cepac.cheme.cmu.edu/pasilectures/costas/varma-palsson94.pdf, 8:u23:3724, -11:u00:Environ, 9:u02:1994;, 14:u03:3724-3731., 70:u05:http://cepac.cheme.cmu.edu/pasilectures/costas/varma-palsson94.pdf, @@ -318655,7 +323329,6 @@ 12:u05:EXCHANGE, 9:u10:co92., 10:u12:hyduke, -7:u22:Hyd, 8:u23:Hydu, 9:uI2:...;-, 28:u00:experimentally-supported, @@ -326223,7 +330896,6 @@ 7:u11:han, 45:u13:https://doi.org/10.1038/s41421-019-0081-2, 27:u14:www.nature.com/celldisc, -14:uI2:://././---, 7:u02:Han, 45:u04:https://doi.org/10.1038/s41421-019-0081-2, 27:u05:www.nature.com/celldisc, @@ -326231,7 +330903,6 @@ 7:u10:han, 45:u12:https://doi.org/10.1038/s41421-019-0081-2, 27:u13:www.nature.com/celldisc, -14:uI1:://././---, 7:u01:Han, 45:u03:https://doi.org/10.1038/s41421-019-0081-2, 27:u04:www.nature.com/celldisc, @@ -326240,7 +330911,6 @@ 13:u02:Discovery, 45:u11:https://doi.org/10.1038/s41421-019-0081-2, 27:u12:www.nature.com/celldisc, -14:uI0:://././---, 7:u00:Han, 45:u02:https://doi.org/10.1038/s41421-019-0081-2, 27:u03:www.nature.com/celldisc, @@ -327743,21 +332413,18 @@ 12:u06:dustrial, 18:u04:Immobilization, 10:u07:media., -11:u08:enzymes, 8:u10:fax:, 12:u14:dustrial, 8:u01:Fax:, 12:u05:dustrial, 18:u03:Immobilization, 10:u06:media., -11:u07:enzymes, 12:u13:dustrial, 8:u00:Fax:, 12:u04:dustrial, 11:u08:organic, 18:u02:Immobilization, 10:u05:media., -11:u06:enzymes, 17:u08:prefabricated, 12:u12:dustrial, 7:u22:dus, @@ -327766,40 +332433,34 @@ 17:u08:cross-linking, 18:u01:Immobilization, 10:u04:media., -11:u05:enzymes, 17:u07:prefabricated, 12:u11:dustrial, 12:u02:dustrial, 11:u07:organic, 18:u00:Immobilization, 10:u03:media., -11:u04:enzymes, 17:u06:prefabricated, 12:u10:dustrial, 12:u01:dustrial, 11:u06:organic, 17:u07:cross-linking, 10:u02:media., -11:u03:enzymes, 17:u05:prefabricated, 12:u00:dustrial, 11:u05:organic, 17:u06:cross-linking, 9:u08:gels,, 10:u01:media., -11:u02:enzymes, 17:u04:prefabricated, 17:u14:cross-linking, 11:u04:organic, 17:u05:cross-linking, 10:u00:media., -11:u01:enzymes, 17:u03:prefabricated, 17:u13:cross-linking, 11:u03:organic, 17:u04:cross-linking, 9:u07:gels,, -11:u00:enzymes, 17:u02:prefabricated, 16:u08:cross-linked, 17:u12:cross-linking, @@ -328175,7 +332836,6 @@ 9:u10:sired, 8:u12:mum., 12:u13:hampered, -7:u22:mum, 8:u23:mum., 9:u01:sired, 8:u03:mum., @@ -328191,7 +332851,6 @@ 12:u03:hampered, 13:u01:activity,, 13:u05:drawbacks, -15:u08:immobilized, 8:u10:mum., 12:u11:hampered, 8:u01:mum., @@ -328199,38 +332858,32 @@ 10:u08:ration, 13:u00:activity,, 13:u04:drawbacks, -15:u07:immobilized, 12:u10:hampered, 8:uI2:.[-], 8:u00:mum., 12:u01:hampered, 10:u08:nating, 13:u03:drawbacks, -15:u06:immobilized, 8:uI1:.[-], 12:u00:hampered, 10:u07:ration, 12:u08:lization, 13:u02:drawbacks, -15:u05:immobilized, 8:uI0:.[-], 10:u06:ration, 10:u07:nating, 13:u01:drawbacks, -15:u04:immobilized, 10:u14:ration, 10:u05:ration, 10:u06:nating, 12:u07:lization, 8:u08:sine, 13:u00:drawbacks, -15:u03:immobilized, 10:u13:ration, 10:u14:nating, 10:u04:ration, 10:u05:nating, 12:u06:lization, -15:u02:immobilized, 7:u08:qua, 10:u12:ration, 10:u13:nating, @@ -328240,7 +332893,6 @@ 12:u05:lization, 8:u07:sine, 8:u08:efit, -15:u01:immobilized, 7:u07:qua, 10:u11:ration, 10:u12:nating, @@ -328249,13 +332901,11 @@ 10:u03:nating, 12:u04:lization, 8:u06:sine, -15:u00:immobilized, 7:u06:qua, 10:u10:ration, 10:u11:nating, 12:u12:lization, 8:u14:sine, -7:u22:liz, 8:u23:liza, 10:u01:ration, 10:u02:nating, @@ -328271,7 +332921,6 @@ 12:u02:lization, 8:u04:sine, 8:u06:efit, -10:u08:enzyme, 7:u04:qua, 12:u10:lization, 8:u12:sine, @@ -328288,7 +332937,6 @@ 12:u00:lization, 8:u02:sine, 8:u04:efit, -10:u07:enzyme, 7:u02:qua, 10:u08:re-use, 8:u10:sine, @@ -328296,7 +332944,6 @@ 8:u23:efit, 8:u01:sine, 8:u03:efit, -10:u06:enzyme, 10:u07:peated, 7:u01:qua, 10:u07:re-use, @@ -328304,7 +332951,6 @@ 8:u11:efit, 8:u00:sine, 8:u02:efit, -10:u05:enzyme, 10:u06:peated, 9:u08:thumb, 7:u00:qua, @@ -328313,20 +332959,17 @@ 8:u10:efit, 10:u14:peated, 8:u01:efit, -10:u04:enzyme, 10:u05:peated, 10:u05:re-use, 7:u06:(kg, 10:u13:peated, 8:u00:efit, -10:u03:enzyme, 10:u04:peated, 9:u07:thumb, 10:u04:re-use, 7:u05:(kg, 10:u12:peated, 10:uI2:(/),,-, -10:u02:enzyme, 10:u03:peated, 9:u06:thumb, 8:u08:2007, @@ -328336,7 +332979,6 @@ 10:u11:peated, 9:u14:thumb, 10:uI1:(/),,-, -10:u01:enzyme, 10:u02:peated, 9:u05:thumb, 8:u08:1289, @@ -328347,7 +332989,6 @@ 10:u10:peated, 9:u13:thumb, 10:uI0:(/),,-, -10:u00:enzyme, 10:u01:peated, 9:u04:thumb, 8:u07:2007, @@ -328475,7 +333116,6 @@ 14:u01:penicillin, 23:u02:3.5.1.11)-catalyzed, 13:u05:fructose,, -18:u08:immobilization, 8:u10:e.c., 13:u12:mobilized, 11:u13:modity,, @@ -328488,7 +333128,6 @@ 14:u00:penicillin, 23:u01:3.5.1.11)-catalyzed, 13:u04:fructose,, -18:u07:immobilization, 11:u08:amidase, 13:u11:mobilized, 11:u12:modity,, @@ -328499,7 +333138,6 @@ 14:u04:merization, 23:u00:3.5.1.11)-catalyzed, 13:u03:fructose,, -18:u06:immobilization, 11:u07:amidase, 16:u08:antibiotics., 13:u10:mobilized, @@ -328511,7 +333149,6 @@ 14:u03:merization, 10:u07:lactam, 13:u02:fructose,, -18:u05:immobilization, 11:u06:amidase, 16:u07:antibiotics., 11:u10:modity,, @@ -328522,7 +333159,6 @@ 14:u02:merization, 10:u06:lactam, 13:u01:fructose,, -18:u04:immobilization, 11:u05:amidase, 16:u06:antibiotics., 14:u10:merization, @@ -328533,43 +333169,35 @@ 10:u05:lactam, 12:u08:powders,, 13:u00:fructose,, -18:u03:immobilization, 11:u04:amidase, 16:u05:antibiotics., 14:u12:penicillin, 10:u13:lactam, -18:u14:immobilization, 8:u23:peni, 14:u00:merization, 10:u04:lactam, 7:u08:ily, -18:u02:immobilization, 11:u03:amidase, 16:u04:antibiotics., 14:u11:penicillin, 10:u12:lactam, -18:u13:immobilization, 10:u03:lactam, 12:u07:powders,, 18:u08:lyophilization, -18:u01:immobilization, 11:u02:amidase, 16:u03:antibiotics., 14:u08:accessible, 14:u10:penicillin, 10:u11:lactam, -18:u12:immobilization, 8:u23:Immo, 10:u02:lactam, 12:u06:powders,, 7:u07:ily, 11:u08:bations, -18:u00:immobilization, 11:u01:amidase, 16:u02:antibiotics., 14:u07:accessible, 10:u10:lactam, -18:u11:immobilization, 12:u14:powders,, 10:u01:lactam, 12:u05:powders,, @@ -328579,7 +333207,6 @@ 11:u00:amidase, 16:u01:antibiotics., 14:u06:accessible, -18:u10:immobilization, 12:u13:powders,, 7:u14:ily, 10:u00:lactam, @@ -328766,20 +333393,17 @@ 14:u05:mercially,, 8:u11:ease, 14:u13:mercially,, -13:u14:synthesis, 8:u02:ease, 14:u04:mercially,, 10:u07:volves, 8:u10:ease, 14:u12:mercially,, -13:u13:synthesis, 14:u14:hydrolases, 8:u01:ease, 14:u03:mercially,, 10:u06:volves, 14:u08:Basically,, 14:u11:mercially,, -13:u12:synthesis, 14:u13:hydrolases, 10:u14:volves, 9:uI2:.[],-, @@ -328788,7 +333412,6 @@ 10:u05:volves, 14:u08:bilization, 14:u10:mercially,, -13:u11:synthesis, 14:u12:hydrolases, 10:u13:volves, 9:uI1:.[],-, @@ -328796,7 +333419,6 @@ 10:u04:volves, 14:u07:Basically,, 14:u08:(carrier),, -13:u10:synthesis, 14:u11:hydrolases, 10:u12:volves, 8:u23:volv, @@ -329467,50 +334089,42 @@ 11:u14:dition,, 13:u01:odologies, 11:u05:dition,, -11:u08:Enzymes, 11:u13:dition,, 13:u00:odologies, 11:u04:dition,, 17:u07:Carrier-Bound, 12:u08:governed, -11:u07:Enzymes, 11:u12:dition,, 11:u03:dition,, 17:u06:Carrier-Bound, -11:u06:Enzymes, 11:u11:dition,, 17:u14:carrier-bound, 11:u02:dition,, 17:u05:Carrier-Bound, 12:u07:governed, -11:u05:Enzymes, 11:u10:dition,, 17:u13:carrier-bound, 11:u01:dition,, 17:u04:Carrier-Bound, 12:u06:governed, 8:u08:cal,, -11:u04:Enzymes, 17:u12:carrier-bound, 12:u14:governed, 8:u23:Carr, 11:u00:dition,, 17:u03:Carrier-Bound, 12:u05:governed, -11:u03:Enzymes, 17:u11:carrier-bound, 12:u13:governed, 17:u02:Carrier-Bound, 12:u04:governed, 8:u07:cal,, 8:u08:mer,, -11:u02:Enzymes, 17:u10:carrier-bound, 12:u12:governed, 17:u01:Carrier-Bound, 12:u03:governed, 8:u06:cal,, -11:u01:Enzymes, 12:u11:governed, 8:u14:cal,, 17:u00:Carrier-Bound, @@ -329518,7 +334132,6 @@ 8:u05:cal,, 8:u07:mer,, 11:u08:Acrylic, -11:u00:Enzymes, 12:u10:governed, 8:u13:cal,, 12:u01:governed, @@ -329572,7 +334185,6 @@ 12:u05:Eupergit, 12:u06:glycidyl, 9:u07:allyl, -12:u08:particle, 8:u10:mer,, 11:u12:acrylic, 13:u13:supports., @@ -329588,7 +334200,6 @@ 12:u04:Eupergit, 12:u05:glycidyl, 9:u06:allyl, -12:u07:particle, 11:u11:acrylic, 13:u12:supports., 39:u13:n,n'-methylene-bi-(methacrylamide),, @@ -329603,7 +334214,6 @@ 12:u03:Eupergit, 12:u04:glycidyl, 9:u05:allyl, -12:u06:particle, 11:u10:acrylic, 13:u11:supports., 39:u12:n,n'-methylene-bi-(methacrylamide),, @@ -329622,7 +334232,6 @@ 12:u02:Eupergit, 12:u03:glycidyl, 9:u04:allyl, -12:u05:particle, 7:u08:14,, 13:u10:supports., 39:u11:n,n'-methylene-bi-(methacrylamide),, @@ -329638,7 +334247,6 @@ 12:u01:Eupergit, 12:u02:glycidyl, 9:u03:allyl, -12:u04:particle, 7:u07:14,, 39:u10:n,n'-methylene-bi-(methacrylamide),, 13:u11:acrylate,, @@ -329651,7 +334259,6 @@ 12:u00:Eupergit, 12:u01:glycidyl, 9:u02:allyl, -12:u03:particle, 7:u06:14,, 13:u10:acrylate,, 14:u13:chemically, @@ -329661,20 +334268,17 @@ 6:u06:pH, 12:u00:glycidyl, 9:u01:allyl, -12:u02:particle, 7:u05:14,, 14:u12:chemically, 13:u00:acrylate,, 14:u03:chemically, 6:u05:pH, 9:u00:allyl, -12:u01:particle, 7:u04:14,, 14:u11:chemically, 14:u02:chemically, 6:u04:pH, 9:u08:epoxy, -12:u00:particle, 7:u03:14,, 14:u10:chemically, 6:u21:pH, @@ -329742,7 +334346,6 @@ 10:u11:amine,, 16:u12:port-protein, 7:u13:ane, -15:u14:immobilized, 9:uI0:,,.)-, 9:u00:epoxy, 10:u02:amine,, @@ -329754,7 +334357,6 @@ 10:u10:amine,, 16:u11:port-protein, 7:u12:ane, -15:u13:immobilized, 28:u14:"multi-point-attachment", 7:u22:ane, 7:u23:ane, @@ -329766,7 +334368,6 @@ 13:u02:reaction., 16:u10:port-protein, 7:u11:ane, -15:u12:immobilized, 28:u13:"multi-point-attachment", 10:u00:amine,, 16:u01:port-protein, @@ -329775,7 +334376,6 @@ 12:u00:glycine,, 13:u01:reaction., 7:u10:ane, -15:u11:immobilized, 28:u12:"multi-point-attachment", 12:u14:eupergit, 6:u21:"m, @@ -329786,7 +334386,6 @@ 28:u03:"multi-point-attachment", 8:u08:dase, 13:u00:reaction., -15:u10:immobilized, 28:u11:"multi-point-attachment", 12:u13:eupergit, 7:u00:ane, @@ -330038,7 +334637,6 @@ 9:u04:decyl, 7:u05:bic, 15:u06:hydrophobic, -19:u08:polysaccharides, 7:u01:435, 13:u02:1-butanol, 11:u04:chains., @@ -330063,7 +334661,6 @@ 9:u02:decyl, 7:u03:bic, 15:u04:hydrophobic, -19:u07:polysaccharides, 13:u00:1-butanol, 11:u02:chains., 7:u04:lid, @@ -330073,7 +334670,6 @@ 9:u01:decyl, 7:u02:bic, 15:u03:hydrophobic, -19:u06:polysaccharides, 12:u07:chitosan, 12:u08:enzymes., 11:u01:chains., @@ -330084,7 +334680,6 @@ 9:u00:decyl, 7:u01:bic, 15:u02:hydrophobic, -19:u05:polysaccharides, 12:u06:chitosan, 11:u00:chains., 7:u02:lid, @@ -330093,7 +334688,6 @@ 12:u14:chitosan, 7:u00:bic, 15:u01:hydrophobic, -19:u04:polysaccharides, 12:u05:chitosan, 12:u07:enzymes., 10:u08:Tanabe, @@ -330101,7 +334695,6 @@ 19:u12:polysaccharides, 12:u13:chitosan, 15:u00:hydrophobic, -19:u03:polysaccharides, 12:u04:chitosan, 12:u06:enzymes., 7:u00:lid, @@ -330109,14 +334702,12 @@ 12:u12:chitosan, 12:u14:enzymes., 8:u23:chit, -19:u02:polysaccharides, 12:u03:chitosan, 12:u05:enzymes., 10:u07:Tanabe, 19:u10:polysaccharides, 12:u11:chitosan, 12:u13:enzymes., -19:u01:polysaccharides, 12:u02:chitosan, 12:u04:enzymes., 10:u06:Tanabe, @@ -330124,7 +334715,6 @@ 12:u10:chitosan, 12:u12:enzymes., 10:u14:tanabe, -19:u00:polysaccharides, 12:u01:chitosan, 12:u03:enzymes., 10:u05:Tanabe, @@ -330237,7 +334827,6 @@ 15:u00:Aspergillus, 8:u03:lyst, 6:u04:L), -9:u08:lized, 10:u00:niger., 12:u02:biphasic, 15:u08:non-aqueous, @@ -330255,53 +334844,40 @@ 6:u11:l), 8:u01:lyst, 6:u02:L), -9:u07:lized, 18:u08:freeze-thawing, 12:u00:biphasic, 15:u06:non-aqueous, 6:u10:l), 8:u00:lyst, 6:u01:L), -9:u06:lized, 13:u07:Polyvinyl, 15:u05:non-aqueous, -9:u14:lized, 6:u00:L), -9:u05:lized, 13:u06:Polyvinyl, 18:u07:freeze-thawing, 15:u04:non-aqueous, -9:u13:lized, 13:u14:polyvinyl, -9:u04:lized, 13:u05:Polyvinyl, 18:u06:freeze-thawing, 13:u08:hydrogels, 15:u03:non-aqueous, -9:u12:lized, 13:u13:polyvinyl, 18:u14:freeze-thawing, -8:u23:lize, -9:u03:lized, 13:u04:Polyvinyl, 18:u05:freeze-thawing, 10:u08:forded, 15:u02:non-aqueous, -9:u11:lized, 13:u12:polyvinyl, 18:u13:freeze-thawing, 9:uI2:-,[],, -9:u02:lized, 13:u03:Polyvinyl, 18:u04:freeze-thawing, 13:u07:hydrogels, 15:u01:non-aqueous, 15:u08:lens-shaped, -9:u10:lized, 13:u11:polyvinyl, 18:u12:freeze-thawing, 9:uI1:-,[],, -9:u01:lized, 13:u02:Polyvinyl, 18:u03:freeze-thawing, 13:u06:hydrogels, @@ -330312,7 +334888,6 @@ 18:u11:freeze-thawing, 13:u14:hydrogels, 9:uI0:-,[],, -9:u00:lized, 13:u01:Polyvinyl, 18:u02:freeze-thawing, 13:u05:hydrogels, @@ -330471,7 +335046,6 @@ 11:u03:medium., 11:u11:aqueous, 11:u13:linking, -11:u14:enzymes, 10:u00:zymes,, 11:u04:linking, 10:u06:media,, @@ -330479,7 +335053,6 @@ 11:u02:medium., 11:u10:aqueous, 11:u12:linking, -11:u13:enzymes, 10:u14:media,, 11:u03:linking, 10:u05:media,, @@ -330487,19 +335060,16 @@ 11:u01:medium., 7:u08:(EC, 11:u11:linking, -11:u12:enzymes, 10:u13:media,, 11:u02:linking, 10:u04:media,, 11:u00:medium., 7:u07:(EC, 11:u10:linking, -11:u11:enzymes, 10:u12:media,, 11:u01:linking, 10:u03:media,, 7:u06:(EC, -11:u10:enzymes, 10:u11:media,, 11:u00:linking, 10:u02:media,, @@ -331543,7 +336113,6 @@ 9:u02:sorbs, 12:u04:Covalent, 23:u07:trimethoxypropanal,, -11:u08:enzyme., 9:u10:sorbs, 12:u12:covalent, 10:uI1:-(...), @@ -331557,14 +336126,12 @@ 9:u00:sorbs, 12:u02:Covalent, 23:u05:trimethoxypropanal,, -11:u07:enzyme., 8:u07:[61], 17:u08:Caldariomyces, 12:u10:covalent, 23:u13:trimethoxypropanal,, 12:u01:Covalent, 23:u04:trimethoxypropanal,, -11:u06:enzyme., 10:u08:vents., 8:u06:[61], 17:u07:Caldariomyces, @@ -331572,7 +336139,6 @@ 11:u14:enzyme., 12:u00:Covalent, 23:u03:trimethoxypropanal,, -11:u05:enzyme., 10:u08:gether, 8:u05:[61], 17:u06:Caldariomyces, @@ -331581,7 +336147,6 @@ 11:u13:enzyme., 9:uI2:.[](), 23:u02:trimethoxypropanal,, -11:u04:enzyme., 10:u07:vents., 10:u08:drogen, 8:u04:[61], @@ -331591,7 +336156,6 @@ 11:u12:enzyme., 9:uI1:.[](), 23:u01:trimethoxypropanal,, -11:u03:enzyme., 10:u06:vents., 10:u07:gether, 9:u08:cose., @@ -331603,7 +336167,6 @@ 10:u14:vents., 9:uI0:.[](), 23:u00:trimethoxypropanal,, -11:u02:enzyme., 10:u05:vents., 10:u06:gether, 10:u07:drogen, @@ -331614,7 +336177,6 @@ 11:u10:enzyme., 10:u13:vents., 10:u14:gether, -11:u01:enzyme., 10:u04:vents., 10:u05:gether, 10:u06:drogen, @@ -331627,7 +336189,6 @@ 10:u12:vents., 10:u13:gether, 10:u14:drogen, -11:u00:enzyme., 10:u03:vents., 10:u04:gether, 10:u05:drogen, @@ -331851,8 +336412,6 @@ 9:u11:ports, 12:u12:crystals, 9:u14:tants, -7:u22:cry, -8:u23:crys, 10:uI1:().[,], 9:u02:ports, 12:u03:crystals, @@ -332227,7 +336786,6 @@ 20:u01:enzyme-polyNIPAM, 17:u02:polymerizable, 9:u07:ester, -11:u08:bilized, 15:u01:conjugates:, 9:u02:vinyl, 20:u03:copolymerization, @@ -332245,44 +336803,31 @@ 9:u14:ester, 17:u00:polymerizable, 9:u05:ester, -11:u07:bilized, 18:u08:enzyme-polymer, 9:u00:vinyl, 20:u01:copolymerization, 6:u10:nh, 9:u13:ester, 9:u04:ester, -11:u06:bilized, 20:u00:copolymerization, 9:u12:ester, -11:u14:bilized, 9:u03:ester, -11:u05:bilized, 18:u07:enzyme-polymer, 9:u11:ester, -11:u13:bilized, 9:u02:ester, -11:u04:bilized, 18:u06:enzyme-polymer, 9:u10:ester, -11:u12:bilized, 18:u14:enzyme-polymer, 9:u01:ester, -11:u03:bilized, 18:u05:enzyme-polymer, 8:u08:1296, -11:u11:bilized, 18:u13:enzyme-polymer, 9:u00:ester, -11:u02:bilized, 18:u04:enzyme-polymer, -11:u10:bilized, 18:u12:enzyme-polymer, -11:u01:bilized, 18:u03:enzyme-polymer, 8:u07:1296, 18:u11:enzyme-polymer, -11:u00:bilized, 18:u02:enzyme-polymer, 8:u06:1296, 18:u10:enzyme-polymer, @@ -333327,29 +337872,24 @@ 8:u05:hols, 16:u03:incarcerated, 8:u13:hols, -13:u14:activity., 8:u04:hols, 17:u07:Cross-Linking, 16:u02:incarcerated, 8:u12:hols, -13:u13:activity., 8:u23:hols, 8:u03:hols, 17:u06:Cross-Linking, 13:u08:dissolved, 16:u01:incarcerated, 8:u11:hols, -13:u12:activity., 8:u02:hols, 17:u05:Cross-Linking, 16:u00:incarcerated, 8:u10:hols, -13:u11:activity., 8:u01:hols, 17:u04:Cross-Linking, 13:u07:dissolved, 16:u08:taraldehyde,, -13:u10:activity., 8:u00:hols, 17:u03:Cross-Linking, 13:u06:dissolved, @@ -333881,7 +338421,6 @@ 9:u08:used,, 8:u14:1299, 8:u05:1299, -11:u08:enzyme,, 8:u13:1299, 8:u04:1299, 9:u07:used,, @@ -333889,53 +338428,40 @@ 8:u23:1299, 8:u03:1299, 9:u06:used,, -11:u07:enzyme,, 13:u08:mentation, 8:u11:1299, 9:u14:used,, 8:u02:1299, 9:u05:used,, -11:u06:enzyme,, 10:u08:broth., 8:u10:1299, 9:u13:used,, -11:u14:enzyme,, 8:u01:1299, 9:u04:used,, -11:u05:enzyme,, 13:u07:mentation, 10:u07:broth., 9:u12:used,, -11:u13:enzyme,, 8:u00:1299, 9:u03:used,, -11:u04:enzyme,, 13:u06:mentation, 10:u06:broth., 9:u11:used,, -11:u12:enzyme,, 13:u14:mentation, 9:u02:used,, -11:u03:enzyme,, 13:u05:mentation, 10:u08:cillin, 10:u05:broth., 9:u10:used,, -11:u11:enzyme,, 13:u13:mentation, 9:u01:used,, -11:u02:enzyme,, 13:u04:mentation, 10:u04:broth., -11:u10:enzyme,, 13:u12:mentation, 9:u00:used,, -11:u01:enzyme,, 13:u03:mentation, 10:u07:cillin, 10:u03:broth., 13:u11:mentation, -11:u00:enzyme,, 13:u02:mentation, 10:u06:cillin, 10:u02:broth., @@ -333997,7 +338523,6 @@ 9:u10:butyl, 9:u13:(s/h), 9:u14:lyst,, -8:uI2:(/)-, 9:u01:butyl, 9:u04:(S/H), 9:u05:lyst,, @@ -334011,7 +338536,6 @@ 20:u14:polyacrylamide),, 7:u22:(S/, 8:u23:(S/H, -8:uI1:(/)-, 9:u00:butyl, 9:u03:(S/H), 9:u04:lyst,, @@ -334021,7 +338545,6 @@ 9:u11:(s/h), 9:u12:lyst,, 20:u13:polyacrylamide),, -8:uI0:(/)-, 9:u02:(S/H), 9:u03:lyst,, 20:u04:polyacrylamide),, @@ -334319,17 +338842,14 @@ 15:u14:percritical, 15:u05:percritical, 15:u13:percritical, -9:uI2:[].[], 15:u04:percritical, 8:u08:scCO, 15:u12:percritical, -9:uI1:[].[], 15:u03:percritical, 14:u08:substrate,, 8:u07:scCO, 15:u11:percritical, 11:u14:ethanol, -9:uI0:[].[], 15:u02:percritical, 17:u08:acetophenone,, 8:u06:scCO, @@ -334449,46 +338969,32 @@ 9:u03:ionic, 8:u00:lene, 9:u02:ionic, -10:u08:tivity, 9:u01:ionic, 18:u08:Glutaraldehyde, 9:u00:ionic, -10:u07:tivity, -10:u06:tivity, 18:u07:Glutaraldehyde, -10:u14:tivity, -10:u05:tivity, 18:u06:Glutaraldehyde, 15:u08:quantities., -10:u13:tivity, 18:u14:glutaraldehyde, -10:u04:tivity, 18:u05:Glutaraldehyde, 15:u07:quantities., 15:u08:nitrilases,, -10:u12:tivity, 18:u13:glutaraldehyde, -10:u03:tivity, 18:u04:Glutaraldehyde, 17:u08:cross-linker., 15:u06:quantities., 15:u07:nitrilases,, -10:u11:tivity, 18:u12:glutaraldehyde, 8:u23:Glut, -10:u02:tivity, 18:u03:Glutaraldehyde, 15:u05:quantities., 15:u06:nitrilases,, -10:u10:tivity, 18:u11:glutaraldehyde, -10:u01:tivity, 18:u02:Glutaraldehyde, 17:u07:cross-linker., 15:u04:quantities., 15:u05:nitrilases,, 18:u10:glutaraldehyde, -10:u00:tivity, 18:u01:Glutaraldehyde, 17:u06:cross-linker., 15:u03:quantities., @@ -334764,7 +339270,6 @@ 13:u02:3.1.1.1),, 16:u03:glycosidases, 14:u05:3.4.21.62,, -14:u08:synthesis., 11:u01:cleated, 16:u02:aminoacylase, 13:u10:3.1.1.1),, @@ -334786,7 +339291,6 @@ 13:u00:3.1.1.1),, 16:u01:glycosidases, 14:u03:3.4.21.62,, -14:u07:synthesis., 13:u08:drolyses., 16:u00:aminoacylase, 9:u07:[114], @@ -334794,7 +339298,6 @@ 11:uI0:...,),-, 16:u00:glycosidases, 14:u02:3.4.21.62,, -14:u06:synthesis., 12:u07:tivities, 9:u06:[114], 9:u08:[115], @@ -334802,7 +339305,6 @@ 14:u14:synthesis., 10:uI2:()[][], 14:u01:3.4.21.62,, -14:u05:synthesis., 12:u06:tivities, 13:u07:drolyses., 9:u05:[114], @@ -334811,7 +339313,6 @@ 12:u14:tivities, 10:uI1:()[][], 14:u00:3.4.21.62,, -14:u04:synthesis., 12:u05:tivities, 13:u06:drolyses., 9:u04:[114], @@ -334820,7 +339321,6 @@ 12:u13:tivities, 13:u14:drolyses., 10:uI0:()[][], -14:u03:synthesis., 12:u04:tivities, 13:u05:drolyses., 9:u08:crude, @@ -334829,7 +339329,6 @@ 14:u11:synthesis., 12:u12:tivities, 13:u13:drolyses., -14:u02:synthesis., 12:u03:tivities, 13:u04:drolyses., 10:u08:olytic, @@ -334839,7 +339338,6 @@ 12:u11:tivities, 13:u12:drolyses., 8:u23:drol, -14:u01:synthesis., 12:u02:tivities, 13:u03:drolyses., 9:u07:crude, @@ -334847,7 +339345,6 @@ 9:u03:[115], 12:u10:tivities, 13:u11:drolyses., -14:u00:synthesis., 12:u01:tivities, 13:u02:drolyses., 9:u06:crude, @@ -334994,7 +339491,6 @@ 13:u00:(inositol, 14:u01:Recyclable, 16:u03:(EC1.1.3.4),, -13:u08:catalytic, 19:u00:hexaphosphate)., 13:u03:galactose, 42:u08:(2,2,6,6-tetramethyl-1-piperidinoxyl),, @@ -335011,7 +339507,6 @@ 12:uI0:(...).,,, 16:u01:(EC1.1.3.4),, 9:u06:TEMPO, -13:u07:catalytic, 13:u01:galactose, 42:u06:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u07:aerobic, @@ -335019,7 +339514,6 @@ 9:u14:tempo, 16:u00:(EC1.1.3.4),, 9:u05:TEMPO, -13:u06:catalytic, 13:u00:galactose, 42:u05:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u06:aerobic, @@ -335029,7 +339523,6 @@ 13:u14:catalytic, 13:uI2:(,,,---),, 9:u04:TEMPO, -13:u05:catalytic, 42:u04:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u05:aerobic, 8:u06:16)., @@ -335040,7 +339533,6 @@ 8:u23:TEMP, 13:uI1:(,,,---),, 9:u03:TEMPO, -13:u04:catalytic, 42:u03:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u04:aerobic, 8:u05:16)., @@ -335049,7 +339541,6 @@ 13:u12:catalytic, 13:uI0:(,,,---),, 9:u02:TEMPO, -13:u03:catalytic, 42:u02:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u03:aerobic, 8:u04:16)., @@ -335058,7 +339549,6 @@ 13:u11:catalytic, 11:u14:aerobic, 9:u01:TEMPO, -13:u02:catalytic, 42:u01:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u02:aerobic, 8:u03:16)., @@ -335067,14 +339557,12 @@ 13:u10:catalytic, 11:u13:aerobic, 9:u00:TEMPO, -13:u01:catalytic, 42:u00:(2,2,6,6-tetramethyl-1-piperidinoxyl),, 11:u01:aerobic, 8:u02:16)., 16:u03:hypochlorite, 17:u07:contribution., 11:u12:aerobic, -13:u00:catalytic, 12:u08:enzymes,, 11:u00:aerobic, 8:u01:16)., @@ -335258,8 +339746,6 @@ 8:u01:(Ps., 18:u04:(Biocatalytics, 13:u12:nitrilase, -7:u22:Nit, -8:u23:Nitr, 12:u00:Nirilase, 13:u03:Nitrilase, 14:u06:Penicillin, @@ -335632,7 +340118,6 @@ 12:u05:product., 20:u14:co-precipitation, 20:u05:co-precipitation, -8:u08:lase, 9:u02:waste, 16:u03:unfavourable, 12:u04:product., @@ -335646,55 +340131,42 @@ 20:u12:co-precipitation, 8:u23:co-p, 20:u03:co-precipitation, -8:u07:lase, 9:u00:waste, 16:u01:unfavourable, 12:u02:product., 10:u07:serves, 20:u11:co-precipitation, 20:u02:co-precipitation, -8:u06:lase, 12:u07:hydrogen, 16:u00:unfavourable, 12:u01:product., 10:u06:serves, 20:u10:co-precipitation, -8:u14:lase, 20:u01:co-precipitation, -8:u05:lase, 12:u06:hydrogen, 12:u00:product., 10:u05:serves, -8:u13:lase, 12:u14:hydrogen, 20:u00:co-precipitation, -8:u04:lase, 12:u05:hydrogen, 10:u04:serves, 9:u08:combi, -8:u12:lase, 12:u13:hydrogen, -8:u03:lase, 12:u04:hydrogen, 10:u03:serves, 9:u07:combi, -8:u11:lase, 12:u12:hydrogen, -8:u02:lase, 12:u03:hydrogen, 11:u08:one-pot, 10:u02:serves, 9:u06:combi, 15:u08:Pseudomonas, -8:u10:lase, 12:u11:hydrogen, -8:u01:lase, 12:u02:hydrogen, 10:u01:serves, 9:u05:combi, 15:u07:Pseudomonas, 12:u10:hydrogen, -8:u00:lase, 12:u01:hydrogen, 11:u07:one-pot, 10:u00:serves, @@ -336222,7 +340694,6 @@ 11:u00:reactor, 20:u04:nanofiber-coated, 11:u11:butanol, -8:u23:Carb, 14:u00:corporated, 11:u02:butanol, 10:u03:Carbon, @@ -337122,7 +341593,6 @@ 6:u10:pp, 11:u12:patel),, 11:u14:biocat., -8:u23:Pate, 9:uI0:,(.:., 12:uI1:),,,,.-;, 12:uI2:..,.,..,, @@ -337855,7 +342325,6 @@ 7:u02:87,, 8:u06:[68], 9:u07:dick,, -11:u08:Bioeng., 7:u10:87,, 9:u11:2005,, 8:u12:[67], @@ -337876,7 +342345,6 @@ 7:u00:87,, 8:u04:[68], 9:u05:dick,, -11:u07:Bioeng., 8:u10:[67], 8:u12:[68], 9:u13:dick,, @@ -337886,60 +342354,48 @@ 15:uI2:,....,,;..,, 8:u03:[68], 9:u04:dick,, -11:u06:Bioeng., 8:u07:[69], 8:u08:[70], 8:u11:[68], 9:u12:dick,, -11:u14:bioeng., 8:u23:dick, 18:uI0:[]..,..,..,..-, 15:uI1:,....,,;..,, 14:uI2:..,..,..,., 8:u02:[68], 9:u03:dick,, -11:u05:Bioeng., 8:u06:[69], 17:u08:Bioseparation, 8:u10:[68], 9:u11:dick,, -11:u13:bioeng., 8:u14:[69], 15:uI0:,....,,;..,, 14:uI1:..,..,..,., 8:u01:[68], 9:u02:dick,, -11:u04:Bioeng., 8:u05:[69], 8:u07:[70], 9:u10:dick,, -11:u12:bioeng., 8:u13:[69], -8:u23:Bioe, 14:uI0:..,..,..,., 8:u00:[68], 9:u01:dick,, -11:u03:Bioeng., 8:u04:[69], 8:u06:[70], 17:u07:Bioseparation, 8:u08:[71], -11:u11:bioeng., 8:u12:[69], 8:u14:[70], 7:u22:[69, 8:u23:[69], 9:u00:dick,, -11:u02:Bioeng., 8:u03:[69], 8:u05:[70], 17:u06:Bioseparation, -11:u10:bioeng., 8:u11:[69], 8:u13:[70], 17:u14:bioseparation, 15:uI2:[]..,.,(.),, -11:u01:Bioeng., 8:u02:[69], 8:u04:[70], 17:u05:Bioseparation, @@ -337950,7 +342406,6 @@ 7:u22:[70, 8:u23:[70], 15:uI1:[]..,.,(.),, -11:u00:Bioeng., 8:u01:[69], 8:u03:[70], 17:u04:Bioseparation, @@ -340004,26 +344459,22 @@ 13:u08:mammalian, 13:u01:PS-coated, 8:u07:ITAM, -15:u08:efficiency., 12:u11:effector, 19:u14:phosphorylation, 12:u02:effector, 13:u00:PS-coated, 8:u06:ITAM, -15:u07:efficiency., 12:u10:effector, 19:u13:phosphorylation, 12:u01:effector, 13:u07:mammalian, 23:u08:phosphatidylserine,, 8:u05:ITAM, -15:u06:efficiency., 14:u08:Signaling,, 19:u12:phosphorylation, 12:u00:effector, 13:u06:mammalian, 8:u04:ITAM, -15:u05:efficiency., 14:u07:Signaling,, 15:u08:Drosophila,, 19:u11:phosphorylation, @@ -340031,7 +344482,6 @@ 13:u05:mammalian, 23:u07:phosphatidylserine,, 8:u03:ITAM, -15:u04:efficiency., 14:u06:Signaling,, 15:u07:Drosophila,, 19:u10:phosphorylation, @@ -340039,7 +344489,6 @@ 13:u04:mammalian, 23:u06:phosphatidylserine,, 8:u02:ITAM, -15:u03:efficiency., 14:u05:Signaling,, 15:u06:Drosophila,, 13:u12:mammalian, @@ -340048,7 +344497,6 @@ 23:u05:phosphatidylserine,, 13:u08:promoting, 8:u01:ITAM, -15:u02:efficiency., 14:u04:Signaling,, 15:u05:Drosophila,, 13:u11:mammalian, @@ -340056,7 +344504,6 @@ 13:u02:mammalian, 23:u04:phosphatidylserine,, 8:u00:ITAM, -15:u01:efficiency., 14:u03:Signaling,, 15:u04:Drosophila,, 13:u10:mammalian, @@ -340065,7 +344512,6 @@ 23:u03:phosphatidylserine,, 13:u07:promoting, 10:u08:debris, -15:u00:efficiency., 14:u02:Signaling,, 15:u03:Drosophila,, 12:u08:Horvitz,, @@ -341201,25 +345647,21 @@ 14:u08:segregated, 21:u00:membrane-membrane, 13:u01:Choudhuri, -12:u08:tyrosine, 15:u11:engagement,, 16:u14:phosphatases, 16:u05:phosphatases, 8:u08:tags, 13:u00:Choudhuri, -12:u07:tyrosine, 15:u10:engagement,, 16:u13:phosphatases, 16:u04:phosphatases, 14:u07:segregated, -12:u06:tyrosine, 16:u12:phosphatases, 13:u14:cytosolic, 16:u03:phosphatases, 14:u06:segregated, 8:u07:tags, 11:u08:ligated, -12:u05:tyrosine, 16:u11:phosphatases, 13:u13:cytosolic, 14:u14:segregated, @@ -341228,7 +345670,6 @@ 14:u05:segregated, 8:u06:tags, 14:u08:Ptp69D-GFP, -12:u04:tyrosine, 18:u08:Draper-mCherry, 16:u10:phosphatases, 13:u12:cytosolic, @@ -341239,7 +345680,6 @@ 14:u04:segregated, 8:u05:tags, 11:u07:ligated, -12:u03:tyrosine, 18:u07:Draper-mCherry, 13:u11:cytosolic, 14:u12:segregated, @@ -341251,7 +345691,6 @@ 11:u06:ligated, 14:u07:Ptp69D-GFP, 10:u08:Ptp69D, -12:u02:tyrosine, 18:u06:Draper-mCherry, 13:u10:cytosolic, 14:u11:segregated, @@ -341262,7 +345701,6 @@ 8:u03:tags, 11:u05:ligated, 14:u06:Ptp69D-GFP, -12:u01:tyrosine, 18:u05:Draper-mCherry, 14:u10:segregated, 8:u11:tags, @@ -341273,7 +345711,6 @@ 11:u04:ligated, 14:u05:Ptp69D-GFP, 10:u07:Ptp69D, -12:u00:tyrosine, 18:u04:Draper-mCherry, 16:u08:phosphatase,, 8:u10:tags, @@ -341537,7 +345974,6 @@ 7:u04:Tyr, 15:u02:proficiency, 7:u12:tyr, -7:u22:Tyr, 7:u23:Tyr, 7:u03:Tyr, 15:u01:proficiency, @@ -341972,7 +346408,6 @@ 14:u00:retrograde, 12:u01:outputs,, 20:u03:metallopeptidase, -14:u08:incubation, 10:u02:(drpr), 11:u07:DmCaBP1, 20:u11:metallopeptidase, @@ -341983,31 +346418,23 @@ 11:u06:DmCaBP1, 20:u10:metallopeptidase, 20:u01:metallopeptidase, -14:u07:incubation, 10:u00:(drpr), 11:u05:DmCaBP1, 15:uI2:(.,;.,).,(), 20:u00:metallopeptidase, -14:u06:incubation, 11:u04:DmCaBP1, 15:uI1:(.,;.,).,(), -14:u05:incubation, 11:u03:DmCaBP1, 15:uI0:(.,;.,).,(), -14:u04:incubation, 20:u08:phosphorylation,, 11:u02:DmCaBP1, -14:u03:incubation, 17:u08:cytoskeleton., 11:u01:DmCaBP1, -14:u02:incubation, 20:u07:phosphorylation,, 11:u00:DmCaBP1, -14:u01:incubation, 20:u06:phosphorylation,, 17:u07:cytoskeleton., 20:u14:phosphorylation,, -14:u00:incubation, 20:u05:phosphorylation,, 17:u06:cytoskeleton., 20:u13:phosphorylation,, @@ -342151,8 +346578,6 @@ 13:u14:tyrosines, 13:u13:tyrosines, 13:u12:tyrosines, -7:u22:tyr, -8:u23:tyro, 13:u11:tyrosines, 13:u10:tyrosines, 11:u08:proceed, @@ -343455,7 +347880,6 @@ 14:u11:membranes., 10:u12:lewis,, 7:u13:lck, -12:u14:tyrosine, 14:uI0:.,-.:./..., 31:uI1:,..,,..,,.,,..,,.,,..,,..,., 30:u00:doi:10.1038/emboj.2009.343, @@ -343473,7 +347897,6 @@ 14:u10:membranes., 10:u11:lewis,, 7:u12:lck, -12:u13:tyrosine, 9:u14:2300., 6:u21:Lc, 7:u22:Lck, @@ -343494,7 +347917,6 @@ 9:u08:M.A.,, 10:u10:lewis,, 7:u11:lck, -12:u12:tyrosine, 9:u13:2300., 8:u14:lim,, 11:uI1:--...,-, @@ -343510,7 +347932,6 @@ 12:u06:724-740., 9:u07:M.A.,, 7:u10:lck, -12:u11:tyrosine, 9:u12:2300., 8:u13:lim,, 8:u14:168,, @@ -343528,7 +347949,6 @@ 9:u04:W.A.,, 12:u05:724-740., 9:u06:M.A.,, -12:u10:tyrosine, 9:u11:2300., 8:u12:lim,, 8:u13:168,, @@ -344527,7 +348947,6 @@ 22:u07:FRB-EXT-Draper-INT, 8:u13:int), 8:u14:fkbp, -9:uI2:)-()., 8:u04:INT), 8:u05:FKBP, 7:u03:FRB, @@ -344535,7 +348954,6 @@ 8:u12:int), 8:u13:fkbp, 8:u23:INT), -9:uI1:)-()., 8:u03:INT), 8:u04:FKBP, 7:u02:FRB, @@ -344545,7 +348963,6 @@ 6:u21:FK, 7:u22:FKB, 8:u23:FKBP, -9:uI0:)-()., 8:u02:INT), 8:u03:FKBP, 7:u01:FRB, @@ -344681,19 +349098,16 @@ 19:u05:Draper-∆ITAM., 14:u02:Engulfment, 19:u13:draper-∆itam., -8:uI2:-..-, 19:u04:Draper-∆ITAM., 14:u01:Engulfment, 12:u08:ingested, 19:u12:draper-∆itam., -8:uI1:-..-, 9:uI2:-,'(), 19:u03:Draper-∆ITAM., 14:u00:Engulfment, 12:u07:ingested, 19:u11:draper-∆itam., 10:u14:beads,, -8:uI0:-..-, 9:uI1:-,'(), 19:u02:Draper-∆ITAM., 12:u06:ingested, @@ -344787,7 +349201,6 @@ 13:u03:liposomes, 15:u04:On-liposome, 11:u05:Src42a., -10:u08:buffer, 16:u11:rhodamine-pe, 10:uI2:.--/(), 20:u00:BG505-Shark-tSH2, @@ -344796,7 +349209,6 @@ 13:u02:liposomes, 15:u03:On-liposome, 11:u04:Src42a., -10:u07:buffer, 16:u10:rhodamine-pe, 10:uI1:.--/(), 16:u01:rhodamine-PE, @@ -344805,7 +349217,6 @@ 13:u01:liposomes, 15:u02:On-liposome, 11:u03:Src42a., -10:u06:buffer, 10:uI0:.--/(), 16:u00:rhodamine-PE, 8:u05:PAGE, @@ -344813,32 +349224,26 @@ 13:u00:liposomes, 15:u01:On-liposome, 11:u02:Src42a., -10:u05:buffer, 17:u14:immunoblotted, 8:u04:PAGE, 17:u05:immunoblotted, 15:u00:On-liposome, 11:u01:Src42a., -10:u04:buffer, 17:u13:immunoblotted, 7:u22:PAG, 8:u23:PAGE, 8:u03:PAGE, 17:u04:immunoblotted, 11:u00:Src42a., -10:u03:buffer, 17:u12:immunoblotted, 8:u02:PAGE, 17:u03:immunoblotted, -10:u02:buffer, 17:u11:immunoblotted, 8:u01:PAGE, 17:u02:immunoblotted, -10:u01:buffer, 17:u10:immunoblotted, 8:u00:PAGE, 17:u01:immunoblotted, -10:u00:buffer, 17:u00:immunoblotted, 9:u08:(71),, 9:u07:(71),, @@ -345666,7 +350071,6 @@ 10:u03:stock), 11:u06:higher,, 13:u07:promoter., -15:u08:Preparation, 20:u01:copper-inducible, 18:u05:transfection),, 10:u11:stock), @@ -345684,21 +350088,18 @@ 10:u01:stock), 11:u04:higher,, 13:u05:promoter., -15:u07:Preparation, 18:u03:transfection),, 11:u12:higher,, 13:u13:promoter., 10:u00:stock), 11:u03:higher,, 13:u04:promoter., -15:u06:Preparation, 18:u02:transfection),, 11:u11:higher,, 13:u12:promoter., 15:u14:preparation, 11:u02:higher,, 13:u03:promoter., -15:u05:Preparation, 15:u08:Actinomycin, 18:u01:transfection),, 13:u08:confluent, @@ -345707,7 +350108,6 @@ 15:u13:preparation, 11:u01:higher,, 13:u02:promoter., -15:u04:Preparation, 18:u00:transfection),, 13:u07:confluent, 13:u10:promoter., @@ -345715,13 +350115,11 @@ 8:u23:Prep, 11:u00:higher,, 13:u01:promoter., -15:u03:Preparation, 15:u07:Actinomycin, 13:u06:confluent, 15:u11:preparation, 9:uI2:(;/,), 13:u00:promoter., -15:u02:Preparation, 15:u06:Actinomycin, 11:u08:Corpses, 13:u05:confluent, @@ -345729,14 +350127,12 @@ 15:u10:preparation, 15:u14:actinomycin, 9:uI1:(;/,), -15:u01:Preparation, 15:u05:Actinomycin, 10:u08:washes, 13:u04:confluent, 10:u07:falcon, 15:u13:actinomycin, 9:uI0:(;/,), -15:u00:Preparation, 15:u04:Actinomycin, 11:u07:Corpses, 13:u03:confluent, @@ -346570,7 +350966,6 @@ 12:u12:quenched, 19:u06:trypsinization,, 9:u07:TCEP,, -8:u08:min., 12:u11:quenched, 19:u14:trypsinization,, 19:u05:trypsinization,, @@ -346581,14 +350976,12 @@ 9:u14:tcep,, 19:u04:trypsinization,, 9:u05:TCEP,, -8:u07:min., 8:u07:Urea, 19:u12:trypsinization,, 9:u13:tcep,, 8:u23:tryp, 19:u03:trypsinization,, 9:u04:TCEP,, -8:u06:min., 8:u06:Urea, 19:u11:trypsinization,, 9:u12:tcep,, @@ -346597,7 +350990,6 @@ 8:u23:TCEP, 19:u02:trypsinization,, 9:u03:TCEP,, -8:u05:min., 8:u05:Urea, 7:u08:v/v, 19:u10:trypsinization,, @@ -346605,7 +350997,6 @@ 8:u13:min., 19:u01:trypsinization,, 9:u02:TCEP,, -8:u04:min., 8:u04:Urea, 7:u07:v/v, 9:u10:tcep,, @@ -346613,22 +351004,18 @@ 8:u23:min., 19:u00:trypsinization,, 9:u01:TCEP,, -8:u03:min., 14:u08:Immunoblot, 8:u03:Urea, 7:u06:v/v, 8:u11:min., 9:u00:TCEP,, -8:u02:min., 8:u02:Urea, 7:u05:v/v, 8:u10:min., -8:u01:min., 14:u07:Immunoblot, 12:u08:liposome, 8:u01:Urea, 7:u04:v/v, -8:u00:min., 14:u06:Immunoblot, 8:u00:Urea, 7:u03:v/v, @@ -347171,13 +351558,11 @@ 10:u07:SOURCE, 14:u08:Antibodies, 13:u05:RESOURCES, -11:u14:reagent, 11:u05:REAGENT, 10:u06:SOURCE, 14:u07:IDENTIFIER, 24:u08:Anti-phosphotyrosine, 13:u04:RESOURCES, -11:u13:reagent, 11:u04:REAGENT, 10:u05:SOURCE, 14:u06:IDENTIFIER, @@ -347185,7 +351570,6 @@ 9:u08:Santa, 13:u03:RESOURCES, 10:u08:(pTyr), -11:u12:reagent, 14:u14:identifier, 8:u23:REAG, 11:u03:REAGENT, @@ -347195,7 +351579,6 @@ 24:u07:Anti-phosphotyrosine, 13:u02:RESOURCES, 10:u07:(pTyr), -11:u11:reagent, 14:u13:identifier, 7:u22:SOU, 8:u23:SOUR, @@ -347208,7 +351591,6 @@ 8:u08:PY20, 13:u01:RESOURCES, 10:u06:(pTyr), -11:u10:reagent, 14:u12:identifier, 24:u14:anti-phosphotyrosine, 7:u22:IDE, @@ -353947,7 +358329,6 @@ 13:u08:termining, 19:u03:pharmacokinetic, 8:u04:(TL), -8:u08:drug, 12:u11:stances,, 8:u14:egy., 7:u00:TNF, @@ -353955,7 +358336,6 @@ 8:u05:egy., 19:u02:pharmacokinetic, 8:u03:(TL), -8:u07:drug, 12:u10:stances,, 8:u13:egy., 12:u01:stances,, @@ -353963,7 +358343,6 @@ 13:u07:termining, 19:u01:pharmacokinetic, 8:u02:(TL), -8:u06:drug, 8:u12:egy., 8:u23:egy., 12:u00:stances,, @@ -353972,13 +358351,11 @@ 16:u08:undetectable, 19:u00:pharmacokinetic, 8:u01:(TL), -8:u05:drug, 8:u11:egy., 13:u14:termining, 8:u02:egy., 13:u05:termining, 8:u00:(TL), -8:u04:drug, 12:u08:anti-TNF, 8:u10:egy., 13:u13:termining, @@ -353986,13 +358363,11 @@ 13:u04:termining, 16:u07:undetectable, 12:u08:genicity, -8:u03:drug, 12:u07:anti-TNF, 13:u12:termining, 8:u00:egy., 13:u03:termining, 16:u06:undetectable, -8:u02:drug, 12:u06:anti-TNF, 14:u08:(formation, 13:u11:termining, @@ -354000,7 +358375,6 @@ 13:u02:termining, 16:u05:undetectable, 12:u07:genicity, -8:u01:drug, 12:u05:anti-TNF, 14:u07:(formation, 13:u10:termining, @@ -354008,7 +358382,6 @@ 13:u01:termining, 16:u04:undetectable, 12:u06:genicity, -8:u00:drug, 12:u04:anti-TNF, 14:u06:(formation, 16:u12:undetectable, @@ -355235,7 +359608,6 @@ 14:u12:sequently,, 13:u13:imitating, 11:uI0:.,[-].-, -8:uI2:-'.-, 14:u03:sequently,, 13:u04:imitating, 19:u00:imitation-based, @@ -355244,14 +359616,12 @@ 14:u11:sequently,, 13:u12:imitating, 8:u23:imit, -8:uI1:-'.-, 14:u02:sequently,, 13:u03:imitating, 14:u03:off-patent, 10:u06:Indian, 14:u10:sequently,, 13:u11:imitating, -8:uI0:-'.-, 14:u01:sequently,, 13:u02:imitating, 11:u08:leader", @@ -356456,7 +360826,6 @@ 7:u04:592, 10:u08:97.565, 7:u12:592, -7:u22:592, 7:u23:592, 7:u03:592, 9:u07:0.411, @@ -367370,37 +371739,29 @@ 6:u10:d:, 17:u00:luminescence:, 11:u07:945-953, -8:u08:Jain, 11:u06:945-953, 11:u05:945-953, -8:u07:Jain, 11:u04:945-953, -8:u06:Jain, 8:u08:Lapp, 11:u03:945-953, 8:u14:jain, -8:u05:Jain, 11:u02:945-953, 8:u13:jain, -8:u04:Jain, 8:u07:Lapp, 11:u08:571-575, 11:u01:945-953, 8:u12:jain, 7:u22:Jai, 8:u23:Jain, -8:u03:Jain, 8:u06:Lapp, 10:u08:Markey, 11:u00:945-953, 8:u11:jain, 8:u14:lapp, -8:u02:Jain, 8:u05:Lapp, 11:u07:571-575, 8:u10:jain, 8:u13:lapp, -8:u01:Jain, 8:u04:Lapp, 11:u06:571-575, 10:u07:Markey, @@ -367408,7 +371769,6 @@ 11:u14:571-575, 7:u22:Lap, 8:u23:Lapp, -8:u00:Jain, 8:u03:Lapp, 11:u05:571-575, 10:u06:Markey, @@ -367799,15 +372159,12 @@ 7:u02:(L), 10:u08:Curves, 10:uI1:()()-(, -8:uI2:).,., 8:u00:Band, 7:u01:(L), 10:u07:Curves, 10:uI0:()()-(, -8:uI1:).,., 7:u00:(L), 10:u06:Curves, -8:uI0:).,., 10:u05:Curves, 11:u14:emitted, 10:u04:Curves, @@ -371624,7 +375981,6 @@ 13:u12:morphisme, 9:uI0:.,''-, 12:uI1:(())(),., -7:uI2:'-., 12:u00:σ(B)(u), 13:u03:morphisme, 11:u07:d'abord, @@ -371634,7 +375990,6 @@ 8:u10:tout, 13:u11:morphisme, 12:uI0:(())(),., -7:uI1:'-., 13:u02:morphisme, 11:u06:d'abord, 12:u07:possède, @@ -371643,7 +375998,6 @@ 12:u08:infinie., 13:u10:morphisme, 11:u14:d'abord, -7:uI0:'-., 13:u01:morphisme, 11:u05:d'abord, 12:u06:possède, @@ -377770,7 +382124,6 @@ 9:u06:2202., 11:u07:[Rau07], 9:u03:Henri, -9:u08:Green, 12:u11:versité, 12:u12:[rau06b], 9:u14:2202., @@ -377782,7 +382135,6 @@ 11:u06:[Rau07], 11:u08:[Rau08], 9:u02:Henri, -9:u07:Green, 19:u08:Prépublication, 12:u10:versité, 12:u11:[rau06b], @@ -377794,7 +382146,6 @@ 9:u04:2202., 11:u05:[Rau07], 9:u01:Henri, -9:u06:Green, 19:u07:Prépublication, 12:u10:[rau06b], 9:u12:2202., @@ -377807,7 +382158,6 @@ 11:u04:[Rau07], 11:u07:[Rau08], 9:u00:Henri, -9:u05:Green, 19:u06:Prépublication, 12:u08:Rigidity, 9:u11:2202., @@ -377817,7 +382167,6 @@ 11:u03:[Rau07], 11:u06:[Rau08], 12:u08:[Rau09a], -9:u04:Green, 19:u05:Prépublication, 12:u07:Rigidity, 9:u10:2202., @@ -377826,7 +382175,6 @@ 9:u01:2202., 11:u02:[Rau07], 11:u05:[Rau08], -9:u03:Green, 19:u04:Prépublication, 12:u06:Rigidity, 11:u10:[rau07], @@ -377836,14 +382184,12 @@ 11:u04:[Rau08], 12:u07:[Rau09a], 12:u08:[Rau09b], -9:u02:Green, 19:u03:Prépublication, 12:u05:Rigidity, 11:u12:[rau08], 11:u00:[Rau07], 11:u03:[Rau08], 12:u06:[Rau09a], -9:u01:Green, 19:u02:Prépublication, 12:u04:Rigidity, 11:u11:[rau08], @@ -377851,7 +382197,6 @@ 11:u02:[Rau08], 12:u05:[Rau09a], 12:u07:[Rau09b], -9:u00:Green, 19:u01:Prépublication, 12:u03:Rigidity, 11:u10:[rau08], @@ -387369,30 +391714,25 @@ 23:u00:immunohistochemical, 11:u08:subsets, 21:u08:characterization,, -8:u08:(TH), 21:u07:characterization,, 11:u07:subsets, 21:u06:characterization,, 11:u06:subsets, -8:u07:(TH), 14:u08:periphery., 21:u05:characterization,, 11:u14:subsets, 11:u05:subsets, -8:u06:(TH), 16:u08:physiologies, 21:u04:characterization,, 11:u13:subsets, 8:u14:(th), 11:u04:subsets, -8:u05:(TH), 14:u07:periphery., 14:u08:transduced, 21:u03:characterization,, 11:u12:subsets, 8:u13:(th), 11:u03:subsets, -8:u04:(TH), 14:u06:periphery., 16:u07:physiologies, 21:u02:characterization,, @@ -387402,7 +391742,6 @@ 7:u22:(TH, 8:u23:(TH), 11:u02:subsets, -8:u03:(TH), 14:u05:periphery., 16:u06:physiologies, 14:u07:transduced, @@ -387413,7 +391752,6 @@ 14:u13:periphery., 16:u14:physiologies, 11:u01:subsets, -8:u02:(TH), 14:u04:periphery., 16:u05:physiologies, 14:u06:transduced, @@ -387423,7 +391761,6 @@ 16:u13:physiologies, 14:u14:transduced, 11:u00:subsets, -8:u01:(TH), 14:u03:periphery., 16:u04:physiologies, 14:u05:transduced, @@ -387432,7 +391769,6 @@ 14:u11:periphery., 16:u12:physiologies, 14:u13:transduced, -8:u00:(TH), 14:u02:periphery., 16:u03:physiologies, 14:u04:transduced, @@ -389216,7 +393552,6 @@ 10:uI1:""(),-, 10:uI2:""().,, 6:u06:3L, -6:u08:TH, 15:u03:"regulation, 13:u04:"response, 6:u14:3l, @@ -389233,7 +393568,6 @@ 8:uI1:---(, 6:u04:3L, 8:u06:3C),, -6:u07:TH, 15:u01:"regulation, 13:u02:"response, 6:u12:3l, @@ -389245,7 +393579,6 @@ 8:uI0:---(, 6:u03:3L, 8:u05:3C),, -6:u06:TH, 15:u00:"regulation, 13:u01:"response, 6:u11:3l, @@ -389254,7 +393587,6 @@ 10:uI2:),..,,, 6:u02:3L, 8:u04:3C),, -6:u05:TH, 13:u00:"response, 6:u10:3l, 9:u11:drive, @@ -389264,27 +393596,20 @@ 10:uI1:),..,,, 6:u01:3L, 8:u03:3C),, -6:u04:TH, 9:u10:drive, 8:u11:3c),, 10:u14:plexus, -6:u22:TH, -6:u23:TH, 10:uI0:),..,,, 6:u00:3L, 8:u02:3C),, -6:u03:TH, 8:u10:3c),, 10:u13:plexus, 8:u01:3C),, -6:u02:TH, 10:u12:plexus, 12:u14:neurons,, 8:u00:3C),, -6:u01:TH, 10:u11:plexus, 12:u13:neurons,, -6:u00:TH, 10:u10:plexus, 12:u12:neurons,, 9:uI2:,,,,(, @@ -390780,19 +395105,16 @@ 12:u08:profiles, 14:u06:absorption, 13:u07:(Watanabe, -14:u14:absorption, 14:u05:absorption, 13:u06:(Watanabe, 12:u07:profiles, 13:u08:DeMorrow,, -14:u13:absorption, 13:u14:(watanabe, 14:uI2:(.,),(.,),, 14:u04:absorption, 13:u05:(Watanabe, 12:u06:profiles, 13:u07:DeMorrow,, -14:u12:absorption, 13:u13:(watanabe, 12:u14:profiles, 14:uI1:(.,),(.,),, @@ -390801,7 +395123,6 @@ 13:u04:(Watanabe, 12:u05:profiles, 13:u06:DeMorrow,, -14:u11:absorption, 13:u12:(watanabe, 12:u13:profiles, 8:u23:(Wat, @@ -390811,7 +395132,6 @@ 13:u03:(Watanabe, 12:u04:profiles, 13:u05:DeMorrow,, -14:u10:absorption, 13:u11:(watanabe, 12:u12:profiles, 13:uI0:(.,)(.,),, @@ -391776,7 +396096,6 @@ 26:u12:green=hm3dq-activated,, 14:u13:holm-sidak, 9:u14:(o-r), -8:u23:gree, 16:uI0:()-()-.(-,;,, 14:uI1:-,*.,**.,-, 9:u01:(M-N), @@ -394267,7 +398586,6 @@ 12:u04:Detected, 8:u06:85%,, 14:u07:outputfile, -14:u08:discarded., 15:u01:metagenomic, 6:u07:-c, 9:u08:PSMs), @@ -394295,7 +398613,6 @@ 12:u02:Detected, 8:u04:85%,, 14:u05:outputfile, -14:u07:discarded., 6:u05:-c, 9:u06:PSMs), 15:u07:Cluster-PSM, @@ -394311,7 +398628,6 @@ 12:u01:Detected, 8:u03:85%,, 14:u04:outputfile, -14:u06:discarded., 10:u07:DESeq2, 6:u04:-c, 9:u05:PSMs), @@ -394319,14 +398635,12 @@ 13:u07:(1.25.13), 8:u11:85%,, 14:u12:outputfile, -14:u14:discarded., 12:uI0:,.:"--.-, 11:uI1:-.--".(, 8:uI2:,)-., 12:u00:Detected, 8:u02:85%,, 14:u03:outputfile, -14:u05:discarded., 10:u06:DESeq2, 6:u03:-c, 9:u04:PSMs), @@ -394334,49 +398648,41 @@ 13:u06:(1.25.13), 8:u10:85%,, 14:u11:outputfile, -14:u13:discarded., 10:u14:deseq2, 11:uI0:-.--".(, 8:uI1:,)-., 8:u01:85%,, 14:u02:outputfile, -14:u04:discarded., 10:u05:DESeq2, 6:u02:-c, 9:u03:PSMs), 15:u04:Cluster-PSM, 13:u05:(1.25.13), 14:u10:outputfile, -14:u12:discarded., 10:u13:deseq2, 8:uI0:,)-., 16:uI2:(..)(.,).,(), 8:u00:85%,, 14:u01:outputfile, -14:u03:discarded., 10:u04:DESeq2, 10:u08:sizes., 6:u01:-c, 9:u02:PSMs), 15:u03:Cluster-PSM, 13:u04:(1.25.13), -14:u11:discarded., 10:u12:deseq2, 7:u22:DES, 8:u23:DESe, 16:uI1:(..)(.,).,(), 14:u00:outputfile, -14:u02:discarded., 10:u03:DESeq2, 6:u00:-c, 9:u01:PSMs), 15:u02:Cluster-PSM, 13:u03:(1.25.13), -14:u10:discarded., 10:u11:deseq2, 16:uI0:(..)(.,).,(), 8:uI2:'('), -14:u01:discarded., 10:u02:DESeq2, 10:u07:sizes., 9:u00:PSMs), @@ -394384,7 +398690,6 @@ 13:u02:(1.25.13), 10:u10:deseq2, 8:uI1:'('), -14:u00:discarded., 10:u01:DESeq2, 10:u06:sizes., 15:u00:Cluster-PSM, @@ -402367,54 +406672,45 @@ 11:u06:(RCAL),, 11:u04:(FMUON), 20:u05:limited-streamer, -10:u08:angles, 11:u14:(rcal),, 10:uI0:,(/)[], 10:uI1:()[]./, 11:u05:(RCAL),, 11:u03:(FMUON), 20:u04:limited-streamer, -10:u07:angles, 9:u08:FMUON, 11:u13:(rcal),, 10:uI0:()[]./, 11:u04:(RCAL),, 11:u02:(FMUON), 20:u03:limited-streamer, -10:u06:angles, 9:u07:FMUON, 11:u12:(rcal),, 8:u23:(RCA, 11:u03:(RCAL),, 11:u01:(FMUON), 20:u02:limited-streamer, -10:u05:angles, 9:u06:FMUON, 11:u11:(rcal),, 18:uI2:••••,., 11:u02:(RCAL),, 11:u00:(FMUON), 20:u01:limited-streamer, -10:u04:angles, 9:u05:FMUON, 11:u10:(rcal),, 18:uI1:••••,., 11:u01:(RCAL),, 20:u00:limited-streamer, -10:u03:angles, 9:u04:FMUON, 18:uI0:••••,., 11:uI2:••., 11:u00:(RCAL),, 13:u08:portional, -10:u02:angles, 9:u03:FMUON, 11:uI1:••., -10:u01:angles, 9:u02:FMUON, 11:uI0:••., 13:u07:portional, -10:u00:angles, 9:u01:FMUON, 13:u06:portional, 9:u00:FMUON, @@ -414128,7 +418424,6 @@ 8:u01:rods, 8:u05:ling, 12:u08:radiated, -15:u08:crystalline, 6:u12:bi, 8:u13:ling, 6:u22:Bi, @@ -414136,21 +418431,18 @@ 8:u00:rods, 8:u04:ling, 9:u08:Graaf, -15:u07:crystalline, 6:u11:bi, 8:u12:ling, 8:u23:ling, 8:u03:ling, 12:u07:radiated, 14:u08:Irradiés., -15:u06:crystalline, 15:u08:accelerator, 6:u10:bi, 8:u11:ling, 8:u02:ling, 12:u06:radiated, 9:u07:Graaf, -15:u05:crystalline, 15:u07:accelerator, 8:u10:ling, 12:u14:radiated, @@ -414158,7 +418450,6 @@ 12:u05:radiated, 9:u06:Graaf, 14:u07:Irradiés., -15:u04:crystalline, 15:u06:accelerator, 11:u08:Frenkel, 12:u13:radiated, @@ -414167,7 +418458,6 @@ 12:u04:radiated, 9:u05:Graaf, 14:u06:Irradiés., -15:u03:crystalline, 15:u05:accelerator, 11:u07:Frenkel, 12:u12:radiated, @@ -414176,7 +418466,6 @@ 12:u03:radiated, 9:u04:Graaf, 14:u05:Irradiés., -15:u02:crystalline, 15:u04:accelerator, 11:u06:Frenkel, 12:u11:radiated, @@ -414186,7 +418475,6 @@ 12:u02:radiated, 9:u03:Graaf, 14:u04:Irradiés., -15:u01:crystalline, 15:u03:accelerator, 11:u05:Frenkel, 12:u10:radiated, @@ -414197,7 +418485,6 @@ 12:u01:radiated, 9:u02:Graaf, 14:u03:Irradiés., -15:u00:crystalline, 15:u02:accelerator, 11:u04:Frenkel, 9:u10:graaf, @@ -416497,44 +420784,30 @@ 13:u00:planning", 11:u01:implied, 12:u02:optimise, -9:u08:green, 12:u10:optimise, 11:u00:implied, 12:u01:optimise, 12:u00:optimise, -9:u07:green, 10:u14:people, -9:u06:green, 10:u13:people, -9:u14:green, -9:u05:green, 13:u08:sustained, 10:u12:people, -9:u13:green, 7:u22:peo, 8:u23:peop, -9:u04:green, 12:u08:setting,, 13:u07:sustained, 9:u08:[71]., 10:u11:people, -9:u12:green, -9:u03:green, 13:u06:sustained, 9:u07:[71]., 10:u10:people, -9:u11:green, -9:u02:green, 12:u07:setting,, 13:u05:sustained, 9:u06:[71]., -9:u10:green, -9:u01:green, 12:u06:setting,, 13:u04:sustained, 9:u05:[71]., 12:u14:setting,, -9:u00:green, 12:u05:setting,, 13:u03:sustained, 9:u04:[71]., @@ -416552,18 +420825,13 @@ 13:u00:sustained, 9:u01:[71]., 12:u10:setting,, -15:u14:investigate, 12:u01:setting,, 9:u00:[71]., -15:u13:investigate, 12:u00:setting,, 17:u07:associations,, -15:u12:investigate, 17:u06:associations,, -15:u11:investigate, 17:u14:associations,, 17:u05:associations,, -15:u10:investigate, 17:u13:associations,, 17:u04:associations,, 17:u12:associations,, @@ -421044,12 +425312,9 @@ 15:u13:transformed, 15:u12:transformed, 15:u11:transformed, -8:uI2:.-.,, 15:u10:transformed, 12:u14:general,, -8:uI1:.-.,, 12:u13:general,, -8:uI0:.-.,, 12:u12:general,, 12:u11:general,, 12:u10:general,, @@ -424166,25 +428431,16 @@ 18:u03:reconstructing, 18:u11:reconstructing, 18:u02:reconstructing, -12:u08:Improved, 18:u10:reconstructing, 18:u01:reconstructing, -12:u07:Improved, 11:u14:graphs,, 18:u00:reconstructing, -12:u06:Improved, 11:u13:graphs,, -12:u05:Improved, 11:u12:graphs,, -12:u04:Improved, 11:u11:graphs,, -12:u03:Improved, 11:u10:graphs,, 17:u08:monotonically, -12:u02:Improved, -12:u01:Improved, 17:u07:monotonically, -12:u00:Improved, 17:u06:monotonically, 17:u14:monotonically, 17:u05:monotonically, @@ -429840,16 +434096,11 @@ 9:u04:[49]., 7:u00:LCH, 9:u03:[49]., -9:u14:[20]., 9:u02:[49]., -9:u13:[20]., 9:u01:[49]., -9:u12:[20]., 9:uI2:-[-],, 9:u00:[49]., -9:u11:[20]., 9:uI1:-[-],, -9:u10:[20]., 9:uI0:-[-],, 12:u08:belongs,, 15:u08:duplication, @@ -431625,7 +435876,6 @@ 13:u08:release),, 13:u11:automated, 6:u13:lc, -8:uI2:.(/), 13:u00:alkylated, 6:u04:LC, 9:u07:03-04, @@ -431638,7 +435888,6 @@ 6:u12:lc, 6:u22:LC, 6:u23:LC, -8:uI1:.(/), 6:u03:LC, 9:u06:03-04, 11:u01:10-step, @@ -431648,7 +435897,6 @@ 10:u07:Dnttip, 6:u11:lc, 9:u14:03-04, -8:uI0:.(/), 6:u02:LC, 9:u05:03-04, 8:u08:FDRs, @@ -432169,7 +436417,6 @@ 12:u04:Confocal, 9:u05:nerve, 8:u05:ring, -8:u08:wild, 13:u11:2(ok3174), 12:u12:confocal, 9:u13:nerve, @@ -432177,7 +436424,6 @@ 12:u03:Confocal, 9:u04:nerve, 8:u04:ring, -8:u07:wild, 13:u10:2(ok3174), 12:u11:confocal, 9:u12:nerve, @@ -432185,7 +436431,6 @@ 12:u02:Confocal, 9:u03:nerve, 8:u03:ring, -8:u06:wild, 12:u10:confocal, 9:u11:nerve, 9:u14:adult, @@ -432194,37 +436439,31 @@ 9:u02:nerve, 17:u08:(FLAG-SAEG-2), 8:u02:ring, -8:u05:wild, 9:u10:nerve, 9:u13:adult, 12:uI2:,-()-()-, 12:u00:Confocal, 9:u01:nerve, 8:u01:ring, -8:u04:wild, 9:u12:adult, 12:uI1:,-()-()-, 9:u00:nerve, 17:u07:(FLAG-SAEG-2), 8:u00:ring, -8:u03:wild, 16:u08:(FLAG-Venus), 9:u11:adult, 12:uI0:,-()-()-, 17:u06:(FLAG-SAEG-2), -8:u02:wild, 16:u07:(FLAG-Venus), 9:u10:adult, 17:u14:(flag-saeg-2), 9:uI2:()---, 17:u05:(FLAG-SAEG-2), -8:u01:wild, 16:u06:(FLAG-Venus), 17:u13:(flag-saeg-2), 9:uI1:()---, 9:uI2:(--)-, 17:u04:(FLAG-SAEG-2), -8:u00:wild, 16:u05:(FLAG-Venus), 17:u12:(flag-saeg-2), 7:u22:(FL, @@ -437161,10 +441400,7 @@ 13:u02:"twist-2", 13:u01:"twist-2", 13:u00:"twist-2", -10:uI2:[]..[], 20:u08:parametrisations, -10:uI1:[]..[], -10:uI0:[]..[], 20:u07:parametrisations, 20:u06:parametrisations, 20:u14:parametrisations, @@ -437595,13 +441831,11 @@ 12:u08:abscissa, 11:u14:(right), 9:uI1:-.,.-, -9:uI2:..-(), 11:u05:(right), 13:u02:averaging, 12:u07:abscissa, 11:u13:(right), 9:uI0:-.,.-, -9:uI1:..-(), 12:uI2:().,...., 11:u04:(right), 10:u08:imises, @@ -437609,7 +441843,6 @@ 12:u06:abscissa, 11:u12:(right), 8:u23:(rig, -9:uI0:..-(), 12:uI1:().,...., 9:uI2:--,.., 11:u03:(right), @@ -440189,7 +444422,6 @@ 10:u12:-chroh, 11:u13:4-cooet, 7:u14:cjh, -6:u21:-C, 7:u22:-CH, 8:u23:-CHR, 8:u00:1886, @@ -442339,7 +446571,6 @@ 10:u08:H-Mg-X, 6:u11:co, 7:u12:c-r, -6:u21:C-, 7:u22:C-R, 7:u23:C-R, 8:u00:"Mg-, @@ -451770,8 +456001,6 @@ 16:u06:-C-CH=CH-C=N, 14:u12:c-c-c-cssn, 16:u14:-c-ch=ch-c=n, -7:u22:C-C, -8:u23:C-C-, 14:u03:C-C-C-CssN, 16:u05:-C-CH=CH-C=N, 6:u07:BH, @@ -451784,7 +456013,6 @@ 14:u10:c-c-c-cssn, 16:u12:-c-ch=ch-c=n, 6:u14:bh, -7:u22:-C-, 8:u23:-C-C, 14:u01:C-C-C-CssN, 16:u03:-C-CH=CH-C=N, @@ -452282,7 +456510,6 @@ 8:u13:sans, 10:u01:CuClJ", 17:u07:spectroscopie, -7:u08:mum, 9:u01:qu'en, 15:u03:concentrée, 8:u04:LiCl, @@ -452300,7 +456527,6 @@ 8:u11:sans, 17:u14:spectroscopie, 17:u05:spectroscopie, -7:u07:mum, 15:u01:concentrée, 8:u02:LiCl, 7:u06:"B", @@ -452308,7 +456534,6 @@ 8:u10:sans, 17:u13:spectroscopie, 17:u04:spectroscopie, -7:u06:mum, 8:u07:1496, 14:u08:molécules, 15:u00:concentrée, @@ -452316,21 +456541,17 @@ 7:u05:"B", 11:u06:indique, 17:u12:spectroscopie, -7:u14:mum, 8:uI2:""'-, 17:u03:spectroscopie, -7:u05:mum, 8:u06:1496, 7:u08:rpe, 8:u00:LiCl, 7:u04:"B", 11:u05:indique, 17:u11:spectroscopie, -7:u13:mum, 8:u14:1496, 8:uI1:""'-, 17:u02:spectroscopie, -7:u04:mum, 8:u05:1496, 14:u07:molécules, 12:u08:diation,, @@ -452338,24 +456559,19 @@ 11:u04:indique, 14:u08:différent, 17:u10:spectroscopie, -7:u12:mum, 8:u13:1496, -7:u23:mum, 8:uI0:""'-, 17:u01:spectroscopie, -7:u03:mum, 8:u04:1496, 14:u06:molécules, 7:u07:rpe, 7:u02:"B", 11:u03:indique, 14:u07:différent, -7:u11:mum, 8:u12:1496, 14:u14:molécules, 8:u23:1496, 17:u00:spectroscopie, -7:u02:mum, 8:u03:1496, 14:u05:molécules, 7:u06:rpe, @@ -452364,11 +456580,9 @@ 7:u01:"B", 11:u02:indique, 14:u06:différent, -7:u10:mum, 8:u11:1496, 14:u13:molécules, 7:u14:rpe, -7:u01:mum, 8:u02:1496, 14:u04:molécules, 7:u05:rpe, @@ -452382,7 +456596,6 @@ 7:u13:rpe, 12:u14:diation,, 9:u23:molé, -7:u00:mum, 8:u01:1496, 14:u03:molécules, 7:u04:rpe, @@ -458022,30 +462235,25 @@ 16:u04:Misalignment, 10:u02:budget, 16:u12:misalignment, -12:u14:particle, 8:u23:Misa, 9:u00:negl., 16:u03:Misalignment, 23:u07:Transverse-momentum, 10:u01:budget, 16:u11:misalignment, -12:u13:particle, 16:u02:Misalignment, 23:u06:Transverse-momentum, 6:u08:4%, 10:u00:budget, 16:u10:misalignment, -12:u12:particle, 23:u14:transverse-momentum, 16:u01:Misalignment, 23:u05:Transverse-momentum, -12:u11:particle, 23:u13:transverse-momentum, 16:u00:Misalignment, 23:u04:Transverse-momentum, 6:u07:4%, 8:u08:4.5%, -12:u10:particle, 23:u12:transverse-momentum, 23:u03:Transverse-momentum, 6:u06:4%, @@ -459393,11 +463601,8 @@ 11:uI2:...,--,, 11:uI1:...,--,, 11:uI0:...,--,, -10:uI2:,,...,, -10:uI1:,,...,, 12:uI2:...,---,, 7:u08:026, -10:uI0:,,...,, 12:uI1:...,---,, 24:u08:arXiv:hep-ph/0610012, 7:u07:026, @@ -459648,20 +463853,17 @@ 12:u03:omission, 9:u04:Chien, 14:u12:shih-cheng, -7:uI2::/:, 9:u00:(will, 14:u03:Shih-Cheng, 12:u02:omission, 9:u03:Chien, 14:u08:regularity, 14:u11:shih-cheng, -7:uI1::/:, 14:u02:Shih-Cheng, 12:u01:omission, 9:u02:Chien, 14:u07:regularity, 14:u10:shih-cheng, -7:uI0::/:, 14:u01:Shih-Cheng, 12:u00:omission, 9:u01:Chien, @@ -464964,7 +469166,6 @@ 9:uI1::(),-, 8:u00:3.1), 9:uI0::(),-, -7:u22:(II, 8:u23:(II), 14:u08:summarized, 14:u07:summarized, @@ -471047,7 +475248,6 @@ 10:u02:NB-55,, 9:u05:NB-55, 9:u13:amine, -8:uI2:-.-,, 11:u00:MCF10A,, 9:u04:amine, 11:u06:(NB-51,, @@ -471055,14 +475255,12 @@ 9:u04:NB-55, 9:u12:amine, 11:u14:(nb-51,, -8:uI1:-.-,, 9:u03:amine, 11:u05:(NB-51,, 10:u00:NB-55,, 9:u03:NB-55, 9:u11:amine, 11:u13:(nb-51,, -8:uI0:-.-,, 14:uI2:(-,,,,),(-, 9:u02:amine, 11:u04:(NB-51,, @@ -471251,7 +475449,6 @@ 12:u13:(foxm1c,, 9:u01:FDI-6, 12:u04:(FOXM1C,, -14:u08:liferative, 10:u04:AURKB,, 9:u05:ATF3,, 12:u12:(foxm1c,, @@ -471263,53 +475460,41 @@ 9:u04:ATF3,, 12:u11:(foxm1c,, 12:u02:(FOXM1C,, -14:u07:liferative, 7:u08:fer, 10:u02:AURKB,, 9:u03:ATF3,, 12:u10:(foxm1c,, 12:u01:(FOXM1C,, -14:u06:liferative, 11:u08:diamine, 10:u01:AURKB,, 9:u02:ATF3,, 13:u08:(tr-FRET), -14:u14:liferative, 12:u00:(FOXM1C,, -14:u05:liferative, 7:u07:fer, 9:u08:NB-72, 10:u00:AURKB,, 9:u01:ATF3,, 13:u07:(tr-FRET), -14:u13:liferative, -14:u04:liferative, 7:u06:fer, 11:u07:diamine, 9:u00:ATF3,, 13:u06:(tr-FRET), -14:u12:liferative, 7:u14:fer, -14:u03:liferative, 7:u05:fer, 11:u06:diamine, 9:u07:NB-72, 13:u05:(tr-FRET), -14:u11:liferative, 7:u13:fer, 11:u14:diamine, -14:u02:liferative, 7:u04:fer, 11:u05:diamine, 9:u06:NB-72, 12:u08:Fl-NB-72, 13:u04:(tr-FRET), -14:u10:liferative, 7:u12:fer, 11:u13:diamine, 9:u14:nb-72, 7:u23:fer, -14:u01:liferative, 7:u03:fer, 11:u04:diamine, 9:u05:NB-72, @@ -471317,7 +475502,6 @@ 7:u11:fer, 11:u12:diamine, 9:u13:nb-72, -14:u00:liferative, 7:u02:fer, 11:u03:diamine, 9:u04:NB-72, @@ -473023,7 +477207,6 @@ 14:u12:subtracted, 17:u13:biotin-foxm1., 8:u23:subt, -8:uI2:-./., 14:u03:subtracted, 17:u04:biotin-FOXM1., 8:u06:IC50, @@ -473032,7 +477215,6 @@ 14:u11:subtracted, 17:u12:biotin-foxm1., 8:u14:ic50, -8:uI1:-./., 8:uI2:-((), 14:u02:subtracted, 17:u03:biotin-FOXM1., @@ -473042,7 +477224,6 @@ 14:u10:subtracted, 17:u11:biotin-foxm1., 8:u13:ic50, -8:uI0:-./., 8:uI1:-((), 17:uI2:()/(/(--));--, 14:u01:subtracted, @@ -473381,37 +477562,30 @@ 10:u08:Trizol, 16:u10:housekeeping, 16:u01:housekeeping, -11:u08:reagent, 16:u00:housekeeping, 10:u07:Trizol, -11:u07:reagent, 19:u08:(ThermoFisher)., 10:u06:Trizol, 13:u08:replicate, -11:u06:reagent, 19:u07:(ThermoFisher)., 10:u14:trizol, 10:u05:Trizol, -11:u05:reagent, 19:u06:(ThermoFisher)., 10:u13:trizol, 10:u04:Trizol, 13:u07:replicate, -11:u04:reagent, 19:u05:(ThermoFisher)., 10:u12:trizol, 8:u23:Triz, 11:uI2:().(.),, 10:u03:Trizol, 13:u06:replicate, -11:u03:reagent, 19:u04:(ThermoFisher)., 10:u11:trizol, 13:u14:replicate, 11:uI1:().(.),, 10:u02:Trizol, 13:u05:replicate, -11:u02:reagent, 19:u03:(ThermoFisher)., 10:u10:trizol, 13:u13:replicate, @@ -473419,12 +477593,10 @@ 10:u01:Trizol, 13:u04:replicate, 12:u08:stranded, -11:u01:reagent, 19:u02:(ThermoFisher)., 13:u12:replicate, 10:u00:Trizol, 13:u03:replicate, -11:u00:reagent, 19:u01:(ThermoFisher)., 13:u11:replicate, 13:u02:replicate, @@ -474833,46 +479005,37 @@ 12:u08:license,, 10:u06:credit, 12:u07:license,, -13:u08:article's, 10:u05:credit, 12:u06:license,, 10:u04:credit, 12:u05:license,, -13:u07:article's, 10:u03:credit, 12:u04:license,, -13:u06:article's, 25:u08:org/licenses/by/4.0/., 10:u02:credit, 12:u03:license,, 13:u14:article's, -13:u05:article's, 10:u01:credit, 12:u02:license,, 13:u13:article's, -13:u04:article's, 25:u07:org/licenses/by/4.0/., 10:u00:credit, 12:u01:license,, 13:u12:article's, -13:u03:article's, 25:u06:org/licenses/by/4.0/., 12:u00:license,, 13:u11:article's, 25:u14:org/licenses/by/4.0/., 10:uI2:.,://., -13:u02:article's, 25:u05:org/licenses/by/4.0/., 13:u10:article's, 25:u13:org/licenses/by/4.0/., 10:uI1:.,://., 10:uI2:///./., -13:u01:article's, 25:u04:org/licenses/by/4.0/., 25:u12:org/licenses/by/4.0/., 10:uI0:.,://., 10:uI1:///./., -13:u00:article's, 25:u03:org/licenses/by/4.0/., 25:u11:org/licenses/by/4.0/., 10:uI0:///./., @@ -476621,13 +480784,11 @@ 8:u05:(QM), 11:u13:chanics, 9:uI1:""""-, -10:uI2:().,,., 11:u04:chanics, 9:u07:QTAIM, 8:u04:(QM), 11:u12:chanics, 9:uI0:""""-, -10:uI1:().,,., 11:u03:chanics, 9:u06:QTAIM, 10:u07:pairs,, @@ -476635,7 +480796,6 @@ 8:u03:(QM), 11:u11:chanics, 9:u14:qtaim, -10:uI0:().,,., 9:uI2:(!)"", 11:u02:chanics, 9:u05:QTAIM, @@ -476809,7 +480969,6 @@ 17:u03:applicability, 10:u11:versal, 13:u12:thoughts,, -9:uI2:,../., 11:u00:bazian), 10:u02:versal, 13:u03:thoughts,, @@ -476817,14 +480976,12 @@ 17:u08:correlations,, 10:u10:versal, 13:u11:thoughts,, -9:uI1:,../., 10:uI2:,[][]-, 10:u01:versal, 13:u02:thoughts,, 17:u01:applicability, 17:u07:correlations,, 13:u10:thoughts,, -9:uI0:,../., 10:uI1:,[][]-, 10:u00:versal, 13:u01:thoughts,, @@ -478829,12 +482986,9 @@ 17:u07:calculations., 11:u00:Causà., 17:u06:calculations., -8:uI2:.../, 15:u08:reactivity,, 17:u05:calculations., -8:uI1:.../, 17:u04:calculations., -8:uI0:.../, 15:u07:reactivity,, 10:u08:Often,, 17:u03:calculations., @@ -484869,34 +489023,25 @@ 15:u10:join/leave,, 15:u01:join/leave,, 15:u00:join/leave,, -12:u08:frequent, -12:u07:frequent, -12:u06:frequent, 10:u08:isting, 12:u14:frequent, -12:u05:frequent, 11:u08:rewalls, 12:u13:frequent, -12:u04:frequent, 10:u07:isting, 11:u07:rewalls, 12:u12:frequent, -12:u03:frequent, 10:u06:isting, 11:u06:rewalls, 12:u11:frequent, 10:u14:isting, -12:u02:frequent, 10:u05:isting, 11:u05:rewalls, 12:u10:frequent, 10:u13:isting, -12:u01:frequent, 10:u04:isting, 11:u04:rewalls, 10:u12:isting, 8:u23:isti, -12:u00:frequent, 10:u03:isting, 11:u03:rewalls, 10:u11:isting, @@ -490412,7 +494557,6 @@ 10:u08:Markus, 12:u07:Putzbach, 9:u14:cd95l, -9:uI2:.,.;., 9:u05:CD95L, 11:u06:William, 13:u07:Elizabeth, @@ -490420,7 +494564,6 @@ 10:u08:Hafner, 9:u13:cd95l, 11:u14:william, -9:uI1:.,.;., 9:u04:CD95L, 11:u05:William, 13:u06:Elizabeth, @@ -490431,7 +494574,6 @@ 11:u13:william, 13:u14:elizabeth, 8:u23:CD95, -9:uI0:.,.;., 13:uI2:,,-,,.,.,, 9:u03:CD95L, 11:u04:William, @@ -493021,7 +497163,6 @@ 12:u07:14504390, 11:u08:Leucine, 11:u13:lzcd95l, -8:u23:reag, 11:u04:LzCD95L, 12:u06:14504390, 10:u08:zipper, @@ -493412,28 +497553,23 @@ 9:u05:#D399, 7:u06:Dye, 9:u13:#d399, -7:u14:dye, 16:u00:Thermofisher, 9:u04:#D399, 7:u05:Dye, 9:u12:#d399, -7:u13:dye, 6:u21:#D, 7:u22:#D3, 8:u23:#D39, 9:u03:#D399, 7:u04:Dye, 9:u11:#d399, -7:u12:dye, 7:u22:Dye, 7:u23:Dye, 9:u02:#D399, 7:u03:Dye, 9:u10:#d399, -7:u11:dye, 9:u01:#D399, 7:u02:Dye, -7:u10:dye, 9:u00:#D399, 7:u01:Dye, 12:u14:zvad-fmk, @@ -495119,7 +499255,6 @@ 8:u05:0005, 16:u12:l-004639-00-, 8:u13:0005, -6:u21:L-, 7:u22:L-0, 8:u23:L-00, 9:u00:siRNA, @@ -498640,7 +502775,6 @@ 12:u06:139-140., 12:u08:272(30),, 37:u06:doi:10.1093/bioinformatics/btp616, -20:u08:Characterization, 10:u10:peter,, 13:u12:robinson,, 12:u14:139-140., @@ -498649,7 +502783,6 @@ 11:u07:(1997)., 9:u08:Suda,, 37:u05:doi:10.1093/bioinformatics/btp616, -20:u07:Characterization, 16:u08:18827-18833., 13:u11:robinson,, 12:u13:139-140., @@ -498659,7 +502792,6 @@ 11:u06:(1997)., 12:u07:272(30),, 37:u04:doi:10.1093/bioinformatics/btp616, -20:u06:Characterization, 16:u07:18827-18833., 13:u10:robinson,, 12:u12:139-140., @@ -498672,7 +502804,6 @@ 9:u07:Suda,, 9:u08:1178., 37:u03:doi:10.1093/bioinformatics/btp616, -20:u05:Characterization, 16:u06:18827-18833., 12:u11:139-140., 11:u13:(1997)., @@ -498686,7 +502817,6 @@ 9:u06:Suda,, 14:u08:Sudarshan,, 37:u02:doi:10.1093/bioinformatics/btp616, -20:u04:Characterization, 16:u05:18827-18833., 12:u10:139-140., 11:u12:(1997)., @@ -498700,7 +502830,6 @@ 9:u05:Suda,, 9:u07:1178., 37:u01:doi:10.1093/bioinformatics/btp616, -20:u03:Characterization, 16:u04:18827-18833., 11:u11:(1997)., 12:u12:272(30),, @@ -498715,7 +502844,6 @@ 9:u06:1178., 14:u07:Sudarshan,, 37:u00:doi:10.1093/bioinformatics/btp616, -20:u02:Characterization, 16:u03:18827-18833., 11:u10:(1997)., 12:u11:272(30),, @@ -498729,7 +502857,6 @@ 9:u03:Suda,, 9:u05:1178., 14:u06:Sudarshan,, -20:u01:Characterization, 16:u02:18827-18833., 12:u10:272(30),, 9:u11:suda,, @@ -498741,7 +502868,6 @@ 9:u02:Suda,, 9:u04:1178., 14:u05:Sudarshan,, -20:u00:Characterization, 16:u01:18827-18833., 9:u10:suda,, 9:u12:1178., @@ -500398,14 +504524,12 @@ 19:u07:inhomogeneities, 12:u05:scenario, 13:u13:bipolaron, -8:u14:[8],, 11:uI1:−[].,, 13:u04:bipolaron, 19:u06:inhomogeneities, 7:u08:uid, 12:u04:scenario, 13:u12:bipolaron, -8:u13:[8],, 19:u14:inhomogeneities, 8:u23:bipo, 11:uI0:−[].,, @@ -500414,16 +504538,13 @@ 19:u05:inhomogeneities, 12:u03:scenario, 13:u11:bipolaron, -8:u12:[8],, 19:u13:inhomogeneities, -8:u23:[8],, 11:uI1:[],-[],, 13:u02:bipolaron, 19:u04:inhomogeneities, 7:u07:uid, 12:u02:scenario, 13:u10:bipolaron, -8:u11:[8],, 19:u12:inhomogeneities, 15:u14:dependence., 8:u23:inho, @@ -500433,7 +504554,6 @@ 7:u06:uid, 14:u08:undermines, 12:u01:scenario, -8:u10:[8],, 19:u11:inhomogeneities, 15:u13:dependence., 7:u14:uid, @@ -500578,30 +504698,24 @@ 19:u01:electrochemical, 22:u00:single-crystalline, 19:u01:crystallisation, -10:u08:silver, 14:u11:conducting, 19:u00:electrochemical, 6:u08:Ba, 19:u00:crystallisation, -10:u07:silver, 14:u10:conducting, 8:u08:rier, -10:u06:silver, 9:u08:1−x, 6:u07:Ba, 11:u08:(N-I-S), -10:u05:silver, 9:u07:1−x, 6:u06:Ba, 8:u07:rier, 9:u08:tacts, -10:u04:silver, 9:u06:1−x, 10:u08:tunnel, 6:u05:Ba, 8:u06:rier, 11:u07:(N-I-S), -10:u03:silver, 9:u05:1−x, 10:u07:tunnel, 8:u14:rier, @@ -500610,7 +504724,6 @@ 11:u06:(N-I-S), 9:u07:tacts, 10:u08:(dI/dV, -10:u02:silver, 9:u04:1−x, 10:u06:tunnel, 19:u08:current-voltage, @@ -500622,7 +504735,6 @@ 8:u04:rier, 11:u05:(N-I-S), 9:u06:tacts, -10:u01:silver, 9:u03:1−x, 10:u05:tunnel, 19:u07:current-voltage, @@ -500635,7 +504747,6 @@ 11:u04:(N-I-S), 9:u05:tacts, 10:u07:(dI/dV, -10:u00:silver, 9:u02:1−x, 10:u04:tunnel, 19:u06:current-voltage, @@ -501521,18 +505632,15 @@ 12:u03:Tinkham,, 7:u08:307, 12:u11:tinkham,, -9:uI2:(-,,,, 11:u00:(1993)., 12:u02:Tinkham,, 7:u07:307, 12:u08:E.Guyon,, 12:u10:tinkham,, -9:uI1:(-,,,, 12:u01:Tinkham,, 7:u06:307, 12:u07:E.Guyon,, 8:u08:138,, -9:uI0:(-,,,, 12:u00:Tinkham,, 7:u05:307, 12:u06:E.Guyon,, @@ -502003,30 +506111,24 @@ 13:u01:annealing, 15:u07:Inductively, 9:u06:paste, -10:u14:silver, 13:u00:annealing, 15:u06:Inductively, 17:u07:stoichiometry, 9:u05:paste, -10:u13:silver, 15:u14:inductively, 15:u05:Inductively, 17:u06:stoichiometry, 9:u04:paste, -10:u12:silver, 15:u13:inductively, 17:u14:stoichiometry, -8:u23:silv, 15:u04:Inductively, 17:u05:stoichiometry, 9:u03:paste, -10:u11:silver, 15:u12:inductively, 17:u13:stoichiometry, 15:u03:Inductively, 17:u04:stoichiometry, 9:u02:paste, -10:u10:silver, 15:u11:inductively, 17:u12:stoichiometry, 9:u14:films, @@ -506322,7 +510424,6 @@ 12:u06:189-194,, 15:u11:maintenance, 13:u13:brodbelt,, -7:u14:25,, 13:u00:Campagna,, 13:u04:Brodbelt,, 13:u07:Okushima,, @@ -506330,7 +510431,6 @@ 12:u08:fentanyl, 15:u10:maintenance, 13:u12:brodbelt,, -7:u13:25,, 8:u23:Brod, 13:u03:Brodbelt,, 13:u06:Okushima,, @@ -506338,22 +510438,18 @@ 12:u04:189-194,, 12:u07:fentanyl, 13:u11:brodbelt,, -7:u12:25,, 13:u14:okushima,, -7:u23:25,, 13:u02:Brodbelt,, 13:u05:Okushima,, 12:u03:189-194,, 12:u06:fentanyl, 13:u10:brodbelt,, -7:u11:25,, 13:u13:okushima,, 13:u01:Brodbelt,, 13:u04:Okushima,, 11:u07:Abbott,, 12:u02:189-194,, 12:u05:fentanyl, -7:u10:25,, 13:u12:okushima,, 8:u23:Okus, 13:u00:Brodbelt,, @@ -507445,7 +511541,6 @@ 11:u10:alberto, 9:u13:4-2-1, 22:u14:alberto@nict.go.jp, -11:uI2:---,,-,, 12:u00:lasercom, 11:u01:Alberto, 9:u02:Space, @@ -507461,7 +511556,6 @@ 9:u14:josé, 7:u22:4-2, 8:u23:4-2-, -11:uI1:---,,-,, 11:u00:Alberto, 9:u01:Space, 9:u03:4-2-1, @@ -507474,7 +511568,6 @@ 9:u11:4-2-1, 22:u12:alberto@nict.go.jp, 9:u13:josé, -11:uI0:---,,-,, 9:u00:Space, 9:u02:4-2-1, 22:u03:alberto@nict.go.jp, @@ -507917,7 +512010,6 @@ 13:u11:cherenkov, 10:u12:cosmic, 13:u14:produced,, -8:u23:cosm, 13:u00:terminals, 10:u03:cosmic, 15:u04:atmospheric, @@ -508470,38 +512562,29 @@ 16:u10:reflectivity, 16:u01:reflectivity, 15:u06:Reflectance, -15:u08:wavelengths, 15:u14:reflectance, 16:u00:reflectivity, 15:u05:Reflectance, 15:u13:reflectance, 15:u04:Reflectance, -15:u07:wavelengths, 15:u12:reflectance, 15:u03:Reflectance, -15:u06:wavelengths, 15:u11:reflectance, 15:u14:wavelengths, 15:u02:Reflectance, -15:u05:wavelengths, 15:u10:reflectance, 15:u13:wavelengths, 15:u01:Reflectance, -15:u04:wavelengths, 15:u12:wavelengths, 15:u00:Reflectance, -15:u03:wavelengths, 11:u08:coating, 15:u11:wavelengths, -15:u02:wavelengths, 14:u08:multilayer, 21:u08:(SiO2+HfO2+SiO2),, 15:u10:wavelengths, -15:u01:wavelengths, 11:u07:coating, 21:u07:(SiO2+HfO2+SiO2),, 11:u08:mirror., -15:u00:wavelengths, 11:u06:coating, 14:u07:multilayer, 21:u06:(SiO2+HfO2+SiO2),, @@ -508915,42 +512998,33 @@ 11:uI0:(,,)(/), 11:u00:angle),, 8:u08:PSF,, -11:u08:avoided, 8:u07:PSF,, 8:u06:PSF,, -11:u07:avoided, 8:u14:psf,, 8:u05:PSF,, -11:u06:avoided, 8:u13:psf,, 11:u14:avoided, 8:u04:PSF,, -11:u05:avoided, 8:u12:psf,, 11:u13:avoided, 7:u22:PSF, 8:u23:PSF,, 8:u03:PSF,, -11:u04:avoided, 14:u08:maximizing, 8:u11:psf,, 11:u12:avoided, 8:u02:PSF,, -11:u03:avoided, 8:u10:psf,, 11:u11:avoided, 8:u01:PSF,, -11:u02:avoided, 14:u07:maximizing, 16:u08:aberrations,, 10:u08:IACTs,, 11:u10:avoided, 8:u00:PSF,, -11:u01:avoided, 14:u06:maximizing, 10:u07:IACTs,, 14:u14:maximizing, -11:u00:avoided, 14:u05:maximizing, 16:u07:aberrations,, 10:u06:IACTs,, @@ -513166,14 +517240,12 @@ 10:u07:Fukuda, 10:u08:Sarrat, 13:uI0:.,.,,.,.,, -13:uI2:..,.,.,.,, 12:u01:Hasegawa, 13:u02:Nakadaira, 13:u03:Sakashita, 10:u06:Fukuda, 10:u07:Sarrat, 11:u08:Idehara, -13:uI1:..,.,.,.,, 15:uI2:..,.,.,.,.,, 12:u00:Hasegawa, 13:u01:Nakadaira, @@ -513182,7 +517254,6 @@ 10:u06:Sarrat, 11:u07:Idehara, 8:u08:Kuno, -13:uI0:..,.,.,.,, 15:uI1:..,.,.,.,.,, 13:u00:Nakadaira, 13:u01:Sakashita, @@ -516414,38 +520485,24 @@ 19:u01:Standardization, 9:u00:tips., 19:u00:Standardization, -10:u08:lative, -10:u07:lative, 11:u08:thogram, -10:u06:lative, -10:u14:lative, 10:uI2:)−,-, -10:u05:lative, 11:u07:thogram, -10:u13:lative, 10:uI1:)−,-, -10:u04:lative, 11:u06:thogram, 9:u08:2-4)., -10:u12:lative, 11:u14:thogram, 10:uI0:)−,-, -10:u03:lative, 11:u05:thogram, 9:u07:2-4)., -10:u11:lative, 11:u13:thogram, -10:u02:lative, 11:u04:thogram, 9:u06:2-4)., -10:u10:lative, 11:u12:thogram, 8:u23:thog, -10:u01:lative, 11:u03:thogram, 9:u05:2-4)., 11:u11:thogram, -10:u00:lative, 11:u02:thogram, 9:u04:2-4)., 11:u10:thogram, @@ -516926,37 +520983,22 @@ 11:u11:deduced, 13:u00:squares)., 11:u10:deduced, -8:u08:leaf, -8:u07:leaf, 11:u08:dotplot, -8:u06:leaf, 11:u07:dotplot, 12:u08:labels.", -8:u14:leaf, -8:u05:leaf, 11:u06:dotplot, 12:u07:labels.", -8:u13:leaf, -8:u04:leaf, 11:u05:dotplot, 12:u06:labels.", -8:u12:leaf, -8:u23:leaf, -8:u03:leaf, 11:u04:dotplot, 12:u05:labels.", -8:u11:leaf, -8:u02:leaf, 11:u03:dotplot, 12:u04:labels.", 11:u08:Absence, -8:u10:leaf, -8:u01:leaf, 13:u08:Jouventin, 11:u02:dotplot, 12:u03:labels.", 11:u07:Absence, -8:u00:leaf, 11:u01:dotplot, 12:u02:labels.", 11:u06:Absence, @@ -522523,8 +526565,6 @@ 9:u02:Carry, 9:u01:Carry, 9:u07:Throw, -7:u22:Wav, -8:u23:Wave, 9:u00:Carry, 9:u06:Throw, 8:u08:Push, @@ -526476,26 +530516,17 @@ 11:u08:Chronic, 15:u03:Chronic-use, 11:u07:Chronic, -14:u08:Analytical, 15:u02:Chronic-use, 11:u06:Chronic, -14:u07:Analytical, 15:u01:Chronic-use, 11:u05:Chronic, -14:u06:Analytical, 15:u00:Chronic-use, 11:u04:Chronic, -14:u05:Analytical, 11:u03:Chronic, -14:u04:Analytical, 11:u02:Chronic, -14:u03:Analytical, 11:u01:Chronic, -14:u02:Analytical, 11:u00:Chronic, -14:u01:Analytical, 20:u08:Sociodemographic, -14:u00:Analytical, 20:u07:Sociodemographic, 20:u06:Sociodemographic, 20:u05:Sociodemographic, @@ -531777,7 +535808,6 @@ 11:uI1:.,,,,-., 9:u02:Audit, 14:u07:Schuurmans, -8:u08:Life, 12:u02:Reports:, 7:u03:Ang, 16:u06:Vonk-Klassen, @@ -531793,7 +535823,6 @@ 14:u14:schuurmans, 9:u00:Audit, 14:u05:Schuurmans, -8:u07:Life, 12:u00:Reports:, 7:u01:Ang, 16:u04:Vonk-Klassen, @@ -531801,45 +535830,38 @@ 13:u08:Danielsen, 14:u13:schuurmans, 14:u04:Schuurmans, -8:u06:Life, 7:u00:Ang, 16:u03:Vonk-Klassen, 7:u04:MJ., 13:u07:Danielsen, 14:u12:schuurmans, 14:u03:Schuurmans, -8:u05:Life, 22:u08:2013;28:1603-1612., 16:u02:Vonk-Klassen, 7:u03:MJ., 13:u06:Danielsen, 14:u11:schuurmans, 14:u02:Schuurmans, -8:u04:Life, 16:u01:Vonk-Klassen, 7:u02:MJ., 13:u05:Danielsen, 14:u10:schuurmans, 14:u01:Schuurmans, -8:u03:Life, 22:u07:2013;28:1603-1612., 29:u08:the-james-lind-alliance/., 16:u00:Vonk-Klassen, 7:u01:MJ., 13:u04:Danielsen, 14:u00:Schuurmans, -8:u02:Life, 22:u06:2013;28:1603-1612., 7:u00:MJ., 13:u03:Danielsen, 22:u14:2013;28:1603-1612., -8:u01:Life, 22:u05:2013;28:1603-1612., 29:u07:the-james-lind-alliance/., 13:u02:Danielsen, 11:u08:Tiernan, 22:u13:2013;28:1603-1612., -8:u00:Life, 22:u04:2013;28:1603-1612., 29:u06:the-james-lind-alliance/., 9:u08:Great, @@ -534397,7 +538419,6 @@ 11:u02:optimum, 17:u12:green-raleigh, 16:u14:consumption,, -8:u23:Gree, 9:u00:plan,, 17:u03:Green-Raleigh, 16:u05:consumption,, @@ -535347,6 +539368,12959 @@ 32:u01:doi:10.1186/1471-2393-13-238, 13:u00:CD001055., 32:u00:doi:10.1186/1471-2393-13-238, +8:u05:1868, +46:u08:https://doi.org/10.1038/s41588-024-01785-9, +12:u06:genetics, +8:u13:1868, +8:u04:1868, +46:u07:https://doi.org/10.1038/s41588-024-01785-9, +12:u05:genetics, +8:u12:1868, +8:u23:1868, +8:u03:1868, +46:u06:https://doi.org/10.1038/s41588-024-01785-9, +12:u04:genetics, +8:u11:1868, +46:u14:https://doi.org/10.1038/s41588-024-01785-9, +8:u02:1868, +46:u05:https://doi.org/10.1038/s41588-024-01785-9, +12:u03:genetics, +12:u08:oncology, +8:u10:1868, +46:u13:https://doi.org/10.1038/s41588-024-01785-9, +8:u01:1868, +46:u04:https://doi.org/10.1038/s41588-024-01785-9, +12:u02:genetics, +12:u07:oncology, +14:u08:Kinnersley, +46:u12:https://doi.org/10.1038/s41588-024-01785-9, +8:u00:1868, +46:u03:https://doi.org/10.1038/s41588-024-01785-9, +10:u08:Costas, +12:u01:genetics, +12:u06:oncology, +14:u07:Kinnersley, +9:u08:Chubb, +46:u11:https://doi.org/10.1038/s41588-024-01785-9, +13:u14:precision, +46:u02:https://doi.org/10.1038/s41588-024-01785-9, +12:u00:genetics, +12:u05:oncology, +14:u06:Kinnersley, +9:u07:Chubb, +15:u08:Mitsopoulos, +46:u10:https://doi.org/10.1038/s41588-024-01785-9, +13:u13:precision, +46:u01:https://doi.org/10.1038/s41588-024-01785-9, +10:u07:Costas, +12:u04:oncology, +14:u05:Kinnersley, +9:u06:Chubb, +15:u07:Mitsopoulos, +13:u12:precision, +17:uI2:,,,,,,,,,,,.,, +46:u00:https://doi.org/10.1038/s41588-024-01785-9, +10:u06:Costas, +12:u03:oncology, +14:u04:Kinnersley, +9:u05:Chubb, +15:u06:Mitsopoulos, +13:u11:precision, +10:u14:costas, +17:uI1:,,,,,,,,,,,.,, +10:u05:Costas, +12:u02:oncology, +14:u03:Kinnersley, +9:u04:Chubb, +15:u05:Mitsopoulos, +9:u08:(WGS), +13:u10:precision, +10:u13:costas, +17:uI0:,,,,,,,,,,,.,, +10:u04:Costas, +10:u08:10,478, +12:u01:oncology, +14:u02:Kinnersley, +9:u03:Chubb, +15:u04:Mitsopoulos, +9:u07:(WGS), +10:u12:costas, +10:u03:Costas, +11:u08:Genomes, +12:u00:oncology, +14:u01:Kinnersley, +9:u02:Chubb, +15:u03:Mitsopoulos, +9:u06:(WGS), +10:u11:costas, +7:u22:Tum, +8:u23:Tumo, +10:u02:Costas, +10:u07:10,478, +14:u00:Kinnersley, +9:u01:Chubb, +15:u02:Mitsopoulos, +9:u05:(WGS), +12:u08:Project., +10:u10:costas, +10:u01:Costas, +10:u06:10,478, +11:u07:Genomes, +9:u00:Chubb, +15:u01:Mitsopoulos, +9:u04:(WGS), +12:u07:Project., +10:u14:10,478, +10:u00:Costas, +10:u05:10,478, +11:u06:Genomes, +15:u00:Mitsopoulos, +9:u03:(WGS), +12:u06:Project., +10:u08:harbor, +10:u13:10,478, +11:u14:genomes, +10:u04:10,478, +11:u05:Genomes, +9:u02:(WGS), +12:u05:Project., +10:u07:harbor, +10:u12:10,478, +11:u13:genomes, +10:u03:10,478, +11:u04:Genomes, +9:u01:(WGS), +12:u04:Project., +10:u06:harbor, +10:u11:10,478, +11:u12:genomes, +10:u02:10,478, +11:u03:Genomes, +9:u00:(WGS), +12:u03:Project., +10:u05:harbor, +10:u10:10,478, +11:u11:genomes, +10:u01:10,478, +11:u02:Genomes, +12:u02:Project., +10:u04:harbor, +11:u10:genomes, +10:u00:10,478, +11:u01:Genomes, +12:u01:Project., +10:u03:harbor, +11:u00:Genomes, +13:u08:Precision, +12:u00:Project., +10:u02:harbor, +13:u08:patient's, +10:u01:harbor, +13:u07:Precision, +10:u00:harbor, +13:u06:Precision, +13:u07:patient's, +13:u05:Precision, +13:u06:patient's, +13:u14:patient's, +13:u04:Precision, +13:u05:patient's, +13:u13:patient's, +13:u03:Precision, +13:u04:patient's, +13:u12:patient's, +13:u02:Precision, +13:u03:patient's, +13:u11:patient's, +13:u01:Precision, +13:u02:patient's, +13:u10:patient's, +13:u00:Precision, +13:u01:patient's, +15:u08:molecularly, +13:u00:patient's, +15:u07:molecularly, +15:u06:molecularly, +15:u14:molecularly, +15:u05:molecularly, +15:u13:molecularly, +15:u04:molecularly, +15:u12:molecularly, +15:u03:molecularly, +15:u11:molecularly, +15:u02:molecularly, +15:u10:molecularly, +15:u01:molecularly, +13:u14:histology, +15:u00:molecularly, +12:u08:systemic, +13:u13:histology, +12:u07:systemic, +13:u12:histology, +12:u06:systemic, +13:u11:histology, +16:u08:whole-genome, +12:u05:systemic, +13:u10:histology, +12:u04:systemic, +16:u07:whole-genome, +12:u03:systemic, +16:u06:whole-genome, +12:u02:systemic, +16:u14:whole-genome, +16:u05:whole-genome, +12:u01:systemic, +14:u08:clinically, +16:u13:whole-genome, +16:u04:whole-genome, +12:u00:systemic, +14:u07:clinically, +11:u08:100,000, +16:u12:whole-genome, +16:u03:whole-genome, +14:u06:clinically, +11:u07:100,000, +16:u11:whole-genome, +16:u02:whole-genome, +14:u05:clinically, +11:u06:100,000, +16:u10:whole-genome, +16:u01:whole-genome, +9:u08:Check, +14:u04:clinically, +11:u05:100,000, +16:u00:whole-genome, +14:u03:clinically, +11:u04:100,000, +9:u07:Check, +14:u02:clinically, +11:u03:100,000, +9:u06:Check, +14:u01:clinically, +11:u02:100,000, +9:u14:check, +9:u05:Check, +14:u00:clinically, +11:u01:100,000, +9:u13:check, +9:u04:Check, +11:u00:100,000, +9:u12:check, +8:u23:Chec, +9:u03:Check, +9:u11:check, +9:u02:Check, +9:u10:check, +7:u14:ma,, +15:uI2:,,.,-,,,.,,, +9:u01:Check, +15:u08:Manchester,, +7:u13:ma,, +15:uI1:,,.,-,,,.,,, +16:uI2:,.,,,.-,,,,., +9:u00:Check, +7:u12:ma,, +7:u22:MA,, +7:u23:MA,, +15:uI0:,,.,-,,,.,,, +16:uI1:,.,,,.-,,,,., +15:u07:Manchester,, +8:u08:1869, +7:u11:ma,, +16:uI0:,.,,,.-,,,,., +15:u06:Manchester,, +7:u10:ma,, +15:u14:manchester,, +12:uI2:,,.,,,.,, +15:u05:Manchester,, +8:u07:1869, +15:u13:manchester,, +12:uI1:,,.,,,.,, +17:uI2:,,.:,,.-:.@.., +15:u04:Manchester,, +8:u06:1869, +15:u12:manchester,, +8:u14:1869, +8:u23:Manc, +12:uI0:,,.,,,.,, +17:uI1:,,.:,,.-:.@.., +15:u03:Manchester,, +8:u05:1869, +9:u08:neous, +15:u11:manchester,, +8:u13:1869, +17:uI0:,,.:,,.-:.@.., +15:u02:Manchester,, +8:u04:1869, +12:u08:melanoma, +15:u10:manchester,, +8:u12:1869, +15:u01:Manchester,, +8:u03:1869, +9:u07:neous, +12:u07:melanoma, +8:u11:1869, +15:u00:Manchester,, +8:u02:1869, +9:u06:neous, +12:u06:melanoma, +11:u08:notably, +8:u10:1869, +9:u14:neous, +8:u01:1869, +9:u05:neous, +12:u08:Invasive, +12:u05:melanoma, +11:u07:notably, +9:u13:neous, +8:u00:1869, +9:u04:neous, +12:u04:melanoma, +11:u06:notably, +9:u12:neous, +9:u03:neous, +12:u07:Invasive, +12:u03:melanoma, +11:u05:notably, +9:u11:neous, +9:u02:neous, +12:u06:Invasive, +12:u02:melanoma, +11:u04:notably, +15:u08:background), +9:u10:neous, +12:u14:invasive, +9:u01:neous, +12:u05:Invasive, +12:u01:melanoma, +11:u03:notably, +15:u07:background), +12:u13:invasive, +9:u00:neous, +12:u04:Invasive, +11:u08:powered, +12:u00:melanoma, +11:u02:notably, +15:u06:background), +12:u12:invasive, +8:u23:Inva, +12:u03:Invasive, +15:u08:colorectal,, +11:u01:notably, +15:u05:background), +12:u11:invasive, +7:uI2:)(., +12:u02:Invasive, +11:u07:powered, +11:u00:notably, +15:u04:background), +14:u08:esophageal, +12:u10:invasive, +7:uI1:)(., +12:u01:Invasive, +11:u06:powered, +15:u07:colorectal,, +15:u03:background), +14:u07:esophageal, +16:u08:transitional, +11:u14:powered, +7:uI0:)(., +12:u00:Invasive, +11:u05:powered, +15:u06:colorectal,, +12:u08:Spectrum, +15:u02:background), +14:u06:esophageal, +16:u07:transitional, +11:u08:tenfold, +11:u13:powered, +15:u14:colorectal,, +11:u04:powered, +15:u05:colorectal,, +10:u08:Across, +15:u01:background), +14:u05:esophageal, +16:u06:transitional, +11:u07:tenfold, +11:u12:powered, +15:u13:colorectal,, +11:u03:powered, +15:u04:colorectal,, +12:u07:Spectrum, +15:u00:background), +14:u04:esophageal, +16:u05:transitional, +11:u06:tenfold, +11:u11:powered, +15:u12:colorectal,, +11:u02:powered, +15:u03:colorectal,, +12:u06:Spectrum, +10:u07:Across, +14:u03:esophageal, +16:u04:transitional, +11:u05:tenfold, +11:u10:powered, +15:u11:colorectal,, +11:u01:powered, +15:u02:colorectal,, +12:u05:Spectrum, +14:u02:esophageal, +16:u03:transitional, +11:u04:tenfold, +15:u10:colorectal,, +11:u00:powered, +15:u01:colorectal,, +12:u04:Spectrum, +9:u08:(NHS), +14:u01:esophageal, +16:u02:transitional, +11:u03:tenfold, +15:u00:colorectal,, +12:u03:Spectrum, +14:u00:esophageal, +16:u01:transitional, +11:u02:tenfold, +12:u02:Spectrum, +9:u07:(NHS), +16:u00:transitional, +11:u01:tenfold, +12:u01:Spectrum, +9:u06:(NHS), +11:u00:tenfold, +9:u14:(nhs), +12:u00:Spectrum, +9:u05:(NHS), +9:u13:(nhs), +9:u04:(NHS), +9:u12:(nhs), +7:u22:(NH, +8:u23:(NHS, +9:u03:(NHS), +16:u08:chemogenomic, +9:u11:(nhs), +9:u02:(NHS), +9:u10:(nhs), +9:u01:(NHS), +16:u07:chemogenomic, +9:u00:(NHS), +16:u06:chemogenomic, +16:u14:chemogenomic, +16:u05:chemogenomic, +6:u08:1b, +16:u13:chemogenomic, +16:u04:chemogenomic, +6:u07:1b, +16:u12:chemogenomic, +16:u03:chemogenomic, +6:u06:1b, +16:u11:chemogenomic, +16:u02:chemogenomic, +13:u08:(Extended, +6:u05:1b, +10:u08:kidney, +16:u10:chemogenomic, +16:u01:chemogenomic, +6:u04:1b, +10:u07:kidney, +16:u00:chemogenomic, +13:u07:(Extended, +6:u03:1b, +10:u06:kidney, +13:u06:(Extended, +6:u02:1b, +10:u05:kidney, +13:u14:(extended, +13:u05:(Extended, +6:u01:1b, +10:u04:kidney, +13:u13:(extended, +13:u04:(Extended, +6:u00:1b, +10:u03:kidney, +13:u12:(extended, +7:u22:(Ex, +8:u23:(Ext, +13:u03:(Extended, +10:u02:kidney, +13:u11:(extended, +13:u02:(Extended, +10:u01:kidney, +13:u10:(extended, +13:u01:(Extended, +10:u00:kidney, +13:u00:(Extended, +13:u08:druggable, +13:u07:druggable, +13:u06:druggable, +13:u05:druggable, +13:u04:druggable, +14:u08:Actionable, +13:u03:druggable, +16:u08:tumor-normal, +7:u08:FDA, +13:u02:druggable, +16:u07:tumor-normal, +14:u07:Actionable, +13:u01:druggable, +16:u06:tumor-normal, +14:u06:Actionable, +7:u07:FDA, +16:u08:Multilayered, +13:u00:druggable, +16:u05:tumor-normal, +14:u14:actionable, +14:u05:Actionable, +7:u06:FDA, +16:u04:tumor-normal, +14:u13:actionable, +7:u14:fda, +14:u04:Actionable, +7:u05:FDA, +16:u07:Multilayered, +10:u08:Driver, +16:u03:tumor-normal, +16:u08:druggability, +14:u12:actionable, +7:u13:fda, +14:u03:Actionable, +7:u04:FDA, +16:u06:Multilayered, +16:u02:tumor-normal, +16:u07:druggability, +14:u11:actionable, +7:u12:fda, +16:u14:multilayered, +7:u22:FDA, +7:u23:FDA, +14:u02:Actionable, +7:u03:FDA, +16:u05:Multilayered, +10:u07:Driver, +7:u08:(74, +16:u01:tumor-normal, +16:u06:druggability, +14:u10:actionable, +7:u11:fda, +16:u13:multilayered, +14:u01:Actionable, +7:u02:FDA, +16:u04:Multilayered, +10:u06:Driver, +9:u08:dMMR,, +16:u00:tumor-normal, +16:u05:druggability, +7:u10:fda, +16:u12:multilayered, +14:u00:Actionable, +7:u01:FDA, +16:u03:Multilayered, +10:u05:Driver, +7:u07:(74, +14:u08:Clinically, +16:u04:druggability, +7:u08:HRD, +16:u11:multilayered, +7:u00:FDA, +16:u02:Multilayered, +10:u04:Driver, +7:u06:(74, +9:u07:dMMR,, +19:u08:Breast-DuctalCA, +16:u03:druggability, +7:u07:HRD, +16:u10:multilayered, +7:u14:(74, +16:u01:Multilayered, +10:u03:Driver, +7:u05:(74, +9:u06:dMMR,, +14:u07:Clinically, +16:u08:Kidney-CCRCC, +16:u02:druggability, +7:u06:HRD, +7:u13:(74, +9:u14:dmmr,, +16:u00:Multilayered, +10:u02:Driver, +7:u04:(74, +9:u05:dMMR,, +14:u06:Clinically, +19:u07:Breast-DuctalCA, +16:u08:Lung-AdenoCA, +16:u01:druggability, +7:u05:HRD, +7:u12:(74, +9:u13:dmmr,, +14:u14:clinically, +7:u23:(74, +10:u01:Driver, +7:u03:(74, +9:u04:dMMR,, +14:u05:Clinically, +19:u06:Breast-DuctalCA, +16:u07:Kidney-CCRCC, +18:u08:Uterus-AdenoCA, +16:u00:druggability, +7:u04:HRD, +7:u11:(74, +9:u12:dmmr,, +14:u13:clinically, +19:u14:breast-ductalca, +7:u22:dMM, +8:u23:dMMR, +10:u00:Driver, +7:u02:(74, +9:u03:dMMR,, +14:u04:Clinically, +19:u05:Breast-DuctalCA, +16:u06:Kidney-CCRCC, +16:u07:Lung-AdenoCA, +17:u08:Ovary-AdenoCA, +7:u03:HRD, +7:u10:(74, +9:u11:dmmr,, +14:u12:clinically, +19:u13:breast-ductalca, +16:u14:kidney-ccrcc, +7:u01:(74, +9:u02:dMMR,, +14:u03:Clinically, +19:u04:Breast-DuctalCA, +16:u05:Kidney-CCRCC, +16:u06:Lung-AdenoCA, +18:u07:Uterus-AdenoCA, +12:u08:Lung-SCC, +7:u02:HRD, +9:u10:dmmr,, +14:u11:clinically, +19:u12:breast-ductalca, +16:u13:kidney-ccrcc, +16:u14:lung-adenoca, +8:u23:Brea, +7:u00:(74, +9:u01:dMMR,, +14:u02:Clinically, +19:u03:Breast-DuctalCA, +16:u04:Kidney-CCRCC, +16:u05:Lung-AdenoCA, +18:u06:Uterus-AdenoCA, +17:u07:Ovary-AdenoCA, +17:u08:Prost-AdenoCA, +7:u01:HRD, +14:u10:clinically, +19:u11:breast-ductalca, +16:u12:kidney-ccrcc, +16:u13:lung-adenoca, +18:u14:uterus-adenoca, +8:u23:Kidn, +9:u00:dMMR,, +14:u01:Clinically, +19:u02:Breast-DuctalCA, +16:u03:Kidney-CCRCC, +16:u04:Lung-AdenoCA, +18:u05:Uterus-AdenoCA, +17:u06:Ovary-AdenoCA, +12:u07:Lung-SCC, +20:u08:Breast-LobularCA, +7:u00:HRD, +19:u10:breast-ductalca, +16:u11:kidney-ccrcc, +16:u12:lung-adenoca, +18:u13:uterus-adenoca, +17:u14:ovary-adenoca, +14:u00:Clinically, +19:u01:Breast-DuctalCA, +16:u02:Kidney-CCRCC, +16:u03:Lung-AdenoCA, +18:u04:Uterus-AdenoCA, +17:u05:Ovary-AdenoCA, +12:u06:Lung-SCC, +17:u07:Prost-AdenoCA, +15:u08:Bladder-TCC, +16:u10:kidney-ccrcc, +16:u11:lung-adenoca, +18:u12:uterus-adenoca, +17:u13:ovary-adenoca, +12:u14:lung-scc, +7:u22:Ute, +8:u23:Uter, +19:u00:Breast-DuctalCA, +16:u01:Kidney-CCRCC, +16:u02:Lung-AdenoCA, +18:u03:Uterus-AdenoCA, +17:u04:Ovary-AdenoCA, +12:u05:Lung-SCC, +17:u06:Prost-AdenoCA, +20:u07:Breast-LobularCA, +17:u08:Skin-Melanoma, +16:u10:lung-adenoca, +18:u11:uterus-adenoca, +17:u12:ovary-adenoca, +12:u13:lung-scc, +17:u14:prost-adenoca, +7:u22:Ova, +8:u23:Ovar, +16:u00:Kidney-CCRCC, +16:u01:Lung-AdenoCA, +18:u02:Uterus-AdenoCA, +17:u03:Ovary-AdenoCA, +12:u04:Lung-SCC, +17:u05:Prost-AdenoCA, +20:u06:Breast-LobularCA, +15:u07:Bladder-TCC, +17:u08:CNS-GBM-IDHwt, +18:u10:uterus-adenoca, +17:u11:ovary-adenoca, +12:u12:lung-scc, +17:u13:prost-adenoca, +20:u14:breast-lobularca, +16:u00:Lung-AdenoCA, +18:u01:Uterus-AdenoCA, +17:u02:Ovary-AdenoCA, +12:u03:Lung-SCC, +17:u04:Prost-AdenoCA, +20:u05:Breast-LobularCA, +15:u06:Bladder-TCC, +17:u07:Skin-Melanoma, +16:u08:HeadNeck-SCC, +17:u10:ovary-adenoca, +12:u11:lung-scc, +17:u12:prost-adenoca, +20:u13:breast-lobularca, +15:u14:bladder-tcc, +8:u23:Pros, +18:u00:Uterus-AdenoCA, +17:u01:Ovary-AdenoCA, +12:u02:Lung-SCC, +17:u03:Prost-AdenoCA, +20:u04:Breast-LobularCA, +15:u05:Bladder-TCC, +17:u06:Skin-Melanoma, +17:u07:CNS-GBM-IDHwt, +24:u08:Connective-Myxofibro, +12:u10:lung-scc, +17:u11:prost-adenoca, +20:u12:breast-lobularca, +15:u13:bladder-tcc, +17:u14:skin-melanoma, +17:u00:Ovary-AdenoCA, +12:u01:Lung-SCC, +17:u02:Prost-AdenoCA, +20:u03:Breast-LobularCA, +15:u04:Bladder-TCC, +17:u05:Skin-Melanoma, +17:u06:CNS-GBM-IDHwt, +16:u07:HeadNeck-SCC, +22:u08:Connective-Chondro, +17:u10:prost-adenoca, +20:u11:breast-lobularca, +15:u12:bladder-tcc, +17:u13:skin-melanoma, +17:u14:cns-gbm-idhwt, +12:u00:Lung-SCC, +17:u01:Prost-AdenoCA, +20:u02:Breast-LobularCA, +15:u03:Bladder-TCC, +17:u04:Skin-Melanoma, +17:u05:CNS-GBM-IDHwt, +16:u06:HeadNeck-SCC, +24:u07:Connective-Myxofibro, +23:u08:Connective-Liposarc, +20:u10:breast-lobularca, +15:u11:bladder-tcc, +17:u12:skin-melanoma, +17:u13:cns-gbm-idhwt, +16:u14:headneck-scc, +17:u00:Prost-AdenoCA, +20:u01:Breast-LobularCA, +15:u02:Bladder-TCC, +17:u03:Skin-Melanoma, +17:u04:CNS-GBM-IDHwt, +16:u05:HeadNeck-SCC, +24:u06:Connective-Myxofibro, +22:u07:Connective-Chondro, +15:u08:Kidney-PRCC, +15:u10:bladder-tcc, +17:u11:skin-melanoma, +17:u12:cns-gbm-idhwt, +16:u13:headneck-scc, +24:u14:connective-myxofibro, +7:u22:CNS, +8:u23:CNS-, +20:u00:Breast-LobularCA, +15:u01:Bladder-TCC, +17:u02:Skin-Melanoma, +17:u03:CNS-GBM-IDHwt, +16:u04:HeadNeck-SCC, +24:u05:Connective-Myxofibro, +22:u06:Connective-Chondro, +23:u07:Connective-Liposarc, +22:u08:Connective-Leiomyo, +17:u10:skin-melanoma, +17:u11:cns-gbm-idhwt, +16:u12:headneck-scc, +24:u13:connective-myxofibro, +22:u14:connective-chondro, +15:u00:Bladder-TCC, +17:u01:Skin-Melanoma, +17:u02:CNS-GBM-IDHwt, +16:u03:HeadNeck-SCC, +24:u04:Connective-Myxofibro, +22:u05:Connective-Chondro, +23:u06:Connective-Liposarc, +15:u07:Kidney-PRCC, +17:u10:cns-gbm-idhwt, +16:u11:headneck-scc, +24:u12:connective-myxofibro, +22:u13:connective-chondro, +23:u14:connective-liposarc, +17:u00:Skin-Melanoma, +17:u01:CNS-GBM-IDHwt, +16:u02:HeadNeck-SCC, +24:u03:Connective-Myxofibro, +22:u04:Connective-Chondro, +23:u05:Connective-Liposarc, +15:u06:Kidney-PRCC, +22:u07:Connective-Leiomyo, +16:u08:Panc-AdenoCA, +16:u10:headneck-scc, +24:u11:connective-myxofibro, +22:u12:connective-chondro, +23:u13:connective-liposarc, +15:u14:kidney-prcc, +17:u00:CNS-GBM-IDHwt, +16:u01:HeadNeck-SCC, +24:u02:Connective-Myxofibro, +22:u03:Connective-Chondro, +23:u04:Connective-Liposarc, +15:u05:Kidney-PRCC, +22:u06:Connective-Leiomyo, +15:u08:Eso-AdenoCA, +24:u10:connective-myxofibro, +22:u11:connective-chondro, +23:u12:connective-liposarc, +15:u13:kidney-prcc, +22:u14:connective-leiomyo, +16:u00:HeadNeck-SCC, +24:u01:Connective-Myxofibro, +22:u02:Connective-Chondro, +23:u03:Connective-Liposarc, +15:u04:Kidney-PRCC, +22:u05:Connective-Leiomyo, +16:u07:Panc-AdenoCA, +19:u08:Stomach-AdenoCA, +22:u10:connective-chondro, +23:u11:connective-liposarc, +15:u12:kidney-prcc, +22:u13:connective-leiomyo, +24:u00:Connective-Myxofibro, +22:u01:Connective-Chondro, +23:u02:Connective-Liposarc, +15:u03:Kidney-PRCC, +22:u04:Connective-Leiomyo, +16:u06:Panc-AdenoCA, +15:u07:Eso-AdenoCA, +16:u08:Kidney-ChRCC, +23:u10:connective-liposarc, +15:u11:kidney-prcc, +22:u12:connective-leiomyo, +16:u14:panc-adenoca, +22:u00:Connective-Chondro, +23:u01:Connective-Liposarc, +15:u02:Kidney-PRCC, +22:u03:Connective-Leiomyo, +16:u05:Panc-AdenoCA, +15:u06:Eso-AdenoCA, +19:u07:Stomach-AdenoCA, +18:u08:Connective-SCS, +15:u10:kidney-prcc, +22:u11:connective-leiomyo, +16:u13:panc-adenoca, +15:u14:eso-adenoca, +23:u00:Connective-Liposarc, +15:u01:Kidney-PRCC, +22:u02:Connective-Leiomyo, +16:u04:Panc-AdenoCA, +15:u05:Eso-AdenoCA, +19:u06:Stomach-AdenoCA, +16:u07:Kidney-ChRCC, +13:u08:CNS-Astro, +22:u10:connective-leiomyo, +16:u12:panc-adenoca, +15:u13:eso-adenoca, +19:u14:stomach-adenoca, +15:u00:Kidney-PRCC, +22:u01:Connective-Leiomyo, +16:u03:Panc-AdenoCA, +15:u04:Eso-AdenoCA, +19:u05:Stomach-AdenoCA, +16:u06:Kidney-ChRCC, +18:u07:Connective-SCS, +24:u08:Connective-Osteosarc, +16:u11:panc-adenoca, +15:u12:eso-adenoca, +19:u13:stomach-adenoca, +16:u14:kidney-chrcc, +7:u22:Eso, +8:u23:Eso-, +22:u00:Connective-Leiomyo, +16:u02:Panc-AdenoCA, +15:u03:Eso-AdenoCA, +19:u04:Stomach-AdenoCA, +16:u05:Kidney-ChRCC, +18:u06:Connective-SCS, +13:u07:CNS-Astro, +13:u08:CNS-Menin, +16:u10:panc-adenoca, +15:u11:eso-adenoca, +19:u12:stomach-adenoca, +16:u13:kidney-chrcc, +18:u14:connective-scs, +16:u01:Panc-AdenoCA, +15:u02:Eso-AdenoCA, +19:u03:Stomach-AdenoCA, +16:u04:Kidney-ChRCC, +18:u05:Connective-SCS, +13:u06:CNS-Astro, +24:u07:Connective-Osteosarc, +13:u08:CNS-Oligo, +15:u10:eso-adenoca, +19:u11:stomach-adenoca, +16:u12:kidney-chrcc, +18:u13:connective-scs, +13:u14:cns-astro, +16:u00:Panc-AdenoCA, +15:u01:Eso-AdenoCA, +19:u02:Stomach-AdenoCA, +16:u03:Kidney-ChRCC, +18:u04:Connective-SCS, +13:u05:CNS-Astro, +24:u06:Connective-Osteosarc, +13:u07:CNS-Menin, +14:u08:Testis-GCT, +19:u10:stomach-adenoca, +16:u11:kidney-chrcc, +18:u12:connective-scs, +13:u13:cns-astro, +24:u14:connective-osteosarc, +15:u00:Eso-AdenoCA, +19:u01:Stomach-AdenoCA, +16:u02:Kidney-ChRCC, +18:u03:Connective-SCS, +13:u04:CNS-Astro, +24:u05:Connective-Osteosarc, +13:u06:CNS-Menin, +13:u07:CNS-Oligo, +20:u08:Mes-Mesothelioma, +16:u10:kidney-chrcc, +18:u11:connective-scs, +13:u12:cns-astro, +24:u13:connective-osteosarc, +13:u14:cns-menin, +19:u00:Stomach-AdenoCA, +16:u01:Kidney-ChRCC, +18:u02:Connective-SCS, +13:u03:CNS-Astro, +24:u04:Connective-Osteosarc, +13:u05:CNS-Menin, +13:u06:CNS-Oligo, +14:u07:Testis-GCT, +17:u08:Connective-SS, +18:u10:connective-scs, +13:u11:cns-astro, +24:u12:connective-osteosarc, +13:u13:cns-menin, +13:u14:cns-oligo, +16:u00:Kidney-ChRCC, +18:u01:Connective-SCS, +13:u02:CNS-Astro, +24:u03:Connective-Osteosarc, +13:u04:CNS-Menin, +13:u05:CNS-Oligo, +14:u06:Testis-GCT, +20:u07:Mes-Mesothelioma, +20:u08:BileDuct-AdenoCA, +13:u10:cns-astro, +24:u11:connective-osteosarc, +13:u12:cns-menin, +13:u13:cns-oligo, +14:u14:testis-gct, +18:u00:Connective-SCS, +13:u01:CNS-Astro, +24:u02:Connective-Osteosarc, +13:u03:CNS-Menin, +13:u04:CNS-Oligo, +14:u05:Testis-GCT, +20:u06:Mes-Mesothelioma, +17:u07:Connective-SS, +18:u08:CNS-GBM-IDHmut, +24:u10:connective-osteosarc, +13:u11:cns-menin, +13:u12:cns-oligo, +14:u13:testis-gct, +20:u14:mes-mesothelioma, +13:u00:CNS-Astro, +24:u01:Connective-Osteosarc, +13:u02:CNS-Menin, +13:u03:CNS-Oligo, +14:u04:Testis-GCT, +20:u05:Mes-Mesothelioma, +17:u06:Connective-SS, +20:u07:BileDuct-AdenoCA, +18:u08:Lung-SmaliCell, +13:u10:cns-menin, +13:u11:cns-oligo, +14:u12:testis-gct, +20:u13:mes-mesothelioma, +17:u14:connective-ss, +24:u00:Connective-Osteosarc, +13:u01:CNS-Menin, +13:u02:CNS-Oligo, +14:u03:Testis-GCT, +20:u04:Mes-Mesothelioma, +17:u05:Connective-SS, +20:u06:BileDuct-AdenoCA, +18:u07:CNS-GBM-IDHmut, +18:u08:Lung-LargeCell, +13:u10:cns-oligo, +14:u11:testis-gct, +20:u12:mes-mesothelioma, +17:u13:connective-ss, +20:u14:bileduct-adenoca, +8:u23:Mes-, +13:u00:CNS-Menin, +13:u01:CNS-Oligo, +14:u02:Testis-GCT, +20:u03:Mes-Mesothelioma, +17:u04:Connective-SS, +20:u05:BileDuct-AdenoCA, +18:u06:CNS-GBM-IDHmut, +18:u07:Lung-SmaliCell, +13:u08:Liver-HCC, +14:u10:testis-gct, +20:u11:mes-mesothelioma, +17:u12:connective-ss, +20:u13:bileduct-adenoca, +18:u14:cns-gbm-idhmut, +13:u00:CNS-Oligo, +14:u01:Testis-GCT, +20:u02:Mes-Mesothelioma, +17:u03:Connective-SS, +20:u04:BileDuct-AdenoCA, +18:u05:CNS-GBM-IDHmut, +18:u06:Lung-SmaliCell, +18:u07:Lung-LargeCell, +20:u08:ColoRect-AdenoCA, +20:u10:mes-mesothelioma, +17:u11:connective-ss, +20:u12:bileduct-adenoca, +18:u13:cns-gbm-idhmut, +18:u14:lung-smalicell, +8:u23:Bile, +14:u00:Testis-GCT, +20:u01:Mes-Mesothelioma, +17:u02:Connective-SS, +20:u03:BileDuct-AdenoCA, +18:u04:CNS-GBM-IDHmut, +18:u05:Lung-SmaliCell, +18:u06:Lung-LargeCell, +13:u07:Liver-HCC, +17:u10:connective-ss, +20:u11:bileduct-adenoca, +18:u12:cns-gbm-idhmut, +18:u13:lung-smalicell, +18:u14:lung-largecell, +20:u00:Mes-Mesothelioma, +17:u01:Connective-SS, +20:u02:BileDuct-AdenoCA, +18:u03:CNS-GBM-IDHmut, +18:u04:Lung-SmaliCell, +18:u05:Lung-LargeCell, +13:u06:Liver-HCC, +20:u07:ColoRect-AdenoCA, +20:u10:bileduct-adenoca, +18:u11:cns-gbm-idhmut, +18:u12:lung-smalicell, +18:u13:lung-largecell, +13:u14:liver-hcc, +17:u00:Connective-SS, +20:u01:BileDuct-AdenoCA, +18:u02:CNS-GBM-IDHmut, +18:u03:Lung-SmaliCell, +18:u04:Lung-LargeCell, +13:u05:Liver-HCC, +20:u06:ColoRect-AdenoCA, +18:u10:cns-gbm-idhmut, +18:u11:lung-smalicell, +18:u12:lung-largecell, +13:u13:liver-hcc, +20:u14:colorect-adenoca, +20:u00:BileDuct-AdenoCA, +18:u01:CNS-GBM-IDHmut, +18:u02:Lung-SmaliCell, +18:u03:Lung-LargeCell, +13:u04:Liver-HCC, +20:u05:ColoRect-AdenoCA, +18:u10:lung-smalicell, +18:u11:lung-largecell, +13:u12:liver-hcc, +20:u13:colorect-adenoca, +18:u00:CNS-GBM-IDHmut, +18:u01:Lung-SmaliCell, +18:u02:Lung-LargeCell, +13:u03:Liver-HCC, +20:u04:ColoRect-AdenoCA, +9:u08:2,000, +18:u10:lung-largecell, +13:u11:liver-hcc, +20:u12:colorect-adenoca, +18:u00:Lung-SmaliCell, +18:u01:Lung-LargeCell, +13:u02:Liver-HCC, +20:u03:ColoRect-AdenoCA, +13:u10:liver-hcc, +20:u11:colorect-adenoca, +9:u14:1,000, +18:u00:Lung-LargeCell, +13:u01:Liver-HCC, +20:u02:ColoRect-AdenoCA, +9:u07:2,000, +20:u10:colorect-adenoca, +9:u13:1,000, +13:u00:Liver-HCC, +20:u01:ColoRect-AdenoCA, +9:u06:2,000, +9:u12:1,000, +9:u14:2,000, +8:u23:1,00, +20:u00:ColoRect-AdenoCA, +9:u05:2,000, +12:u08:AdenoCA,, +9:u11:1,000, +9:u13:2,000, +9:u04:2,000, +14:u08:carcinoma;, +9:u10:1,000, +9:u12:2,000, +9:u03:2,000, +12:u07:AdenoCA,, +11:u08:lobular, +20:u08:Breast-DuctalCA,, +9:u11:2,000, +9:u02:2,000, +12:u06:AdenoCA,, +14:u07:carcinoma;, +17:u08:glioblastoma;, +20:u07:Breast-DuctalCA,, +9:u10:2,000, +12:u14:adenoca,, +9:u01:2,000, +12:u05:AdenoCA,, +14:u06:carcinoma;, +11:u07:lobular, +15:u08:meningioma;, +20:u06:Breast-DuctalCA,, +18:u08:CNS-GBM-IDHwt,, +12:u13:adenoca,, +14:u14:carcinoma;, +8:uI2:,;-,, +9:u00:2,000, +12:u04:AdenoCA,, +14:u05:carcinoma;, +11:u06:lobular, +17:u07:glioblastoma;, +20:u05:Breast-DuctalCA,, +18:u07:CNS-GBM-IDHwt,, +14:u08:CNS-Oligo,, +12:u12:adenoca,, +14:u13:carcinoma;, +11:u14:lobular, +8:u23:Aden, +8:uI1:,;-,, +10:uI2:;-,;-,, +12:u03:AdenoCA,, +14:u04:carcinoma;, +11:u05:lobular, +17:u06:glioblastoma;, +15:u07:meningioma;, +19:u08:leiomyosarcoma;, +20:u04:Breast-DuctalCA,, +18:u06:CNS-GBM-IDHwt,, +14:u07:CNS-Oligo,, +23:u08:Connective-Chondro,, +12:u11:adenoca,, +14:u12:carcinoma;, +11:u13:lobular, +17:u14:glioblastoma;, +8:uI0:,;-,, +10:uI1:;-,;-,, +11:uI2:;-,;--,, +12:u02:AdenoCA,, +14:u03:carcinoma;, +11:u04:lobular, +17:u05:glioblastoma;, +15:u06:meningioma;, +21:u08:myxofibrosarcoma;, +20:u03:Breast-DuctalCA,, +18:u05:CNS-GBM-IDHwt,, +14:u06:CNS-Oligo,, +23:u07:Connective-Chondro,, +24:u08:Connective-Liposarc,, +12:u10:adenoca,, +14:u11:carcinoma;, +11:u12:lobular, +17:u13:glioblastoma;, +15:u14:meningioma;, +8:u23:lobu, +10:uI0:;-,;-,, +11:uI1:;-,;--,, +12:uI2:;--,-;-,, +12:u01:AdenoCA,, +14:u02:carcinoma;, +11:u03:lobular, +17:u04:glioblastoma;, +15:u05:meningioma;, +19:u07:leiomyosarcoma;, +8:u08:SCS,, +20:u02:Breast-DuctalCA,, +18:u04:CNS-GBM-IDHwt,, +14:u05:CNS-Oligo,, +23:u06:Connective-Chondro,, +24:u07:Connective-Liposarc,, +25:u08:Connective-Osteosarc,, +14:u10:carcinoma;, +11:u11:lobular, +17:u12:glioblastoma;, +15:u13:meningioma;, +19:u14:adenocarcinoma;, +11:uI0:;-,;--,, +12:uI1:;--,-;-,, +12:u00:AdenoCA,, +14:u01:carcinoma;, +11:u02:lobular, +17:u03:glioblastoma;, +15:u04:meningioma;, +19:u06:leiomyosarcoma;, +21:u07:myxofibrosarcoma;, +20:u01:Breast-DuctalCA,, +18:u03:CNS-GBM-IDHwt,, +14:u04:CNS-Oligo,, +23:u05:Connective-Chondro,, +24:u06:Connective-Liposarc,, +25:u07:Connective-Osteosarc,, +11:u08:spindle, +11:u10:lobular, +17:u11:glioblastoma;, +15:u12:meningioma;, +19:u13:adenocarcinoma;, +19:u14:leiomyosarcoma;, +8:u23:meni, +12:uI0:;--,-;-,, +14:u00:carcinoma;, +11:u01:lobular, +17:u02:glioblastoma;, +15:u03:meningioma;, +19:u05:leiomyosarcoma;, +21:u06:myxofibrosarcoma;, +8:u07:SCS,, +20:u00:Breast-DuctalCA,, +18:u02:CNS-GBM-IDHwt,, +14:u03:CNS-Oligo,, +23:u04:Connective-Chondro,, +24:u05:Connective-Liposarc,, +25:u06:Connective-Osteosarc,, +11:u07:spindle, +17:u10:glioblastoma;, +15:u11:meningioma;, +19:u12:adenocarcinoma;, +19:u13:leiomyosarcoma;, +21:u14:myxofibrosarcoma;, +8:u23:aden, +11:u00:lobular, +17:u01:glioblastoma;, +15:u02:meningioma;, +19:u04:leiomyosarcoma;, +21:u05:myxofibrosarcoma;, +8:u06:SCS,, +15:u08:chromophobe, +18:u01:CNS-GBM-IDHwt,, +14:u02:CNS-Oligo,, +23:u03:Connective-Chondro,, +24:u04:Connective-Liposarc,, +25:u05:Connective-Osteosarc,, +11:u06:spindle, +15:u10:meningioma;, +19:u11:adenocarcinoma;, +19:u12:leiomyosarcoma;, +21:u13:myxofibrosarcoma;, +8:u14:scs,, +7:u22:lei, +8:u23:leio, +9:uI2:;-,;-, +17:u00:glioblastoma;, +15:u01:meningioma;, +19:u03:leiomyosarcoma;, +21:u04:myxofibrosarcoma;, +8:u05:SCS,, +14:u08:Liver-HCC,, +18:u00:CNS-GBM-IDHwt,, +14:u01:CNS-Oligo,, +23:u02:Connective-Chondro,, +24:u03:Connective-Liposarc,, +25:u04:Connective-Osteosarc,, +11:u05:spindle, +19:u10:adenocarcinoma;, +19:u11:leiomyosarcoma;, +21:u12:myxofibrosarcoma;, +8:u13:scs,, +14:u14:esophageal, +7:u22:myx, +8:u23:myxo, +9:uI1:;-,;-, +11:uI2:,;-,;-,, +15:u00:meningioma;, +19:u02:leiomyosarcoma;, +21:u03:myxofibrosarcoma;, +8:u04:SCS,, +15:u07:chromophobe, +19:u08:Lung-LargeCell,, +14:u00:CNS-Oligo,, +23:u01:Connective-Chondro,, +24:u02:Connective-Liposarc,, +25:u03:Connective-Osteosarc,, +11:u04:spindle, +19:u10:leiomyosarcoma;, +21:u11:myxofibrosarcoma;, +8:u12:scs,, +14:u13:esophageal, +7:u22:SCS, +8:u23:SCS,, +9:uI0:;-,;-, +11:uI1:,;-,;-,, +19:u01:leiomyosarcoma;, +21:u02:myxofibrosarcoma;, +8:u03:SCS,, +15:u06:chromophobe, +14:u07:Liver-HCC,, +23:u00:Connective-Chondro,, +24:u01:Connective-Liposarc,, +25:u02:Connective-Osteosarc,, +11:u03:spindle, +21:u10:myxofibrosarcoma;, +8:u11:scs,, +14:u12:esophageal, +15:u14:chromophobe, +7:u22:eso, +8:u23:esop, +11:uI0:,;-,;-,, +19:u00:leiomyosarcoma;, +21:u01:myxofibrosarcoma;, +8:u02:SCS,, +15:u05:chromophobe, +14:u06:Liver-HCC,, +19:u07:Lung-LargeCell,, +17:u08:mesothelioma;, +24:u00:Connective-Liposarc,, +25:u01:Connective-Osteosarc,, +11:u02:spindle, +9:u08:lung;, +8:u10:scs,, +14:u11:esophageal, +15:u13:chromophobe, +14:u14:liver-hcc,, +8:uI2:;-,;, +21:u00:myxofibrosarcoma;, +8:u01:SCS,, +15:u04:chromophobe, +14:u05:Liver-HCC,, +19:u06:Lung-LargeCell,, +14:u08:pancreatic, +25:u00:Connective-Osteosarc,, +11:u01:spindle, +9:u07:lung;, +18:u08:Ovary-AdenoCA,, +14:u10:esophageal, +15:u12:chromophobe, +14:u13:liver-hcc,, +19:u14:lung-largecell,, +8:uI1:;-,;, +10:uI2:-,;-,;, +8:u00:SCS,, +15:u03:chromophobe, +14:u04:Liver-HCC,, +19:u05:Lung-LargeCell,, +17:u07:mesothelioma;, +13:u08:Melanoma,, +11:u00:spindle, +9:u06:lung;, +18:u07:Ovary-AdenoCA,, +15:u11:chromophobe, +14:u12:liver-hcc,, +19:u13:lung-largecell,, +8:uI0:;-,;, +10:uI1:-,;-,;, +9:uI2:-,;-,, +15:u02:chromophobe, +14:u03:Liver-HCC,, +19:u04:Lung-LargeCell,, +17:u06:mesothelioma;, +14:u07:pancreatic, +15:u08:Testis-GCT,, +9:u05:lung;, +18:u06:Ovary-AdenoCA,, +15:u10:chromophobe, +14:u11:liver-hcc,, +19:u12:lung-largecell,, +17:u14:mesothelioma;, +10:uI0:-,;-,;, +9:uI1:-,;-,, +15:u01:chromophobe, +14:u02:Liver-HCC,, +19:u03:Lung-LargeCell,, +17:u05:mesothelioma;, +14:u06:pancreatic, +13:u07:Melanoma,, +19:u08:adenocarcinoma., +9:u04:lung;, +18:u05:Ovary-AdenoCA,, +14:u08:testicular, +14:u10:liver-hcc,, +19:u11:lung-largecell,, +17:u13:mesothelioma;, +9:uI0:-,;-,, +15:u00:chromophobe, +14:u01:Liver-HCC,, +19:u02:Lung-LargeCell,, +17:u04:mesothelioma;, +14:u05:pancreatic, +13:u06:Melanoma,, +15:u07:Testis-GCT,, +9:u03:lung;, +18:u04:Ovary-AdenoCA,, +14:u07:testicular, +19:u10:lung-largecell,, +17:u12:mesothelioma;, +13:u14:melanoma,, +14:u00:Liver-HCC,, +19:u01:Lung-LargeCell,, +17:u03:mesothelioma;, +14:u04:pancreatic, +13:u05:Melanoma,, +15:u06:Testis-GCT,, +19:u07:adenocarcinoma., +8:u08:1870, +9:u02:lung;, +18:u03:Ovary-AdenoCA,, +14:u06:testicular, +17:u11:mesothelioma;, +13:u13:melanoma,, +15:u14:testis-gct,, +8:u23:panc, +9:uI2:,;-,;, +19:u00:Lung-LargeCell,, +17:u02:mesothelioma;, +14:u03:pancreatic, +13:u04:Melanoma,, +15:u05:Testis-GCT,, +19:u06:adenocarcinoma., +9:u01:lung;, +18:u02:Ovary-AdenoCA,, +14:u05:testicular, +17:u10:mesothelioma;, +13:u12:melanoma,, +15:u13:testis-gct,, +19:u14:adenocarcinoma., +9:uI1:,;-,;, +17:u01:mesothelioma;, +14:u02:pancreatic, +13:u03:Melanoma,, +15:u04:Testis-GCT,, +19:u05:adenocarcinoma., +8:u07:1870, +9:u00:lung;, +18:u01:Ovary-AdenoCA,, +14:u04:testicular, +13:u11:melanoma,, +15:u12:testis-gct,, +19:u13:adenocarcinoma., +9:uI0:,;-,;, +17:u00:mesothelioma;, +14:u01:pancreatic, +13:u02:Melanoma,, +15:u03:Testis-GCT,, +19:u04:adenocarcinoma., +8:u06:1870, +18:u00:Ovary-AdenoCA,, +14:u03:testicular, +13:u10:melanoma,, +15:u11:testis-gct,, +19:u12:adenocarcinoma., +8:u14:1870, +14:u00:pancreatic, +13:u01:Melanoma,, +15:u02:Testis-GCT,, +19:u03:adenocarcinoma., +8:u05:1870, +14:u02:testicular, +15:u10:testis-gct,, +19:u11:adenocarcinoma., +8:u13:1870, +13:u00:Melanoma,, +15:u01:Testis-GCT,, +19:u02:adenocarcinoma., +8:u04:1870, +14:u01:testicular, +19:u10:adenocarcinoma., +8:u12:1870, +8:u23:1870, +15:u00:Testis-GCT,, +19:u01:adenocarcinoma., +8:u03:1870, +14:u00:testicular, +8:u11:1870, +19:u00:adenocarcinoma., +8:u02:1870, +13:u08:(COSMIC),, +8:u10:1870, +8:u01:1870, +13:u07:(COSMIC),, +8:u00:1870, +13:u06:(COSMIC),, +13:u05:(COSMIC),, +13:u04:(COSMIC),, +11:u08:drivers, +13:u03:(COSMIC),, +11:u07:drivers, +13:u02:(COSMIC),, +11:u06:drivers, +8:u23:ref., +13:u01:(COSMIC),, +11:u05:drivers, +13:u00:(COSMIC),, +11:u04:drivers, +7:u08:den, +11:u03:drivers, +11:u02:drivers, +7:u07:den, +11:u01:drivers, +7:u06:den, +11:u00:drivers, +7:u14:den, +7:u05:den, +7:u13:den, +8:uI2:('.,, +7:u04:den, +7:u12:den, +7:u23:den, +8:uI1:('.,, +7:u03:den, +7:u08:88%, +7:u11:den, +8:uI0:('.,, +7:u02:den, +7:u08:(65, +7:u10:den, +7:u01:den, +7:u07:88%, +7:u07:(65, +7:u00:den, +7:u06:88%, +9:u08:cers., +7:u06:(65, +7:u14:88%, +7:u05:88%, +7:u05:(65, +7:u13:88%, +7:u04:88%, +9:u07:cers., +14:u08:carcinoma,, +7:u04:(65, +13:u08:cataloged, +7:u12:88%, +7:u22:88%, +7:u23:88%, +7:u03:88%, +9:u06:cers., +7:u03:(65, +13:u07:cataloged, +14:u08:meningioma, +7:u11:88%, +9:u14:cers., +12:uI2:(),()()-, +7:u02:88%, +9:u05:cers., +14:u07:carcinoma,, +7:u02:(65, +13:u06:cataloged, +14:u07:meningioma, +7:u10:88%, +9:u13:cers., +12:uI1:(),()()-, +7:u01:88%, +9:u04:cers., +14:u06:carcinoma,, +12:u08:CNTNAP2,, +7:u01:(65, +13:u05:cataloged, +14:u06:meningioma, +9:u12:cers., +14:u14:carcinoma,, +8:u23:cers, +12:uI0:(),()()-, +7:u00:88%, +9:u03:cers., +14:u05:carcinoma,, +7:u00:(65, +13:u04:cataloged, +14:u05:meningioma, +10:u08:CTNND2, +9:u11:cers., +14:u13:carcinoma,, +9:u02:cers., +14:u04:carcinoma,, +12:u07:CNTNAP2,, +13:u03:cataloged, +14:u04:meningioma, +10:u07:CTNND2, +9:u10:cers., +14:u12:carcinoma,, +9:u01:cers., +14:u03:carcinoma,, +12:u06:CNTNAP2,, +13:u02:cataloged, +14:u03:meningioma, +10:u06:CTNND2, +14:u11:carcinoma,, +12:u14:cntnap2,, +9:u00:cers., +14:u02:carcinoma,, +12:u05:CNTNAP2,, +13:u01:cataloged, +14:u02:meningioma, +10:u05:CTNND2, +14:u10:carcinoma,, +12:u13:cntnap2,, +14:u01:carcinoma,, +12:u04:CNTNAP2,, +15:u08:Eighty-five, +13:u00:cataloged, +14:u01:meningioma, +10:u04:CTNND2, +12:u12:cntnap2,, +7:u22:CNT, +8:u23:CNTN, +14:u00:carcinoma,, +12:u03:CNTNAP2,, +14:u00:meningioma, +10:u03:CTNND2, +12:u11:cntnap2,, +12:u02:CNTNAP2,, +15:u07:Eighty-five, +10:u02:CTNND2, +12:u10:cntnap2,, +12:u01:CNTNAP2,, +15:u06:Eighty-five, +10:u01:CTNND2, +15:u14:eighty-five, +12:u00:CNTNAP2,, +15:u05:Eighty-five, +10:u00:CTNND2, +15:u13:eighty-five, +15:u04:Eighty-five, +15:u12:eighty-five, +15:u03:Eighty-five, +15:u11:eighty-five, +15:u02:Eighty-five, +15:u10:eighty-five, +15:u01:Eighty-five, +15:u00:Eighty-five, +12:u08:clearest, +12:u07:clearest, +16:u08:predominated, +12:u06:clearest, +14:u08:furin-like, +12:u14:clearest, +12:u05:clearest, +16:u07:predominated, +16:u08:glioblastoma, +17:u08:cysteine-rich, +12:u13:clearest, +12:u04:clearest, +16:u06:predominated, +14:u07:furin-like, +10:u08:PIK3CA, +17:u07:cysteine-rich, +12:u12:clearest, +16:u14:predominated, +12:u03:clearest, +16:u05:predominated, +14:u06:furin-like, +16:u07:glioblastoma, +17:u06:cysteine-rich, +12:u11:clearest, +16:u13:predominated, +14:u14:furin-like, +12:u02:clearest, +16:u04:predominated, +14:u05:furin-like, +16:u06:glioblastoma, +10:u07:PIK3CA, +17:u05:cysteine-rich, +12:u10:clearest, +16:u12:predominated, +14:u13:furin-like, +16:u14:glioblastoma, +12:u01:clearest, +16:u03:predominated, +14:u04:furin-like, +16:u05:glioblastoma, +10:u06:PIK3CA, +17:u04:cysteine-rich, +16:u11:predominated, +14:u12:furin-like, +16:u13:glioblastoma, +10:u14:pik3ca, +8:u23:furi, +12:u00:clearest, +16:u02:predominated, +14:u03:furin-like, +16:u04:glioblastoma, +10:u05:PIK3CA, +17:u03:cysteine-rich, +16:u10:predominated, +14:u11:furin-like, +16:u12:glioblastoma, +10:u13:pik3ca, +16:u01:predominated, +14:u02:furin-like, +16:u03:glioblastoma, +10:u04:PIK3CA, +17:u02:cysteine-rich, +14:u10:furin-like, +16:u11:glioblastoma, +10:u12:pik3ca, +7:u22:PIK, +8:u23:PIK3, +16:u00:predominated, +14:u01:furin-like, +16:u02:glioblastoma, +10:u03:PIK3CA, +17:u01:cysteine-rich, +16:u10:glioblastoma, +10:u11:pik3ca, +14:u00:furin-like, +16:u01:glioblastoma, +10:u02:PIK3CA, +12:u08:squamous, +17:u00:cysteine-rich, +10:u10:pik3ca, +16:u00:glioblastoma, +10:u01:PIK3CA, +10:u00:PIK3CA, +12:u07:squamous, +14:u08:activating, +12:u06:squamous, +12:u14:squamous, +12:u05:squamous, +14:u07:activating, +12:u13:squamous, +7:uI2:)(,, +12:u04:squamous, +14:u06:activating, +12:u12:squamous, +14:u14:activating, +7:uI1:)(,, +8:uI2:;.)., +12:u03:squamous, +14:u05:activating, +12:u11:squamous, +14:u13:activating, +7:uI0:)(,, +8:uI1:;.)., +12:u02:squamous, +14:u04:activating, +10:u08:12,606, +12:u10:squamous, +14:u12:activating, +8:uI0:;.)., +12:u01:squamous, +14:u03:activating, +10:u07:12,606, +14:u11:activating, +12:u00:squamous, +14:u02:activating, +10:u06:12,606, +14:u10:activating, +14:u01:activating, +10:u05:12,606, +14:u00:activating, +10:u04:12,606, +10:u03:12,606, +10:u02:12,606, +10:u01:12,606, +10:u00:12,606, +7:u08:VHL, +11:u08:tumors,, +11:u14:arising, +8:u08:TP53, +11:u07:tumors,, +11:u13:arising, +7:u07:VHL, +11:u06:tumors,, +11:u12:arising, +7:u06:VHL, +8:u07:TP53, +10:u08:clonal, +11:u05:tumors,, +11:u11:arising, +7:u14:vhl, +7:u05:VHL, +8:u06:TP53, +11:u04:tumors,, +13:u08:oncogenic, +11:u10:arising, +7:u13:vhl, +8:u14:tp53, +7:u04:VHL, +8:u05:TP53, +10:u07:clonal, +11:u03:tumors,, +13:u07:oncogenic, +7:u12:vhl, +8:u13:tp53, +6:u21:VH, +7:u22:VHL, +7:u23:VHL, +7:u03:VHL, +8:u04:TP53, +10:u06:clonal, +11:u02:tumors,, +13:u06:oncogenic, +7:u11:vhl, +8:u12:tp53, +10:u14:clonal, +6:u21:TP, +7:u22:TP5, +8:u23:TP53, +7:u02:VHL, +8:u03:TP53, +10:u05:clonal, +11:u01:tumors,, +13:u05:oncogenic, +7:u10:vhl, +8:u11:tp53, +10:u13:clonal, +7:u01:VHL, +8:u02:TP53, +10:u04:clonal, +11:u00:tumors,, +13:u04:oncogenic, +11:u08:ARID1A,, +8:u10:tp53, +10:u12:clonal, +7:u00:VHL, +8:u01:TP53, +10:u03:clonal, +13:u03:oncogenic, +11:u07:ARID1A,, +10:u11:clonal, +8:u00:TP53, +10:u02:clonal, +10:u08:(TP53,, +13:u02:oncogenic, +11:u06:ARID1A,, +10:u10:clonal, +10:u01:clonal, +13:u01:oncogenic, +11:u05:ARID1A,, +8:u08:APC,, +8:uI2:,,(., +10:u00:clonal, +10:u07:(TP53,, +13:u00:oncogenic, +11:u04:ARID1A,, +8:u07:APC,, +8:uI1:,,(., +9:uI2:.).,-, +10:u06:(TP53,, +11:u03:ARID1A,, +8:u06:APC,, +10:u14:(tp53,, +8:uI0:,,(., +9:uI1:.).,-, +10:u05:(TP53,, +11:u02:ARID1A,, +8:u05:APC,, +10:u13:(tp53,, +9:uI0:.).,-, +10:u04:(TP53,, +11:u01:ARID1A,, +8:u04:APC,, +10:u12:(tp53,, +7:u22:(TP, +8:u23:(TP5, +10:u03:(TP53,, +9:u08:gioma, +11:u00:ARID1A,, +8:u03:APC,, +10:u11:(tp53,, +10:u02:(TP53,, +8:u02:APC,, +10:u10:(tp53,, +10:u01:(TP53,, +9:u07:gioma, +21:u08:oligodendroglioma, +8:u01:APC,, +10:u00:(TP53,, +9:u06:gioma, +8:u00:APC,, +9:u14:gioma, +9:u05:gioma, +21:u07:oligodendroglioma, +9:u13:gioma, +9:u04:gioma, +21:u06:oligodendroglioma, +9:u12:gioma, +21:u14:oligodendroglioma, +8:u23:giom, +9:u03:gioma, +21:u05:oligodendroglioma, +9:u11:gioma, +21:u13:oligodendroglioma, +9:u02:gioma, +21:u04:oligodendroglioma, +9:u10:gioma, +21:u12:oligodendroglioma, +9:u01:gioma, +21:u03:oligodendroglioma, +21:u11:oligodendroglioma, +9:u00:gioma, +21:u02:oligodendroglioma, +9:u08:(MSK), +21:u10:oligodendroglioma, +21:u01:oligodendroglioma, +21:u00:oligodendroglioma, +9:u07:(MSK), +9:u06:(MSK), +11:u08:parable, +9:u14:(msk), +9:u05:(MSK), +9:u13:(msk), +9:u04:(MSK), +11:u07:parable, +9:u12:(msk), +12:u14:cohorts,, +8:u23:(MSK, +9:u03:(MSK), +11:u06:parable, +9:u11:(msk), +12:u13:cohorts,, +11:u14:parable, +9:u02:(MSK), +11:u05:parable, +9:u10:(msk), +12:u12:cohorts,, +11:u13:parable, +9:u01:(MSK), +11:u04:parable, +12:u11:cohorts,, +11:u12:parable, +9:u00:(MSK), +11:u03:parable, +17:u08:CNS-GBM-Menin, +12:u10:cohorts,, +11:u11:parable, +11:u02:parable, +11:u10:parable, +11:u01:parable, +17:u07:CNS-GBM-Menin, +11:u00:parable, +17:u06:CNS-GBM-Menin, +17:u14:cns-gbm-menin, +17:u05:CNS-GBM-Menin, +17:u13:cns-gbm-menin, +17:u04:CNS-GBM-Menin, +17:u12:cns-gbm-menin, +17:u03:CNS-GBM-Menin, +17:u11:cns-gbm-menin, +17:u02:CNS-GBM-Menin, +17:u10:cns-gbm-menin, +17:u01:CNS-GBM-Menin, +17:u00:CNS-GBM-Menin, +18:u08:Lung-SmallCell, +18:u07:Lung-SmallCell, +18:u06:Lung-SmallCell, +18:u14:lung-smallcell, +18:u05:Lung-SmallCell, +18:u13:lung-smallcell, +18:u04:Lung-SmallCell, +18:u12:lung-smallcell, +18:u03:Lung-SmallCell, +18:u11:lung-smallcell, +18:u02:Lung-SmallCell, +18:u10:lung-smallcell, +18:u01:Lung-SmallCell, +18:u00:Lung-SmallCell, +8:u08:1871, +8:u07:1871, +8:u06:1871, +13:u08:per-tumor, +8:u14:1871, +8:u05:1871, +8:u13:1871, +8:u04:1871, +13:u07:per-tumor, +8:u12:1871, +8:u23:1871, +8:u03:1871, +13:u06:per-tumor, +8:u11:1871, +13:u14:per-tumor, +8:u02:1871, +13:u05:per-tumor, +8:u10:1871, +13:u13:per-tumor, +8:u01:1871, +13:u04:per-tumor, +13:u12:per-tumor, +8:u23:per-, +8:u00:1871, +13:u03:per-tumor, +9:u08:Figs., +13:u11:per-tumor, +13:u02:per-tumor, +9:u08:3-7)., +13:u10:per-tumor, +13:u01:per-tumor, +9:u07:Figs., +9:u07:3-7)., +13:u00:per-tumor, +9:u06:Figs., +9:u06:3-7)., +9:u14:figs., +9:u05:Figs., +17:u08:Actionability, +9:u05:3-7)., +7:u08:>5%, +9:u13:figs., +9:u04:Figs., +9:u04:3-7)., +7:u07:>5%, +9:u12:figs., +8:u23:Figs, +9:u03:Figs., +17:u07:Actionability, +15:u08:alterations, +9:u03:3-7)., +7:u06:>5%, +9:u11:figs., +9:u02:Figs., +17:u06:Actionability, +9:u02:3-7)., +7:u05:>5%, +9:u10:figs., +17:u14:actionability, +9:u01:Figs., +17:u05:Actionability, +15:u07:alterations, +9:u01:3-7)., +7:u04:>5%, +17:u13:actionability, +9:u00:Figs., +17:u04:Actionability, +15:u06:alterations, +9:u00:3-7)., +7:u03:>5%, +17:u12:actionability, +15:u14:alterations, +17:u03:Actionability, +15:u05:alterations, +7:u02:>5%, +17:u11:actionability, +15:u13:alterations, +17:u02:Actionability, +15:u04:alterations, +7:u01:>5%, +17:u10:actionability, +15:u12:alterations, +17:u01:Actionability, +15:u03:alterations, +7:u00:>5%, +15:u11:alterations, +17:u00:Actionability, +15:u02:alterations, +10:u08:(5,805, +15:u10:alterations, +15:u01:alterations, +10:u07:(5,805, +15:u00:alterations, +10:u06:(5,805, +10:u05:(5,805, +10:u04:(5,805, +7:uI2:(.-, +10:u03:(5,805, +7:uI1:(.-, +11:uI2:).,(,,), +10:u02:(5,805, +7:uI0:(.-, +11:uI1:).,(,,), +10:u01:(5,805, +11:uI0:).,(,,), +10:u00:(5,805, +12:uI2:(,),,,,,, +12:uI1:(,),,,,,, +12:uI0:(,),,,,,, +8:u08:cers, +8:u07:cers, +12:u14:missense, +8:u06:cers, +9:u08:(47%), +12:u13:missense, +8:u14:cers, +8:u05:cers, +12:u12:missense, +8:u13:cers, +8:u04:cers, +9:u07:(47%), +14:u08:allosteric, +12:u11:missense, +8:u12:cers, +8:u03:cers, +9:u06:(47%), +14:u07:allosteric, +12:u10:missense, +8:u11:cers, +9:u14:(47%), +8:u02:cers, +9:u05:(47%), +14:u06:allosteric, +14:u08:actionable, +8:u10:cers, +9:u13:(47%), +8:u01:cers, +9:u04:(47%), +9:u08:geted, +14:u05:allosteric, +14:u07:actionable, +9:u12:(47%), +8:u23:(47%, +8:u00:cers, +9:u03:(47%), +7:u08:C>A, +14:u04:allosteric, +14:u06:actionable, +9:u11:(47%), +9:u02:(47%), +9:u07:geted, +7:u08:C>G, +14:u03:allosteric, +14:u05:actionable, +9:u10:(47%), +9:u01:(47%), +9:u06:geted, +7:u07:C>A, +7:u08:C>T, +14:u02:allosteric, +14:u04:actionable, +9:u14:geted, +9:u00:(47%), +9:u05:geted, +7:u06:C>A, +7:u07:C>G, +7:u08:T>A, +14:u01:allosteric, +14:u03:actionable, +9:u13:geted, +7:u14:c>a, +9:u04:geted, +7:u05:C>A, +7:u06:C>G, +7:u07:C>T, +7:u08:T>C, +14:u00:allosteric, +14:u02:actionable, +9:u12:geted, +7:u13:c>a, +7:u14:c>g, +8:u23:gete, +9:u03:geted, +7:u04:C>A, +7:u05:C>G, +7:u06:C>T, +7:u07:T>A, +7:u08:T>G, +14:u01:actionable, +9:u11:geted, +7:u12:c>a, +7:u13:c>g, +7:u14:c>t, +6:u21:C>, +7:u22:C>A, +7:u23:C>A, +9:u02:geted, +7:u03:C>A, +7:u04:C>G, +7:u05:C>T, +7:u06:T>A, +7:u07:T>C, +14:u00:actionable, +9:u10:geted, +7:u11:c>a, +7:u12:c>g, +7:u13:c>t, +7:u14:t>a, +7:u22:C>G, +7:u23:C>G, +9:u01:geted, +7:u02:C>A, +7:u03:C>G, +7:u04:C>T, +7:u05:T>A, +7:u06:T>C, +7:u07:T>G, +8:u08:AKT1, +7:u10:c>a, +7:u11:c>g, +7:u12:c>t, +7:u13:t>a, +7:u14:t>c, +7:u22:C>T, +7:u23:C>T, +9:u00:geted, +7:u01:C>A, +7:u02:C>G, +7:u03:C>T, +7:u04:T>A, +7:u05:T>C, +7:u06:T>G, +7:u10:c>g, +7:u11:c>t, +7:u12:t>a, +7:u13:t>c, +7:u14:t>g, +6:u21:T>, +7:u22:T>A, +7:u23:T>A, +7:u00:C>A, +7:u01:C>G, +7:u02:C>T, +7:u03:T>A, +7:u04:T>C, +7:u05:T>G, +8:u07:AKT1, +7:u10:c>t, +7:u11:t>a, +7:u12:t>c, +7:u13:t>g, +7:u22:T>C, +7:u23:T>C, +7:u00:C>G, +7:u01:C>T, +7:u02:T>A, +7:u03:T>C, +7:u04:T>G, +8:u06:AKT1, +10:u08:ARID1A, +7:u10:t>a, +7:u11:t>c, +7:u12:t>g, +8:u14:akt1, +7:u22:T>G, +7:u23:T>G, +7:u00:C>T, +7:u01:T>A, +7:u02:T>C, +7:u03:T>G, +8:u05:AKT1, +7:u08:ATM, +7:u10:t>c, +7:u11:t>g, +8:u13:akt1, +7:u00:T>A, +7:u01:T>C, +7:u02:T>G, +8:u04:AKT1, +10:u07:ARID1A, +8:u08:ATRX, +7:u10:t>g, +8:u12:akt1, +6:u21:AK, +7:u22:AKT, +8:u23:AKT1, +7:u00:T>C, +7:u01:T>G, +8:u03:AKT1, +10:u06:ARID1A, +7:u07:ATM, +8:u08:BAP1, +8:u11:akt1, +10:u14:arid1a, +7:u00:T>G, +8:u02:AKT1, +10:u05:ARID1A, +7:u06:ATM, +8:u07:ATRX, +8:u08:BRAF, +8:u10:akt1, +10:u13:arid1a, +7:u14:atm, +8:u01:AKT1, +10:u04:ARID1A, +7:u05:ATM, +8:u06:ATRX, +8:u07:BAP1, +10:u08:CDKN2A, +10:u12:arid1a, +7:u13:atm, +8:u14:atrx, +8:u23:ARID, +8:u00:AKT1, +10:u03:ARID1A, +7:u04:ATM, +8:u05:ATRX, +8:u06:BAP1, +8:u07:BRAF, +7:u08:CIC, +10:u11:arid1a, +7:u12:atm, +8:u13:atrx, +8:u14:bap1, +7:u22:ATM, +7:u23:ATM, +10:u02:ARID1A, +7:u03:ATM, +8:u04:ATRX, +8:u05:BAP1, +8:u06:BRAF, +10:u07:CDKN2A, +9:u08:CSMD3, +10:u10:arid1a, +7:u11:atm, +8:u12:atrx, +8:u13:bap1, +8:u14:braf, +7:u22:ATR, +8:u23:ATRX, +10:u01:ARID1A, +7:u02:ATM, +8:u03:ATRX, +8:u04:BAP1, +8:u05:BRAF, +10:u06:CDKN2A, +7:u07:CIC, +10:u08:CTNNB1, +7:u10:atm, +8:u11:atrx, +8:u12:bap1, +8:u13:braf, +10:u14:cdkn2a, +7:u22:BAP, +8:u23:BAP1, +10:u00:ARID1A, +7:u01:ATM, +8:u02:ATRX, +8:u03:BAP1, +8:u04:BRAF, +10:u05:CDKN2A, +7:u06:CIC, +9:u07:CSMD3, +8:u08:EGFR, +8:u10:atrx, +8:u11:bap1, +8:u12:braf, +10:u13:cdkn2a, +7:u14:cic, +8:u23:BRAF, +7:u00:ATM, +8:u01:ATRX, +8:u02:BAP1, +8:u03:BRAF, +10:u04:CDKN2A, +7:u05:CIC, +9:u06:CSMD3, +10:u07:CTNNB1, +9:u08:ERBB2, +8:u10:bap1, +8:u11:braf, +10:u12:cdkn2a, +7:u13:cic, +9:u14:csmd3, +7:u22:CDK, +8:u23:CDKN, +8:u00:ATRX, +8:u01:BAP1, +8:u02:BRAF, +10:u03:CDKN2A, +7:u04:CIC, +9:u05:CSMD3, +10:u06:CTNNB1, +8:u07:EGFR, +8:u08:FAT1, +8:u10:braf, +10:u11:cdkn2a, +7:u12:cic, +9:u13:csmd3, +10:u14:ctnnb1, +7:u22:CIC, +7:u23:CIC, +8:u00:BAP1, +8:u01:BRAF, +10:u02:CDKN2A, +7:u03:CIC, +9:u04:CSMD3, +10:u05:CTNNB1, +8:u06:EGFR, +9:u07:ERBB2, +9:u08:FBXW7, +10:u10:cdkn2a, +7:u11:cic, +9:u12:csmd3, +10:u13:ctnnb1, +7:u22:CSM, +8:u23:CSMD, +8:u00:BRAF, +10:u01:CDKN2A, +7:u02:CIC, +9:u03:CSMD3, +10:u04:CTNNB1, +8:u05:EGFR, +9:u06:ERBB2, +8:u07:FAT1, +9:u08:FGFR3, +7:u10:cic, +9:u11:csmd3, +10:u12:ctnnb1, +9:u14:erbb2, +7:u22:CTN, +8:u23:CTNN, +10:u00:CDKN2A, +7:u01:CIC, +9:u02:CSMD3, +10:u03:CTNNB1, +8:u04:EGFR, +9:u05:ERBB2, +8:u06:FAT1, +9:u07:FBXW7, +9:u08:FUBP1, +9:u10:csmd3, +10:u11:ctnnb1, +9:u13:erbb2, +8:u14:fat1, +7:u22:EGF, +8:u23:EGFR, +7:u00:CIC, +9:u01:CSMD3, +10:u02:CTNNB1, +8:u03:EGFR, +9:u04:ERBB2, +8:u05:FAT1, +9:u06:FBXW7, +9:u07:FGFR3, +8:u08:IDH1, +10:u10:ctnnb1, +9:u12:erbb2, +8:u13:fat1, +9:u14:fbxw7, +7:u22:ERB, +8:u23:ERBB, +9:u00:CSMD3, +10:u01:CTNNB1, +8:u02:EGFR, +9:u03:ERBB2, +8:u04:FAT1, +9:u05:FBXW7, +9:u06:FGFR3, +9:u07:FUBP1, +7:u08:KIT, +9:u11:erbb2, +8:u12:fat1, +9:u13:fbxw7, +9:u14:fgfr3, +7:u22:FAT, +8:u23:FAT1, +10:u00:CTNNB1, +8:u01:EGFR, +9:u02:ERBB2, +8:u03:FAT1, +9:u04:FBXW7, +9:u05:FGFR3, +9:u06:FUBP1, +8:u07:IDH1, +9:u08:KMT2C, +9:u10:erbb2, +8:u11:fat1, +9:u12:fbxw7, +9:u13:fgfr3, +9:u14:fubp1, +8:u23:FBXW, +8:u00:EGFR, +9:u01:ERBB2, +8:u02:FAT1, +9:u03:FBXW7, +9:u04:FGFR3, +9:u05:FUBP1, +8:u06:IDH1, +7:u07:KIT, +9:u08:KMT2D, +8:u10:fat1, +9:u11:fbxw7, +9:u12:fgfr3, +9:u13:fubp1, +8:u14:idh1, +6:u21:FG, +7:u22:FGF, +8:u23:FGFR, +9:u00:ERBB2, +8:u01:FAT1, +9:u02:FBXW7, +9:u03:FGFR3, +9:u04:FUBP1, +8:u05:IDH1, +7:u06:KIT, +9:u07:KMT2C, +8:u08:KRAS, +9:u10:fbxw7, +9:u11:fgfr3, +9:u12:fubp1, +8:u13:idh1, +7:u22:FUB, +8:u23:FUBP, +8:u00:FAT1, +9:u01:FBXW7, +9:u02:FGFR3, +9:u03:FUBP1, +8:u04:IDH1, +7:u05:KIT, +9:u06:KMT2C, +9:u07:KMT2D, +9:u08:LRP1B, +9:u10:fgfr3, +9:u11:fubp1, +8:u12:idh1, +9:u14:kmt2c, +7:u22:IDH, +8:u23:IDH1, +9:u00:FBXW7, +9:u01:FGFR3, +9:u02:FUBP1, +8:u03:IDH1, +7:u04:KIT, +9:u05:KMT2C, +9:u06:KMT2D, +8:u07:KRAS, +8:u08:MGAM, +9:u10:fubp1, +8:u11:idh1, +9:u13:kmt2c, +9:u14:kmt2d, +7:u22:KIT, +7:u23:KIT, +9:u00:FGFR3, +9:u01:FUBP1, +8:u02:IDH1, +7:u03:KIT, +9:u04:KMT2C, +9:u05:KMT2D, +8:u06:KRAS, +9:u07:LRP1B, +8:u08:MTOR, +8:u10:idh1, +9:u12:kmt2c, +9:u13:kmt2d, +8:u14:kras, +7:u22:KMT, +8:u23:KMT2, +9:u00:FUBP1, +8:u01:IDH1, +7:u02:KIT, +9:u03:KMT2C, +9:u04:KMT2D, +8:u05:KRAS, +9:u06:LRP1B, +8:u07:MGAM, +7:u08:NF1, +9:u11:kmt2c, +9:u12:kmt2d, +8:u13:kras, +9:u14:lrp1b, +8:u00:IDH1, +7:u01:KIT, +9:u02:KMT2C, +9:u03:KMT2D, +8:u04:KRAS, +9:u05:LRP1B, +8:u06:MGAM, +8:u07:MTOR, +7:u08:NF2, +9:u10:kmt2c, +9:u11:kmt2d, +8:u12:kras, +9:u13:lrp1b, +8:u14:mgam, +6:u21:KR, +7:u22:KRA, +8:u23:KRAS, +7:u00:KIT, +9:u01:KMT2C, +9:u02:KMT2D, +8:u03:KRAS, +9:u04:LRP1B, +8:u05:MGAM, +8:u06:MTOR, +7:u07:NF1, +10:u08:NOTCH1, +9:u10:kmt2d, +8:u11:kras, +9:u12:lrp1b, +8:u13:mgam, +8:u14:mtor, +7:u22:LRP, +8:u23:LRP1, +9:u00:KMT2C, +9:u01:KMT2D, +8:u02:KRAS, +9:u03:LRP1B, +8:u04:MGAM, +8:u05:MTOR, +7:u06:NF1, +7:u07:NF2, +8:u08:NRAS, +8:u10:kras, +9:u11:lrp1b, +8:u12:mgam, +8:u13:mtor, +7:u14:nf1, +7:u22:MGA, +8:u23:MGAM, +9:u00:KMT2D, +8:u01:KRAS, +9:u02:LRP1B, +8:u03:MGAM, +8:u04:MTOR, +7:u05:NF1, +7:u06:NF2, +10:u07:NOTCH1, +10:u08:PDGFRA, +9:u10:lrp1b, +8:u11:mgam, +8:u12:mtor, +7:u13:nf1, +7:u14:nf2, +7:u22:MTO, +8:u23:MTOR, +8:u00:KRAS, +9:u01:LRP1B, +8:u02:MGAM, +8:u03:MTOR, +7:u04:NF1, +7:u05:NF2, +10:u06:NOTCH1, +8:u07:NRAS, +8:u10:mgam, +8:u11:mtor, +7:u12:nf1, +7:u13:nf2, +10:u14:notch1, +7:u22:NF1, +7:u23:NF1, +9:u00:LRP1B, +8:u01:MGAM, +8:u02:MTOR, +7:u03:NF1, +7:u04:NF2, +10:u05:NOTCH1, +8:u06:NRAS, +10:u07:PDGFRA, +11:u08:PKHD1L1, +8:u10:mtor, +7:u11:nf1, +7:u12:nf2, +10:u13:notch1, +8:u14:nras, +7:u22:NF2, +7:u23:NF2, +8:u00:MGAM, +8:u01:MTOR, +7:u02:NF1, +7:u03:NF2, +10:u04:NOTCH1, +8:u05:NRAS, +10:u06:PDGFRA, +8:u08:PTEN, +7:u10:nf1, +7:u11:nf2, +10:u12:notch1, +8:u13:nras, +10:u14:pdgfra, +8:u23:NOTC, +8:u00:MTOR, +7:u01:NF1, +7:u02:NF2, +10:u03:NOTCH1, +8:u04:NRAS, +10:u05:PDGFRA, +11:u07:PKHD1L1, +7:u08:RB1, +7:u10:nf2, +10:u11:notch1, +8:u12:nras, +10:u13:pdgfra, +7:u22:NRA, +8:u23:NRAS, +7:u00:NF1, +7:u01:NF2, +10:u02:NOTCH1, +8:u03:NRAS, +10:u04:PDGFRA, +11:u06:PKHD1L1, +8:u07:PTEN, +9:u08:SMAD4, +10:u10:notch1, +8:u11:nras, +10:u12:pdgfra, +11:u14:pkhd1l1, +7:u22:PDG, +8:u23:PDGF, +7:u00:NF2, +10:u01:NOTCH1, +8:u02:NRAS, +10:u03:PDGFRA, +11:u05:PKHD1L1, +8:u06:PTEN, +7:u07:RB1, +9:u08:SYNE1, +8:u10:nras, +10:u11:pdgfra, +11:u13:pkhd1l1, +8:u14:pten, +10:u00:NOTCH1, +8:u01:NRAS, +10:u02:PDGFRA, +11:u04:PKHD1L1, +8:u05:PTEN, +7:u06:RB1, +9:u07:SMAD4, +10:u10:pdgfra, +11:u12:pkhd1l1, +8:u13:pten, +7:u14:rb1, +8:u23:PKHD, +8:u00:NRAS, +10:u01:PDGFRA, +11:u03:PKHD1L1, +8:u04:PTEN, +7:u05:RB1, +9:u06:SMAD4, +9:u07:SYNE1, +9:u08:TRAF7, +11:u11:pkhd1l1, +8:u12:pten, +7:u13:rb1, +9:u14:smad4, +7:u22:PTE, +8:u23:PTEN, +10:u00:PDGFRA, +11:u02:PKHD1L1, +8:u03:PTEN, +7:u04:RB1, +9:u05:SMAD4, +9:u06:SYNE1, +8:u08:TSC1, +11:u10:pkhd1l1, +8:u11:pten, +7:u12:rb1, +9:u13:smad4, +9:u14:syne1, +7:u22:RB1, +7:u23:RB1, +11:u01:PKHD1L1, +8:u02:PTEN, +7:u03:RB1, +9:u04:SMAD4, +9:u05:SYNE1, +9:u07:TRAF7, +8:u10:pten, +7:u11:rb1, +9:u12:smad4, +9:u13:syne1, +8:u23:SMAD, +11:u00:PKHD1L1, +8:u01:PTEN, +7:u02:RB1, +9:u03:SMAD4, +9:u04:SYNE1, +9:u06:TRAF7, +8:u07:TSC1, +7:u10:rb1, +9:u11:smad4, +9:u12:syne1, +9:u14:traf7, +7:u22:SYN, +8:u23:SYNE, +8:u00:PTEN, +7:u01:RB1, +9:u02:SMAD4, +9:u03:SYNE1, +9:u05:TRAF7, +8:u06:TSC1, +9:u10:smad4, +9:u11:syne1, +9:u13:traf7, +8:u14:tsc1, +7:u00:RB1, +9:u01:SMAD4, +9:u02:SYNE1, +9:u04:TRAF7, +8:u05:TSC1, +9:u10:syne1, +9:u12:traf7, +8:u13:tsc1, +7:u22:TRA, +8:u23:TRAF, +9:u00:SMAD4, +9:u01:SYNE1, +9:u03:TRAF7, +8:u04:TSC1, +9:u11:traf7, +8:u12:tsc1, +7:u22:TSC, +8:u23:TSC1, +9:u00:SYNE1, +9:u02:TRAF7, +8:u03:TSC1, +9:u10:traf7, +8:u11:tsc1, +9:u01:TRAF7, +8:u02:TSC1, +8:u10:tsc1, +9:u00:TRAF7, +8:u01:TSC1, +8:u00:TSC1, +14:u08:Activating, +13:u08:Ambiguous, +14:u07:Activating, +14:u06:Activating, +13:u07:Ambiguous, +14:u05:Activating, +13:u06:Ambiguous, +13:u14:ambiguous, +14:u04:Activating, +13:u05:Ambiguous, +13:u13:ambiguous, +14:u03:Activating, +13:u04:Ambiguous, +13:u12:ambiguous, +7:u22:Amb, +8:u23:Ambi, +14:u02:Activating, +13:u03:Ambiguous, +13:u11:ambiguous, +8:u23:Loss, +14:u01:Activating, +13:u02:Ambiguous, +13:u10:ambiguous, +14:u00:Activating, +13:u01:Ambiguous, +13:u00:Ambiguous, +8:uI2::,;,, +11:u14:drivers, +8:uI1::,;,, +11:u13:drivers, +8:uI0::,;,, +11:u12:drivers, +11:u11:drivers, +9:uI2::,;,-, +11:u10:drivers, +9:uI1::,;,-, +9:uI0::,;,-, +9:u08:ERBB3, +9:u07:ERBB3, +9:u06:ERBB3, +10:u08:ACVR2A, +9:u14:erbb3, +9:u05:ERBB3, +9:u08:RNF43, +9:u13:erbb3, +9:u04:ERBB3, +10:u07:ACVR2A, +9:u12:erbb3, +9:u03:ERBB3, +10:u06:ACVR2A, +9:u07:RNF43, +9:u11:erbb3, +10:u14:acvr2a, +9:u02:ERBB3, +10:u05:ACVR2A, +9:u06:RNF43, +9:u10:erbb3, +10:u13:acvr2a, +9:u14:rnf43, +9:u01:ERBB3, +10:u04:ACVR2A, +9:u05:RNF43, +10:u12:acvr2a, +9:u13:rnf43, +7:u22:ACV, +8:u23:ACVR, +9:u00:ERBB3, +10:u03:ACVR2A, +9:u04:RNF43, +10:u11:acvr2a, +9:u12:rnf43, +8:u23:RNF4, +10:u02:ACVR2A, +9:u03:RNF43, +10:u10:acvr2a, +9:u11:rnf43, +10:u01:ACVR2A, +9:u02:RNF43, +9:u10:rnf43, +10:u00:ACVR2A, +9:u01:RNF43, +9:u08:FOXA1, +9:u00:RNF43, +10:u08:MAP3K1, +9:u07:FOXA1, +10:u08:MAP2K4, +9:u06:FOXA1, +10:u07:MAP3K1, +9:u08:RUNX1, +9:u14:foxa1, +9:u05:FOXA1, +10:u06:MAP3K1, +10:u07:MAP2K4, +9:u08:NCOR1, +9:u13:foxa1, +10:u14:map3k1, +9:u04:FOXA1, +10:u05:MAP3K1, +10:u06:MAP2K4, +9:u07:RUNX1, +9:u08:ZFPM1, +9:u12:foxa1, +10:u13:map3k1, +10:u14:map2k4, +8:u23:FOXA, +9:u03:FOXA1, +10:u04:MAP3K1, +10:u05:MAP2K4, +9:u06:RUNX1, +9:u07:NCOR1, +8:u08:SPEN, +9:u11:foxa1, +10:u12:map3k1, +10:u13:map2k4, +9:u14:runx1, +9:u02:FOXA1, +10:u03:MAP3K1, +10:u04:MAP2K4, +9:u05:RUNX1, +9:u06:NCOR1, +9:u07:ZFPM1, +9:u08:GATA3, +9:u10:foxa1, +10:u11:map3k1, +10:u12:map2k4, +9:u13:runx1, +9:u14:ncor1, +9:u01:FOXA1, +10:u02:MAP3K1, +10:u03:MAP2K4, +9:u04:RUNX1, +9:u05:NCOR1, +9:u06:ZFPM1, +8:u07:SPEN, +9:u08:SF3B1, +10:u10:map3k1, +10:u11:map2k4, +9:u12:runx1, +9:u13:ncor1, +9:u14:zfpm1, +6:u21:RU, +7:u22:RUN, +8:u23:RUNX, +9:u00:FOXA1, +10:u01:MAP3K1, +10:u02:MAP2K4, +9:u03:RUNX1, +9:u04:NCOR1, +9:u05:ZFPM1, +8:u06:SPEN, +9:u07:GATA3, +10:u10:map2k4, +9:u11:runx1, +9:u12:ncor1, +9:u13:zfpm1, +8:u14:spen, +7:u22:NCO, +8:u23:NCOR, +10:u00:MAP3K1, +10:u01:MAP2K4, +9:u02:RUNX1, +9:u03:NCOR1, +9:u04:ZFPM1, +8:u05:SPEN, +9:u06:GATA3, +9:u07:SF3B1, +8:u08:CDH1, +9:u10:runx1, +9:u11:ncor1, +9:u12:zfpm1, +8:u13:spen, +9:u14:gata3, +7:u22:ZFP, +8:u23:ZFPM, +10:u00:MAP2K4, +9:u01:RUNX1, +9:u02:NCOR1, +9:u03:ZFPM1, +8:u04:SPEN, +9:u05:GATA3, +9:u06:SF3B1, +8:u08:TBX3, +9:u10:ncor1, +9:u11:zfpm1, +8:u12:spen, +9:u13:gata3, +9:u14:sf3b1, +7:u22:SPE, +8:u23:SPEN, +9:u00:RUNX1, +9:u01:NCOR1, +9:u02:ZFPM1, +8:u03:SPEN, +9:u04:GATA3, +9:u05:SF3B1, +8:u07:CDH1, +8:u08:CBFB, +9:u10:zfpm1, +8:u11:spen, +9:u12:gata3, +9:u13:sf3b1, +8:u23:GATA, +9:u00:NCOR1, +9:u01:ZFPM1, +8:u02:SPEN, +9:u03:GATA3, +9:u04:SF3B1, +8:u06:CDH1, +8:u07:TBX3, +8:u10:spen, +9:u11:gata3, +9:u12:sf3b1, +8:u14:cdh1, +7:u22:SF3, +8:u23:SF3B, +9:u00:ZFPM1, +8:u01:SPEN, +9:u02:GATA3, +9:u03:SF3B1, +8:u05:CDH1, +8:u06:TBX3, +8:u07:CBFB, +9:u10:gata3, +9:u11:sf3b1, +8:u13:cdh1, +8:u14:tbx3, +8:u00:SPEN, +9:u01:GATA3, +9:u02:SF3B1, +8:u04:CDH1, +8:u05:TBX3, +8:u06:CBFB, +9:u10:sf3b1, +8:u12:cdh1, +8:u13:tbx3, +8:u14:cbfb, +8:u23:CDH1, +9:u00:GATA3, +9:u01:SF3B1, +8:u03:CDH1, +8:u04:TBX3, +8:u05:CBFB, +9:u08:KDM6A, +8:u11:cdh1, +8:u12:tbx3, +8:u13:cbfb, +7:u22:TBX, +8:u23:TBX3, +9:u00:SF3B1, +8:u02:CDH1, +8:u03:TBX3, +8:u04:CBFB, +10:u08:CREBBP, +8:u10:cdh1, +8:u11:tbx3, +8:u12:cbfb, +7:u22:CBF, +8:u23:CBFB, +8:u01:CDH1, +8:u02:TBX3, +8:u03:CBFB, +9:u07:KDM6A, +9:u08:STAG2, +8:u10:tbx3, +8:u11:cbfb, +8:u00:CDH1, +8:u01:TBX3, +8:u02:CBFB, +9:u06:KDM6A, +10:u07:CREBBP, +8:u08:ELF3, +8:u10:cbfb, +9:u14:kdm6a, +8:u00:TBX3, +8:u01:CBFB, +9:u05:KDM6A, +10:u06:CREBBP, +9:u07:STAG2, +9:u08:EP300, +9:u13:kdm6a, +10:u14:crebbp, +8:u00:CBFB, +9:u04:KDM6A, +10:u05:CREBBP, +9:u06:STAG2, +8:u07:ELF3, +9:u08:KMT2A, +9:u12:kdm6a, +10:u13:crebbp, +9:u14:stag2, +6:u21:KD, +7:u22:KDM, +8:u23:KDM6, +9:u03:KDM6A, +10:u04:CREBBP, +9:u05:STAG2, +8:u06:ELF3, +9:u07:EP300, +8:u08:RHOA, +9:u11:kdm6a, +10:u12:crebbp, +9:u13:stag2, +8:u14:elf3, +8:u23:CREB, +9:u02:KDM6A, +10:u03:CREBBP, +9:u04:STAG2, +8:u05:ELF3, +9:u06:EP300, +9:u07:KMT2A, +9:u10:kdm6a, +10:u11:crebbp, +9:u12:stag2, +8:u13:elf3, +9:u14:ep300, +8:u23:STAG, +9:u01:KDM6A, +10:u02:CREBBP, +9:u03:STAG2, +8:u04:ELF3, +9:u05:EP300, +9:u06:KMT2A, +8:u07:RHOA, +11:u08:PPP2R1A, +10:u10:crebbp, +9:u11:stag2, +8:u12:elf3, +9:u13:ep300, +9:u14:kmt2a, +8:u23:ELF3, +9:u00:KDM6A, +10:u01:CREBBP, +9:u02:STAG2, +8:u03:ELF3, +9:u04:EP300, +9:u05:KMT2A, +8:u06:RHOA, +10:u08:PIK3R1, +9:u10:stag2, +8:u11:elf3, +9:u12:ep300, +9:u13:kmt2a, +8:u14:rhoa, +7:u22:EP3, +8:u23:EP30, +10:u00:CREBBP, +9:u01:STAG2, +8:u02:ELF3, +9:u03:EP300, +9:u04:KMT2A, +8:u05:RHOA, +11:u07:PPP2R1A, +9:u08:FGFR2, +8:u10:elf3, +9:u11:ep300, +9:u12:kmt2a, +8:u13:rhoa, +9:u00:STAG2, +8:u01:ELF3, +9:u02:EP300, +9:u03:KMT2A, +8:u04:RHOA, +11:u06:PPP2R1A, +10:u07:PIK3R1, +8:u08:CHD4, +9:u10:ep300, +9:u11:kmt2a, +8:u12:rhoa, +11:u14:ppp2r1a, +7:u22:RHO, +8:u23:RHOA, +8:u00:ELF3, +9:u01:EP300, +9:u02:KMT2A, +8:u03:RHOA, +11:u05:PPP2R1A, +10:u06:PIK3R1, +9:u07:FGFR2, +8:u08:BCOR, +9:u10:kmt2a, +8:u11:rhoa, +11:u13:ppp2r1a, +10:u14:pik3r1, +9:u00:EP300, +9:u01:KMT2A, +8:u02:RHOA, +11:u04:PPP2R1A, +10:u05:PIK3R1, +9:u06:FGFR2, +8:u07:CHD4, +8:u08:SPOP, +8:u10:rhoa, +11:u12:ppp2r1a, +10:u13:pik3r1, +9:u14:fgfr2, +7:u22:PPP, +8:u23:PPP2, +9:u00:KMT2A, +8:u01:RHOA, +11:u03:PPP2R1A, +10:u04:PIK3R1, +9:u05:FGFR2, +8:u06:CHD4, +8:u07:BCOR, +11:u11:ppp2r1a, +10:u12:pik3r1, +9:u13:fgfr2, +8:u14:chd4, +8:u00:RHOA, +11:u02:PPP2R1A, +10:u03:PIK3R1, +9:u04:FGFR2, +8:u05:CHD4, +8:u06:BCOR, +8:u07:SPOP, +11:u10:ppp2r1a, +10:u11:pik3r1, +9:u12:fgfr2, +8:u13:chd4, +8:u14:bcor, +11:u01:PPP2R1A, +10:u02:PIK3R1, +9:u03:FGFR2, +8:u04:CHD4, +8:u05:BCOR, +8:u06:SPOP, +10:u10:pik3r1, +9:u11:fgfr2, +8:u12:chd4, +8:u13:bcor, +8:u14:spop, +7:u22:CHD, +8:u23:CHD4, +11:u00:PPP2R1A, +10:u01:PIK3R1, +9:u02:FGFR2, +8:u03:CHD4, +8:u04:BCOR, +8:u05:SPOP, +10:u08:NFE2L2, +9:u10:fgfr2, +8:u11:chd4, +8:u12:bcor, +8:u13:spop, +6:u21:BC, +7:u22:BCO, +8:u23:BCOR, +10:u00:PIK3R1, +9:u01:FGFR2, +8:u02:CHD4, +8:u03:BCOR, +8:u04:SPOP, +9:u08:SETD2, +8:u10:chd4, +8:u11:bcor, +8:u12:spop, +7:u22:SPO, +8:u23:SPOP, +9:u00:FGFR2, +8:u01:CHD4, +8:u02:BCOR, +8:u03:SPOP, +10:u07:NFE2L2, +8:u10:bcor, +8:u11:spop, +8:u00:CHD4, +8:u01:BCOR, +8:u02:SPOP, +10:u06:NFE2L2, +9:u07:SETD2, +8:u10:spop, +10:u14:nfe2l2, +8:u00:BCOR, +8:u01:SPOP, +10:u05:NFE2L2, +9:u06:SETD2, +9:u08:PBRM1, +10:u13:nfe2l2, +9:u14:setd2, +8:u00:SPOP, +10:u04:NFE2L2, +9:u05:SETD2, +7:u08:MGA, +10:u12:nfe2l2, +9:u13:setd2, +7:u22:NFE, +8:u23:NFE2, +10:u03:NFE2L2, +9:u04:SETD2, +9:u07:PBRM1, +9:u08:RBM10, +10:u11:nfe2l2, +9:u12:setd2, +7:u22:SET, +8:u23:SETD, +10:u02:NFE2L2, +9:u03:SETD2, +9:u06:PBRM1, +7:u07:MGA, +9:u08:STK11, +10:u10:nfe2l2, +9:u11:setd2, +9:u14:pbrm1, +10:u01:NFE2L2, +9:u02:SETD2, +9:u05:PBRM1, +7:u06:MGA, +9:u07:RBM10, +9:u08:KEAP1, +9:u10:setd2, +9:u13:pbrm1, +7:u14:mga, +10:u00:NFE2L2, +9:u01:SETD2, +9:u04:PBRM1, +7:u05:MGA, +9:u06:RBM10, +9:u07:STK11, +9:u08:ARID2, +9:u12:pbrm1, +7:u13:mga, +9:u14:rbm10, +7:u22:PBR, +8:u23:PBRM, +9:u00:SETD2, +9:u03:PBRM1, +7:u04:MGA, +9:u05:RBM10, +9:u06:STK11, +9:u07:KEAP1, +8:u08:RAC1, +9:u11:pbrm1, +7:u12:mga, +9:u13:rbm10, +9:u14:stk11, +7:u23:MGA, +9:u02:PBRM1, +7:u03:MGA, +9:u04:RBM10, +9:u05:STK11, +9:u06:KEAP1, +9:u07:ARID2, +8:u08:IDH2, +9:u10:pbrm1, +7:u11:mga, +9:u12:rbm10, +9:u13:stk11, +9:u14:keap1, +8:u23:RBM1, +9:u01:PBRM1, +7:u02:MGA, +9:u03:RBM10, +9:u04:STK11, +9:u05:KEAP1, +9:u06:ARID2, +8:u07:RAC1, +9:u08:CASP8, +7:u10:mga, +9:u11:rbm10, +9:u12:stk11, +9:u13:keap1, +9:u14:arid2, +7:u22:STK, +8:u23:STK1, +9:u00:PBRM1, +7:u01:MGA, +9:u02:RBM10, +9:u03:STK11, +9:u04:KEAP1, +9:u05:ARID2, +8:u06:RAC1, +8:u07:IDH2, +7:u08:MAX, +9:u10:rbm10, +9:u11:stk11, +9:u12:keap1, +9:u13:arid2, +8:u14:rac1, +7:u22:KEA, +8:u23:KEAP, +7:u00:MGA, +9:u01:RBM10, +9:u02:STK11, +9:u03:KEAP1, +9:u04:ARID2, +8:u05:RAC1, +8:u06:IDH2, +9:u07:CASP8, +12:u08:ARHGAP35, +9:u10:stk11, +9:u11:keap1, +9:u12:arid2, +8:u13:rac1, +8:u14:idh2, +9:u00:RBM10, +9:u01:STK11, +9:u02:KEAP1, +9:u03:ARID2, +8:u04:RAC1, +8:u05:IDH2, +9:u06:CASP8, +7:u07:MAX, +8:u08:CTCF, +9:u10:keap1, +9:u11:arid2, +8:u12:rac1, +8:u13:idh2, +9:u14:casp8, +7:u22:RAC, +8:u23:RAC1, +9:u00:STK11, +9:u01:KEAP1, +9:u02:ARID2, +8:u03:RAC1, +8:u04:IDH2, +9:u05:CASP8, +7:u06:MAX, +12:u07:ARHGAP35, +8:u08:ESR1, +9:u10:arid2, +8:u11:rac1, +8:u12:idh2, +9:u13:casp8, +8:u23:IDH2, +9:u00:KEAP1, +9:u01:ARID2, +8:u02:RAC1, +8:u03:IDH2, +9:u04:CASP8, +7:u05:MAX, +12:u06:ARHGAP35, +8:u07:CTCF, +8:u10:rac1, +8:u11:idh2, +9:u12:casp8, +12:u14:arhgap35, +9:u00:ARID2, +8:u01:RAC1, +8:u02:IDH2, +9:u03:CASP8, +7:u04:MAX, +12:u05:ARHGAP35, +8:u06:CTCF, +8:u07:ESR1, +8:u08:KLF4, +8:u10:idh2, +9:u11:casp8, +12:u13:arhgap35, +8:u14:ctcf, +7:u22:MAX, +7:u23:MAX, +8:u00:RAC1, +8:u01:IDH2, +9:u02:CASP8, +7:u03:MAX, +12:u04:ARHGAP35, +8:u05:CTCF, +8:u06:ESR1, +9:u10:casp8, +12:u12:arhgap35, +8:u13:ctcf, +8:u14:esr1, +7:u22:ARH, +8:u23:ARHG, +8:u00:IDH2, +9:u01:CASP8, +7:u02:MAX, +12:u03:ARHGAP35, +8:u04:CTCF, +8:u05:ESR1, +8:u07:KLF4, +10:u08:ARID1B, +12:u11:arhgap35, +8:u12:ctcf, +8:u13:esr1, +7:u22:CTC, +8:u23:CTCF, +9:u00:CASP8, +7:u01:MAX, +12:u02:ARHGAP35, +8:u03:CTCF, +8:u04:ESR1, +8:u06:KLF4, +9:u08:SIN3A, +12:u10:arhgap35, +8:u11:ctcf, +8:u12:esr1, +8:u14:klf4, +8:u23:ESR1, +7:u00:MAX, +12:u01:ARHGAP35, +8:u02:CTCF, +8:u03:ESR1, +8:u05:KLF4, +10:u07:ARID1B, +8:u08:GNAS, +8:u10:ctcf, +8:u11:esr1, +8:u13:klf4, +12:u00:ARHGAP35, +8:u01:CTCF, +8:u02:ESR1, +8:u04:KLF4, +10:u06:ARID1B, +9:u07:SIN3A, +8:u10:esr1, +8:u12:klf4, +10:u14:arid1b, +7:u22:KLF, +8:u23:KLF4, +8:u00:CTCF, +8:u01:ESR1, +8:u03:KLF4, +10:u05:ARID1B, +9:u06:SIN3A, +8:u07:GNAS, +10:u08:MAP2K1, +8:u11:klf4, +10:u13:arid1b, +9:u14:sin3a, +8:u00:ESR1, +8:u02:KLF4, +10:u04:ARID1B, +9:u05:SIN3A, +8:u06:GNAS, +9:u08:PSPC1, +8:u10:klf4, +10:u12:arid1b, +9:u13:sin3a, +8:u14:gnas, +8:u01:KLF4, +10:u03:ARID1B, +9:u04:SIN3A, +8:u05:GNAS, +10:u07:MAP2K1, +9:u08:ZFHX3, +10:u11:arid1b, +9:u12:sin3a, +8:u13:gnas, +7:u22:SIN, +8:u23:SIN3, +8:u00:KLF4, +10:u02:ARID1B, +9:u03:SIN3A, +8:u04:GNAS, +10:u06:MAP2K1, +9:u07:PSPC1, +9:u08:MED12, +10:u10:arid1b, +9:u11:sin3a, +8:u12:gnas, +10:u14:map2k1, +7:u22:GNA, +8:u23:GNAS, +10:u01:ARID1B, +9:u02:SIN3A, +8:u03:GNAS, +10:u05:MAP2K1, +9:u06:PSPC1, +9:u07:ZFHX3, +9:u08:ZMYM3, +9:u10:sin3a, +8:u11:gnas, +10:u13:map2k1, +9:u14:pspc1, +10:u00:ARID1B, +9:u01:SIN3A, +8:u02:GNAS, +10:u04:MAP2K1, +9:u05:PSPC1, +9:u06:ZFHX3, +9:u07:MED12, +9:u08:CDK12, +8:u10:gnas, +10:u12:map2k1, +9:u13:pspc1, +9:u14:zfhx3, +9:u00:SIN3A, +8:u01:GNAS, +10:u03:MAP2K1, +9:u04:PSPC1, +9:u05:ZFHX3, +9:u06:MED12, +9:u07:ZMYM3, +8:u08:HRAS, +10:u11:map2k1, +9:u12:pspc1, +9:u13:zfhx3, +9:u14:med12, +8:u23:PSPC, +8:u00:GNAS, +10:u02:MAP2K1, +9:u03:PSPC1, +9:u04:ZFHX3, +9:u05:MED12, +9:u06:ZMYM3, +9:u07:CDK12, +10:u08:CDKN1A, +10:u10:map2k1, +9:u11:pspc1, +9:u12:zfhx3, +9:u13:med12, +9:u14:zmym3, +7:u22:ZFH, +8:u23:ZFHX, +10:u01:MAP2K1, +9:u02:PSPC1, +9:u03:ZFHX3, +9:u04:MED12, +9:u05:ZMYM3, +9:u06:CDK12, +8:u07:HRAS, +9:u08:ASXL1, +9:u10:pspc1, +9:u11:zfhx3, +9:u12:med12, +9:u13:zmym3, +9:u14:cdk12, +8:u23:MED1, +10:u00:MAP2K1, +9:u01:PSPC1, +9:u02:ZFHX3, +9:u03:MED12, +9:u04:ZMYM3, +9:u05:CDK12, +8:u06:HRAS, +10:u07:CDKN1A, +8:u08:MUC4, +9:u10:zfhx3, +9:u11:med12, +9:u12:zmym3, +9:u13:cdk12, +8:u14:hras, +6:u21:ZM, +7:u22:ZMY, +8:u23:ZMYM, +9:u00:PSPC1, +9:u01:ZFHX3, +9:u02:MED12, +9:u03:ZMYM3, +9:u04:CDK12, +8:u05:HRAS, +10:u06:CDKN1A, +9:u07:ASXL1, +9:u08:ZNF98, +9:u10:med12, +9:u11:zmym3, +9:u12:cdk12, +8:u13:hras, +10:u14:cdkn1a, +8:u23:CDK1, +9:u00:ZFHX3, +9:u01:MED12, +9:u02:ZMYM3, +9:u03:CDK12, +8:u04:HRAS, +10:u05:CDKN1A, +9:u06:ASXL1, +8:u07:MUC4, +11:u08:ZSCAN5A, +9:u10:zmym3, +9:u11:cdk12, +8:u12:hras, +10:u13:cdkn1a, +9:u14:asxl1, +7:u22:HRA, +8:u23:HRAS, +9:u00:MED12, +9:u01:ZMYM3, +9:u02:CDK12, +8:u03:HRAS, +10:u04:CDKN1A, +9:u05:ASXL1, +8:u06:MUC4, +9:u07:ZNF98, +9:u08:MUC20, +9:u10:cdk12, +8:u11:hras, +10:u12:cdkn1a, +9:u13:asxl1, +8:u14:muc4, +9:u00:ZMYM3, +9:u01:CDK12, +8:u02:HRAS, +10:u03:CDKN1A, +9:u04:ASXL1, +8:u05:MUC4, +9:u06:ZNF98, +11:u07:ZSCAN5A, +10:u08:CDKN1B, +8:u10:hras, +10:u11:cdkn1a, +9:u12:asxl1, +8:u13:muc4, +9:u14:znf98, +7:u22:ASX, +8:u23:ASXL, +9:u00:CDK12, +8:u01:HRAS, +10:u02:CDKN1A, +9:u03:ASXL1, +8:u04:MUC4, +9:u05:ZNF98, +11:u06:ZSCAN5A, +9:u07:MUC20, +9:u08:FOXO3, +10:u10:cdkn1a, +9:u11:asxl1, +8:u12:muc4, +9:u13:znf98, +11:u14:zscan5a, +7:u22:MUC, +8:u23:MUC4, +8:u00:HRAS, +10:u01:CDKN1A, +9:u02:ASXL1, +8:u03:MUC4, +9:u04:ZNF98, +11:u05:ZSCAN5A, +9:u06:MUC20, +10:u07:CDKN1B, +12:u08:USP17L22, +9:u10:asxl1, +8:u11:muc4, +9:u12:znf98, +11:u13:zscan5a, +9:u14:muc20, +8:u23:ZNF9, +10:u00:CDKN1A, +9:u01:ASXL1, +8:u02:MUC4, +9:u03:ZNF98, +11:u04:ZSCAN5A, +9:u05:MUC20, +10:u06:CDKN1B, +9:u07:FOXO3, +10:u08:SEC22B, +8:u10:muc4, +9:u11:znf98, +11:u12:zscan5a, +9:u13:muc20, +10:u14:cdkn1b, +7:u22:ZSC, +8:u23:ZSCA, +9:u00:ASXL1, +8:u01:MUC4, +9:u02:ZNF98, +11:u03:ZSCAN5A, +9:u04:MUC20, +10:u05:CDKN1B, +9:u06:FOXO3, +12:u07:USP17L22, +11:u08:SMARCA4, +9:u10:znf98, +11:u11:zscan5a, +9:u12:muc20, +10:u13:cdkn1b, +9:u14:foxo3, +8:u23:MUC2, +8:u00:MUC4, +9:u01:ZNF98, +11:u02:ZSCAN5A, +9:u03:MUC20, +10:u04:CDKN1B, +9:u05:FOXO3, +12:u06:USP17L22, +10:u07:SEC22B, +9:u08:PRPF8, +11:u10:zscan5a, +9:u11:muc20, +10:u12:cdkn1b, +9:u13:foxo3, +12:u14:usp17l22, +9:u00:ZNF98, +11:u01:ZSCAN5A, +9:u02:MUC20, +10:u03:CDKN1B, +9:u04:FOXO3, +12:u05:USP17L22, +10:u06:SEC22B, +11:u07:SMARCA4, +8:u08:TET2, +9:u10:muc20, +10:u11:cdkn1b, +9:u12:foxo3, +12:u13:usp17l22, +10:u14:sec22b, +8:u23:FOXO, +11:u00:ZSCAN5A, +9:u01:MUC20, +10:u02:CDKN1B, +9:u03:FOXO3, +12:u04:USP17L22, +10:u05:SEC22B, +11:u06:SMARCA4, +9:u07:PRPF8, +8:u08:CUL3, +10:u10:cdkn1b, +9:u11:foxo3, +12:u12:usp17l22, +10:u13:sec22b, +11:u14:smarca4, +7:u22:USP, +8:u23:USP1, +9:u00:MUC20, +10:u01:CDKN1B, +9:u02:FOXO3, +12:u03:USP17L22, +10:u04:SEC22B, +11:u05:SMARCA4, +9:u06:PRPF8, +8:u07:TET2, +11:u08:SMARCB1, +9:u10:foxo3, +12:u11:usp17l22, +10:u12:sec22b, +11:u13:smarca4, +9:u14:prpf8, +8:u23:SEC2, +10:u00:CDKN1B, +9:u01:FOXO3, +12:u02:USP17L22, +10:u03:SEC22B, +11:u04:SMARCA4, +9:u05:PRPF8, +8:u06:TET2, +8:u07:CUL3, +9:u08:ROCK1, +12:u10:usp17l22, +10:u11:sec22b, +11:u12:smarca4, +9:u13:prpf8, +8:u14:tet2, +9:u00:FOXO3, +12:u01:USP17L22, +10:u02:SEC22B, +11:u03:SMARCA4, +9:u04:PRPF8, +8:u05:TET2, +8:u06:CUL3, +11:u07:SMARCB1, +12:u08:PRAMEF15, +10:u10:sec22b, +11:u11:smarca4, +9:u12:prpf8, +8:u13:tet2, +8:u14:cul3, +7:u22:PRP, +8:u23:PRPF, +12:u00:USP17L22, +10:u01:SEC22B, +11:u02:SMARCA4, +9:u03:PRPF8, +8:u04:TET2, +8:u05:CUL3, +11:u06:SMARCB1, +9:u07:ROCK1, +9:u08:AGAP6, +11:u10:smarca4, +9:u11:prpf8, +8:u12:tet2, +8:u13:cul3, +11:u14:smarcb1, +7:u22:TET, +8:u23:TET2, +10:u00:SEC22B, +11:u01:SMARCA4, +9:u02:PRPF8, +8:u03:TET2, +8:u04:CUL3, +11:u05:SMARCB1, +9:u06:ROCK1, +12:u07:PRAMEF15, +9:u08:BRCA2, +9:u10:prpf8, +8:u11:tet2, +8:u12:cul3, +11:u13:smarcb1, +9:u14:rock1, +7:u22:CUL, +8:u23:CUL3, +11:u00:SMARCA4, +9:u01:PRPF8, +8:u02:TET2, +8:u03:CUL3, +11:u04:SMARCB1, +9:u05:ROCK1, +12:u06:PRAMEF15, +9:u07:AGAP6, +8:u10:tet2, +8:u11:cul3, +11:u12:smarcb1, +9:u13:rock1, +12:u14:pramef15, +9:u00:PRPF8, +8:u01:TET2, +8:u02:CUL3, +11:u03:SMARCB1, +9:u04:ROCK1, +12:u05:PRAMEF15, +9:u06:AGAP6, +9:u07:BRCA2, +8:u10:cul3, +11:u11:smarcb1, +9:u12:rock1, +12:u13:pramef15, +9:u14:agap6, +8:u23:ROCK, +8:u00:TET2, +8:u01:CUL3, +11:u02:SMARCB1, +9:u03:ROCK1, +12:u04:PRAMEF15, +9:u05:AGAP6, +9:u06:BRCA2, +8:u08:MYH9, +11:u10:smarcb1, +9:u11:rock1, +12:u12:pramef15, +9:u13:agap6, +9:u14:brca2, +7:u22:PRA, +8:u23:PRAM, +8:u00:CUL3, +11:u01:SMARCB1, +9:u02:ROCK1, +12:u03:PRAMEF15, +9:u04:AGAP6, +9:u05:BRCA2, +10:u08:SETD1B, +9:u10:rock1, +12:u11:pramef15, +9:u12:agap6, +9:u13:brca2, +8:u23:AGAP, +11:u00:SMARCB1, +9:u01:ROCK1, +12:u02:PRAMEF15, +9:u03:AGAP6, +9:u04:BRCA2, +8:u07:MYH9, +12:u10:pramef15, +9:u11:agap6, +9:u12:brca2, +7:u22:BRC, +8:u23:BRCA, +9:u00:ROCK1, +12:u01:PRAMEF15, +9:u02:AGAP6, +9:u03:BRCA2, +8:u06:MYH9, +10:u07:SETD1B, +9:u10:agap6, +9:u11:brca2, +8:u14:myh9, +12:u00:PRAMEF15, +9:u01:AGAP6, +9:u02:BRCA2, +8:u05:MYH9, +10:u06:SETD1B, +8:u08:FAT3, +9:u10:brca2, +8:u13:myh9, +10:u14:setd1b, +9:u00:AGAP6, +9:u01:BRCA2, +8:u04:MYH9, +10:u05:SETD1B, +9:u08:NCOR2, +8:u12:myh9, +10:u13:setd1b, +7:u22:MYH, +8:u23:MYH9, +9:u00:BRCA2, +8:u03:MYH9, +10:u04:SETD1B, +8:u07:FAT3, +9:u08:CDH10, +8:u11:myh9, +10:u12:setd1b, +8:u02:MYH9, +10:u03:SETD1B, +8:u06:FAT3, +9:u07:NCOR2, +8:u08:NBEA, +8:u10:myh9, +10:u11:setd1b, +8:u14:fat3, +8:u01:MYH9, +10:u02:SETD1B, +8:u05:FAT3, +9:u06:NCOR2, +9:u07:CDH10, +10:u08:PDGFRB, +10:u10:setd1b, +8:u13:fat3, +9:u14:ncor2, +8:u00:MYH9, +10:u01:SETD1B, +8:u04:FAT3, +9:u05:NCOR2, +9:u06:CDH10, +8:u07:NBEA, +9:u08:EPHA3, +8:u12:fat3, +9:u13:ncor2, +9:u14:cdh10, +8:u23:FAT3, +10:u00:SETD1B, +8:u03:FAT3, +9:u04:NCOR2, +9:u05:CDH10, +8:u06:NBEA, +10:u07:PDGFRB, +8:u08:NSD1, +8:u11:fat3, +9:u12:ncor2, +9:u13:cdh10, +8:u14:nbea, +8:u02:FAT3, +9:u03:NCOR2, +9:u04:CDH10, +8:u05:NBEA, +10:u06:PDGFRB, +9:u07:EPHA3, +7:u08:ATR, +8:u10:fat3, +9:u11:ncor2, +9:u12:cdh10, +8:u13:nbea, +10:u14:pdgfrb, +8:u01:FAT3, +9:u02:NCOR2, +9:u03:CDH10, +8:u04:NBEA, +10:u05:PDGFRB, +9:u06:EPHA3, +8:u07:NSD1, +9:u08:BIRC6, +9:u10:ncor2, +9:u11:cdh10, +8:u12:nbea, +10:u13:pdgfrb, +9:u14:epha3, +7:u22:NBE, +8:u23:NBEA, +8:u00:FAT3, +9:u01:NCOR2, +9:u02:CDH10, +8:u03:NBEA, +10:u04:PDGFRB, +9:u05:EPHA3, +8:u06:NSD1, +7:u07:ATR, +9:u08:ROBO2, +9:u10:cdh10, +8:u11:nbea, +10:u12:pdgfrb, +9:u13:epha3, +8:u14:nsd1, +9:u00:NCOR2, +9:u01:CDH10, +8:u02:NBEA, +10:u03:PDGFRB, +9:u04:EPHA3, +8:u05:NSD1, +7:u06:ATR, +9:u07:BIRC6, +9:u08:PTPRB, +8:u10:nbea, +10:u11:pdgfrb, +9:u12:epha3, +8:u13:nsd1, +7:u14:atr, +9:u00:CDH10, +8:u01:NBEA, +10:u02:PDGFRB, +9:u03:EPHA3, +8:u04:NSD1, +7:u05:ATR, +9:u06:BIRC6, +9:u07:ROBO2, +9:u08:MUC16, +10:u10:pdgfrb, +9:u11:epha3, +8:u12:nsd1, +7:u13:atr, +9:u14:birc6, +8:u23:NSD1, +8:u00:NBEA, +10:u01:PDGFRB, +9:u02:EPHA3, +8:u03:NSD1, +7:u04:ATR, +9:u05:BIRC6, +9:u06:ROBO2, +9:u07:PTPRB, +11:u08:PDE4DIP, +9:u10:epha3, +8:u11:nsd1, +7:u12:atr, +9:u13:birc6, +9:u14:robo2, +7:u23:ATR, +10:u00:PDGFRB, +9:u01:EPHA3, +8:u02:NSD1, +7:u03:ATR, +9:u04:BIRC6, +9:u05:ROBO2, +9:u06:PTPRB, +9:u07:MUC16, +8:u08:FAT4, +8:u10:nsd1, +7:u11:atr, +9:u12:birc6, +9:u13:robo2, +9:u14:ptprb, +8:u23:BIRC, +9:u00:EPHA3, +8:u01:NSD1, +7:u02:ATR, +9:u03:BIRC6, +9:u04:ROBO2, +9:u05:PTPRB, +9:u06:MUC16, +11:u07:PDE4DIP, +9:u08:TRRAP, +7:u10:atr, +9:u11:birc6, +9:u12:robo2, +9:u13:ptprb, +9:u14:muc16, +8:u23:ROBO, +8:u00:NSD1, +7:u01:ATR, +9:u02:BIRC6, +9:u03:ROBO2, +9:u04:PTPRB, +9:u05:MUC16, +11:u06:PDE4DIP, +8:u07:FAT4, +11:u08:SLC35G5, +9:u10:birc6, +9:u11:robo2, +9:u12:ptprb, +9:u13:muc16, +11:u14:pde4dip, +7:u00:ATR, +9:u01:BIRC6, +9:u02:ROBO2, +9:u03:PTPRB, +9:u04:MUC16, +11:u05:PDE4DIP, +8:u06:FAT4, +9:u07:TRRAP, +9:u08:DCTN1, +9:u10:robo2, +9:u11:ptprb, +9:u12:muc16, +11:u13:pde4dip, +8:u14:fat4, +8:u23:MUC1, +9:u00:BIRC6, +9:u01:ROBO2, +9:u02:PTPRB, +9:u03:MUC16, +11:u04:PDE4DIP, +8:u05:FAT4, +9:u06:TRRAP, +11:u07:SLC35G5, +9:u08:AKAP9, +9:u10:ptprb, +9:u11:muc16, +11:u12:pde4dip, +8:u13:fat4, +9:u14:trrap, +8:u23:PDE4, +9:u00:ROBO2, +9:u01:PTPRB, +9:u02:MUC16, +11:u03:PDE4DIP, +8:u04:FAT4, +9:u05:TRRAP, +11:u06:SLC35G5, +9:u07:DCTN1, +11:u08:CNTNAP2, +9:u10:muc16, +11:u11:pde4dip, +8:u12:fat4, +9:u13:trrap, +11:u14:slc35g5, +8:u23:FAT4, +9:u00:PTPRB, +9:u01:MUC16, +11:u02:PDE4DIP, +8:u03:FAT4, +9:u04:TRRAP, +11:u05:SLC35G5, +9:u06:DCTN1, +9:u07:AKAP9, +9:u08:N4BP2, +11:u10:pde4dip, +8:u11:fat4, +9:u12:trrap, +11:u13:slc35g5, +9:u14:dctn1, +7:u22:TRR, +8:u23:TRRA, +9:u00:MUC16, +11:u01:PDE4DIP, +8:u02:FAT4, +9:u03:TRRAP, +11:u04:SLC35G5, +9:u05:DCTN1, +9:u06:AKAP9, +11:u07:CNTNAP2, +9:u08:DDX3X, +8:u10:fat4, +9:u11:trrap, +11:u12:slc35g5, +9:u13:dctn1, +9:u14:akap9, +8:u23:SLC3, +11:u00:PDE4DIP, +8:u01:FAT4, +9:u02:TRRAP, +11:u03:SLC35G5, +9:u04:DCTN1, +9:u05:AKAP9, +11:u06:CNTNAP2, +9:u07:N4BP2, +7:u08:MET, +9:u10:trrap, +11:u11:slc35g5, +9:u12:dctn1, +9:u13:akap9, +11:u14:cntnap2, +7:u22:DCT, +8:u23:DCTN, +8:u00:FAT4, +9:u01:TRRAP, +11:u02:SLC35G5, +9:u03:DCTN1, +9:u04:AKAP9, +11:u05:CNTNAP2, +9:u06:N4BP2, +9:u07:DDX3X, +10:u08:PTPN11, +11:u10:slc35g5, +9:u11:dctn1, +9:u12:akap9, +11:u13:cntnap2, +9:u14:n4bp2, +7:u22:AKA, +8:u23:AKAP, +9:u00:TRRAP, +11:u01:SLC35G5, +9:u02:DCTN1, +9:u03:AKAP9, +11:u04:CNTNAP2, +9:u05:N4BP2, +9:u06:DDX3X, +7:u07:MET, +9:u10:dctn1, +9:u11:akap9, +11:u12:cntnap2, +9:u13:n4bp2, +9:u14:ddx3x, +11:u00:SLC35G5, +9:u01:DCTN1, +9:u02:AKAP9, +11:u03:CNTNAP2, +9:u04:N4BP2, +9:u05:DDX3X, +7:u06:MET, +10:u07:PTPN11, +11:u08:-log10q, +9:u10:akap9, +11:u11:cntnap2, +9:u12:n4bp2, +9:u13:ddx3x, +7:u14:met, +6:u21:N4, +7:u22:N4B, +8:u23:N4BP, +9:u00:DCTN1, +9:u01:AKAP9, +11:u02:CNTNAP2, +9:u03:N4BP2, +9:u04:DDX3X, +7:u05:MET, +10:u06:PTPN11, +11:u10:cntnap2, +9:u11:n4bp2, +9:u12:ddx3x, +7:u13:met, +10:u14:ptpn11, +7:u22:DDX, +8:u23:DDX3, +9:u00:AKAP9, +11:u01:CNTNAP2, +9:u02:N4BP2, +9:u03:DDX3X, +7:u04:MET, +10:u05:PTPN11, +11:u07:-log10q, +9:u10:n4bp2, +9:u11:ddx3x, +7:u12:met, +10:u13:ptpn11, +7:u23:MET, +11:u00:CNTNAP2, +9:u01:N4BP2, +9:u02:DDX3X, +7:u03:MET, +10:u04:PTPN11, +11:u06:-log10q, +9:u10:ddx3x, +7:u11:met, +10:u12:ptpn11, +11:u14:-log10q, +8:u23:PTPN, +9:u00:N4BP2, +9:u01:DDX3X, +7:u02:MET, +10:u03:PTPN11, +11:u05:-log10q, +7:u10:met, +10:u11:ptpn11, +11:u13:-log10q, +9:u00:DDX3X, +7:u01:MET, +10:u02:PTPN11, +11:u04:-log10q, +10:u10:ptpn11, +11:u12:-log10q, +7:u00:MET, +10:u01:PTPN11, +11:u03:-log10q, +11:u11:-log10q, +10:u00:PTPN11, +11:u02:-log10q, +8:u08:1872, +11:u10:-log10q, +11:u01:-log10q, +11:u00:-log10q, +8:u07:1872, +8:u06:1872, +8:u14:1872, +8:u05:1872, +13:u08:sotorasib, +8:u13:1872, +8:u04:1872, +13:u07:sotorasib, +8:u12:1872, +8:u23:1872, +8:u03:1872, +13:u06:sotorasib, +8:u11:1872, +8:u02:1872, +13:u05:sotorasib, +8:u10:1872, +8:u01:1872, +8:u08:toma, +13:u04:sotorasib, +10:u08:(13%),, +11:u14:thought, +8:u00:1872, +13:u03:sotorasib, +10:u07:(13%),, +14:u08:multiforme, +11:u13:thought, +8:u07:toma, +13:u08:Landscape, +13:u02:sotorasib, +10:u06:(13%),, +14:u07:multiforme, +11:u12:thought, +8:u06:toma, +13:u01:sotorasib, +10:u05:(13%),, +14:u06:multiforme, +11:u11:thought, +8:u14:toma, +8:u05:toma, +13:u07:Landscape, +13:u00:sotorasib, +10:u04:(13%),, +14:u05:multiforme, +11:u10:thought, +8:u13:toma, +8:u04:toma, +13:u06:Landscape, +10:u03:(13%),, +14:u04:multiforme, +8:u12:toma, +13:u14:landscape, +8:u03:toma, +13:u05:Landscape, +13:u08:dMMR/POLE, +10:u02:(13%),, +14:u03:multiforme, +8:u11:toma, +13:u13:landscape, +8:u02:toma, +13:u04:Landscape, +10:u08:(HRD),, +10:u01:(13%),, +14:u02:multiforme, +8:u10:toma, +13:u12:landscape, +8:u01:toma, +13:u03:Landscape, +13:u07:dMMR/POLE, +13:u08:notherapy, +10:u00:(13%),, +14:u01:multiforme, +13:u11:landscape, +8:u00:toma, +13:u02:Landscape, +13:u06:dMMR/POLE, +10:u07:(HRD),, +14:u00:multiforme, +13:u10:landscape, +13:u14:dmmr/pole, +13:u01:Landscape, +13:u05:dMMR/POLE, +10:u06:(HRD),, +13:u07:notherapy, +13:u13:dmmr/pole, +10:u14:(hrd),, +13:u00:Landscape, +13:u04:dMMR/POLE, +10:u05:(HRD),, +13:u06:notherapy, +13:u12:dmmr/pole, +10:u13:(hrd),, +13:u14:notherapy, +13:u03:dMMR/POLE, +10:u04:(HRD),, +13:u05:notherapy, +9:u08:24-28, +13:u11:dmmr/pole, +10:u12:(hrd),, +13:u13:notherapy, +8:u23:(HRD, +13:u02:dMMR/POLE, +10:u03:(HRD),, +13:u04:notherapy, +9:u07:24-28, +13:u10:dmmr/pole, +10:u11:(hrd),, +13:u12:notherapy, +13:u01:dMMR/POLE, +10:u02:(HRD),, +13:u03:notherapy, +9:u06:24-28, +10:u10:(hrd),, +13:u11:notherapy, +13:u00:dMMR/POLE, +10:u01:(HRD),, +13:u02:notherapy, +9:u05:24-28, +12:u08:germline, +13:u10:notherapy, +10:u00:(HRD),, +13:u01:notherapy, +9:u04:24-28, +12:u07:germline, +13:u00:notherapy, +9:u03:24-28, +12:u06:germline, +9:u02:24-28, +12:u05:germline, +9:u01:24-28, +12:u04:germline, +9:u00:24-28, +12:u03:germline, +12:u02:germline, +12:u14:eligible, +12:u01:germline, +12:u13:eligible, +12:u00:germline, +9:u08:1,312, +12:u12:eligible, +8:u23:elig, +9:u07:1,312, +12:u11:eligible, +9:u06:1,312, +12:u08:patient,, +12:u10:eligible, +9:u05:1,312, +12:u07:patient,, +9:u04:1,312, +12:u06:patient,, +9:u03:1,312, +12:u05:patient,, +9:u08:6,151, +9:u02:1,312, +12:u04:patient,, +9:u07:6,151, +10:u08:(1,361, +9:u01:1,312, +12:u03:patient,, +9:u06:6,151, +10:u07:(1,361, +9:u00:1,312, +12:u02:patient,, +9:u05:6,151, +10:u06:(1,361, +7:u14:13%, +10:uI2:,(,,),, +12:u01:patient,, +9:u04:6,151, +10:u05:(1,361, +7:u13:13%, +10:uI1:,(,,),, +12:uI2:(,,)(,,), +12:u00:patient,, +9:u03:6,151, +10:u04:(1,361, +7:u12:13%, +7:u22:13%, +7:u23:13%, +10:uI0:,(,,),, +12:uI1:(,,)(,,), +7:u08:261, +9:u02:6,151, +10:u03:(1,361, +7:u11:13%, +12:uI0:(,,)(,,), +10:u08:COSMIC, +9:u01:6,151, +10:u02:(1,361, +9:u08:(79%), +7:u10:13%, +7:u07:261, +9:u00:6,151, +10:u01:(1,361, +9:u07:(79%), +7:u06:261, +10:u07:COSMIC, +10:u00:(1,361, +9:u06:(79%), +7:u14:261, +7:u05:261, +10:u06:COSMIC, +9:u05:(79%), +7:u13:261, +7:u04:261, +10:u05:COSMIC, +9:u08:base,, +9:u04:(79%), +10:u08:DepMap, +7:u12:261, +7:u23:261, +7:u03:261, +10:u04:COSMIC, +9:u03:(79%), +10:u07:DepMap, +11:u08:canSAR,, +7:u11:261, +7:u22:COS, +8:u23:COSM, +7:u02:261, +10:u03:COSMIC, +9:u07:base,, +9:u02:(79%), +10:u06:DepMap, +11:u07:canSAR,, +7:u10:261, +7:u01:261, +10:u02:COSMIC, +9:u06:base,, +9:u01:(79%), +10:u05:DepMap, +11:u06:canSAR,, +9:u14:base,, +7:u00:261, +10:u01:COSMIC, +9:u05:base,, +13:u08:Motivated, +9:u00:(79%), +10:u04:DepMap, +11:u05:canSAR,, +8:u08:(3D), +9:u13:base,, +10:uI2:,,,.(), +10:u00:COSMIC, +9:u04:base,, +10:u03:DepMap, +11:u04:canSAR,, +8:u07:(3D), +9:u12:base,, +10:uI1:,,,.(), +9:u03:base,, +13:u07:Motivated, +10:u02:DepMap, +11:u03:canSAR,, +8:u06:(3D), +9:u11:base,, +10:uI0:,,,.(), +9:u02:base,, +13:u06:Motivated, +10:u01:DepMap, +11:u02:canSAR,, +8:u05:(3D), +9:u10:base,, +13:u14:motivated, +9:u01:base,, +13:u05:Motivated, +10:u00:DepMap, +11:u01:canSAR,, +8:u04:(3D), +9:u08:34,35, +13:u13:motivated, +9:u00:base,, +13:u04:Motivated, +11:u00:canSAR,, +8:u03:(3D), +9:u07:34,35, +13:u12:motivated, +13:u03:Motivated, +8:u02:(3D), +9:u06:34,35, +13:u11:motivated, +13:u02:Motivated, +8:u01:(3D), +9:u05:34,35, +13:u10:motivated, +13:u01:Motivated, +19:u08:Breast_DuctalCA, +8:u00:(3D), +9:u04:34,35, +13:u00:Motivated, +20:u08:Breast_LobularCA, +9:u03:34,35, +19:u07:Breast_DuctalCA, +9:u02:34,35, +19:u06:Breast_DuctalCA, +20:u07:Breast_LobularCA, +9:u01:34,35, +19:u14:breast_ductalca, +19:u05:Breast_DuctalCA, +20:u06:Breast_LobularCA, +9:u00:34,35, +19:u13:breast_ductalca, +20:u14:breast_lobularca, +19:u04:Breast_DuctalCA, +20:u05:Breast_LobularCA, +19:u12:breast_ductalca, +20:u13:breast_lobularca, +19:u03:Breast_DuctalCA, +20:u04:Breast_LobularCA, +19:u11:breast_ductalca, +20:u12:breast_lobularca, +19:u02:Breast_DuctalCA, +20:u03:Breast_LobularCA, +19:u10:breast_ductalca, +20:u11:breast_lobularca, +19:u01:Breast_DuctalCA, +20:u02:Breast_LobularCA, +20:u10:breast_lobularca, +19:u00:Breast_DuctalCA, +20:u01:Breast_LobularCA, +20:u00:Breast_LobularCA, +13:u08:CNS_Astro, +18:u08:CNS_GBM_IDHmut, +13:u07:CNS_Astro, +17:u08:CNS_GBM_IDHwt, +13:u06:CNS_Astro, +18:u07:CNS_GBM_IDHmut, +13:u08:CNS_Menin, +13:u14:cns_astro, +13:u05:CNS_Astro, +18:u06:CNS_GBM_IDHmut, +17:u07:CNS_GBM_IDHwt, +13:u08:CNS_Oligo, +13:u13:cns_astro, +18:u14:cns_gbm_idhmut, +13:u04:CNS_Astro, +18:u05:CNS_GBM_IDHmut, +17:u06:CNS_GBM_IDHwt, +13:u07:CNS_Menin, +16:u08:Kidney_CCRCC, +13:u12:cns_astro, +18:u13:cns_gbm_idhmut, +17:u14:cns_gbm_idhwt, +8:u23:CNS_, +13:u03:CNS_Astro, +18:u04:CNS_GBM_IDHmut, +17:u05:CNS_GBM_IDHwt, +13:u06:CNS_Menin, +13:u07:CNS_Oligo, +16:u08:Kidney_ChRCC, +13:u11:cns_astro, +18:u12:cns_gbm_idhmut, +17:u13:cns_gbm_idhwt, +13:u14:cns_menin, +13:u02:CNS_Astro, +18:u03:CNS_GBM_IDHmut, +17:u04:CNS_GBM_IDHwt, +13:u05:CNS_Menin, +13:u06:CNS_Oligo, +16:u07:Kidney_CCRCC, +13:u10:cns_astro, +18:u11:cns_gbm_idhmut, +17:u12:cns_gbm_idhwt, +13:u13:cns_menin, +13:u14:cns_oligo, +13:u01:CNS_Astro, +18:u02:CNS_GBM_IDHmut, +17:u03:CNS_GBM_IDHwt, +13:u04:CNS_Menin, +13:u05:CNS_Oligo, +16:u06:Kidney_CCRCC, +16:u07:Kidney_ChRCC, +10:u08:Kidney, +18:u10:cns_gbm_idhmut, +17:u11:cns_gbm_idhwt, +13:u12:cns_menin, +13:u13:cns_oligo, +16:u14:kidney_ccrcc, +13:u00:CNS_Astro, +18:u01:CNS_GBM_IDHmut, +17:u02:CNS_GBM_IDHwt, +13:u03:CNS_Menin, +13:u04:CNS_Oligo, +16:u05:Kidney_CCRCC, +16:u06:Kidney_ChRCC, +7:u08:CNS, +17:u10:cns_gbm_idhwt, +13:u11:cns_menin, +13:u12:cns_oligo, +16:u13:kidney_ccrcc, +16:u14:kidney_chrcc, +18:u00:CNS_GBM_IDHmut, +17:u01:CNS_GBM_IDHwt, +13:u02:CNS_Menin, +13:u03:CNS_Oligo, +16:u04:Kidney_CCRCC, +16:u05:Kidney_ChRCC, +10:u07:Kidney, +14:u08:Connective, +13:u10:cns_menin, +13:u11:cns_oligo, +16:u12:kidney_ccrcc, +16:u13:kidney_chrcc, +17:u00:CNS_GBM_IDHwt, +13:u01:CNS_Menin, +13:u02:CNS_Oligo, +16:u03:Kidney_CCRCC, +16:u04:Kidney_ChRCC, +10:u06:Kidney, +7:u07:CNS, +22:u08:Connective_Chondro, +14:u07:Connective, +13:u10:cns_oligo, +16:u11:kidney_ccrcc, +16:u12:kidney_chrcc, +10:u14:kidney, +13:u00:CNS_Menin, +13:u01:CNS_Oligo, +16:u02:Kidney_CCRCC, +16:u03:Kidney_ChRCC, +10:u05:Kidney, +7:u06:CNS, +22:u08:Connective_Leiomyo, +14:u06:Connective, +16:u10:kidney_ccrcc, +16:u11:kidney_chrcc, +10:u13:kidney, +7:u14:cns, +13:u00:CNS_Oligo, +16:u01:Kidney_CCRCC, +16:u02:Kidney_ChRCC, +10:u04:Kidney, +7:u05:CNS, +22:u07:Connective_Chondro, +23:u08:Connective_Liposarc, +14:u05:Connective, +16:u10:kidney_chrcc, +10:u12:kidney, +7:u13:cns, +16:u00:Kidney_CCRCC, +16:u01:Kidney_ChRCC, +10:u03:Kidney, +7:u04:CNS, +22:u06:Connective_Chondro, +22:u07:Connective_Leiomyo, +24:u08:Connective_Myxofibro, +14:u04:Connective, +10:u11:kidney, +7:u12:cns, +22:u14:connective_chondro, +7:u23:CNS, +16:u00:Kidney_ChRCC, +10:u02:Kidney, +7:u03:CNS, +22:u05:Connective_Chondro, +22:u06:Connective_Leiomyo, +23:u07:Connective_Liposarc, +24:u08:Connective_Osteosarc, +14:u03:Connective, +10:u10:kidney, +7:u11:cns, +22:u13:connective_chondro, +22:u14:connective_leiomyo, +10:u01:Kidney, +7:u02:CNS, +22:u04:Connective_Chondro, +22:u05:Connective_Leiomyo, +23:u06:Connective_Liposarc, +24:u07:Connective_Myxofibro, +18:u08:Connective_SCS, +14:u02:Connective, +7:u10:cns, +22:u12:connective_chondro, +22:u13:connective_leiomyo, +23:u14:connective_liposarc, +10:u00:Kidney, +7:u01:CNS, +22:u03:Connective_Chondro, +22:u04:Connective_Leiomyo, +23:u05:Connective_Liposarc, +24:u06:Connective_Myxofibro, +24:u07:Connective_Osteosarc, +17:u08:Connective_SS, +14:u01:Connective, +22:u11:connective_chondro, +22:u12:connective_leiomyo, +23:u13:connective_liposarc, +24:u14:connective_myxofibro, +7:u00:CNS, +22:u02:Connective_Chondro, +22:u03:Connective_Leiomyo, +23:u04:Connective_Liposarc, +24:u05:Connective_Myxofibro, +24:u06:Connective_Osteosarc, +18:u07:Connective_SCS, +16:u08:Lung_AdenoCA, +14:u00:Connective, +22:u10:connective_chondro, +22:u11:connective_leiomyo, +23:u12:connective_liposarc, +24:u13:connective_myxofibro, +24:u14:connective_osteosarc, +22:u01:Connective_Chondro, +22:u02:Connective_Leiomyo, +23:u03:Connective_Liposarc, +24:u04:Connective_Myxofibro, +24:u05:Connective_Osteosarc, +18:u06:Connective_SCS, +17:u07:Connective_SS, +18:u08:Lung_LargeCell, +22:u10:connective_leiomyo, +23:u11:connective_liposarc, +24:u12:connective_myxofibro, +24:u13:connective_osteosarc, +18:u14:connective_scs, +22:u00:Connective_Chondro, +22:u01:Connective_Leiomyo, +23:u02:Connective_Liposarc, +24:u03:Connective_Myxofibro, +24:u04:Connective_Osteosarc, +18:u05:Connective_SCS, +17:u06:Connective_SS, +16:u07:Lung_AdenoCA, +12:u08:Lung_SCC, +23:u10:connective_liposarc, +24:u11:connective_myxofibro, +24:u12:connective_osteosarc, +18:u13:connective_scs, +17:u14:connective_ss, +22:u00:Connective_Leiomyo, +23:u01:Connective_Liposarc, +24:u02:Connective_Myxofibro, +24:u03:Connective_Osteosarc, +18:u04:Connective_SCS, +17:u05:Connective_SS, +16:u06:Lung_AdenoCA, +18:u07:Lung_LargeCell, +18:u08:Lung_SmallCell, +24:u10:connective_myxofibro, +24:u11:connective_osteosarc, +18:u12:connective_scs, +17:u13:connective_ss, +16:u14:lung_adenoca, +23:u00:Connective_Liposarc, +24:u01:Connective_Myxofibro, +24:u02:Connective_Osteosarc, +18:u03:Connective_SCS, +17:u04:Connective_SS, +16:u05:Lung_AdenoCA, +18:u06:Lung_LargeCell, +12:u07:Lung_SCC, +15:u08:Kidney_PRCC, +24:u10:connective_osteosarc, +18:u11:connective_scs, +17:u12:connective_ss, +16:u13:lung_adenoca, +18:u14:lung_largecell, +24:u00:Connective_Myxofibro, +24:u01:Connective_Osteosarc, +18:u02:Connective_SCS, +17:u03:Connective_SS, +16:u04:Lung_AdenoCA, +18:u05:Lung_LargeCell, +12:u06:Lung_SCC, +18:u07:Lung_SmallCell, +18:u10:connective_scs, +17:u11:connective_ss, +16:u12:lung_adenoca, +18:u13:lung_largecell, +12:u14:lung_scc, +24:u00:Connective_Osteosarc, +18:u01:Connective_SCS, +17:u02:Connective_SS, +16:u03:Lung_AdenoCA, +18:u04:Lung_LargeCell, +12:u05:Lung_SCC, +18:u06:Lung_SmallCell, +15:u07:Kidney_PRCC, +17:u10:connective_ss, +16:u11:lung_adenoca, +18:u12:lung_largecell, +12:u13:lung_scc, +18:u14:lung_smallcell, +18:u00:Connective_SCS, +17:u01:Connective_SS, +16:u02:Lung_AdenoCA, +18:u03:Lung_LargeCell, +12:u04:Lung_SCC, +18:u05:Lung_SmallCell, +15:u06:Kidney_PRCC, +16:u10:lung_adenoca, +18:u11:lung_largecell, +12:u12:lung_scc, +18:u13:lung_smallcell, +15:u14:kidney_prcc, +17:u00:Connective_SS, +16:u01:Lung_AdenoCA, +18:u02:Lung_LargeCell, +12:u03:Lung_SCC, +18:u04:Lung_SmallCell, +15:u05:Kidney_PRCC, +18:u10:lung_largecell, +12:u11:lung_scc, +18:u12:lung_smallcell, +15:u13:kidney_prcc, +16:u00:Lung_AdenoCA, +18:u01:Lung_LargeCell, +12:u02:Lung_SCC, +18:u03:Lung_SmallCell, +15:u04:Kidney_PRCC, +12:u10:lung_scc, +18:u11:lung_smallcell, +15:u12:kidney_prcc, +18:u00:Lung_LargeCell, +12:u01:Lung_SCC, +18:u02:Lung_SmallCell, +15:u03:Kidney_PRCC, +18:u10:lung_smallcell, +15:u11:kidney_prcc, +12:u00:Lung_SCC, +18:u01:Lung_SmallCell, +15:u02:Kidney_PRCC, +15:u10:kidney_prcc, +18:u00:Lung_SmallCell, +15:u01:Kidney_PRCC, +15:u00:Kidney_PRCC, +8:u08:TERT, +8:u07:TERT, +8:u06:TERT, +9:u08:KDM5C, +8:u14:tert, +8:u05:TERT, +8:u13:tert, +8:u04:TERT, +9:u07:KDM5C, +8:u12:tert, +8:u23:TERT, +8:u03:TERT, +9:u06:KDM5C, +8:u11:tert, +9:u14:kdm5c, +8:u02:TERT, +9:u05:KDM5C, +8:u10:tert, +9:u13:kdm5c, +8:u01:TERT, +9:u04:KDM5C, +9:u12:kdm5c, +8:u23:KDM5, +8:u00:TERT, +9:u03:KDM5C, +9:u11:kdm5c, +9:u02:KDM5C, +9:u10:kdm5c, +9:u01:KDM5C, +9:u00:KDM5C, +9:u08:CMTR2, +9:u07:CMTR2, +9:u06:CMTR2, +9:u14:cmtr2, +9:u05:CMTR2, +9:u13:cmtr2, +9:u04:CMTR2, +9:u12:cmtr2, +8:u23:CMTR, +9:u03:CMTR2, +9:u11:cmtr2, +9:u02:CMTR2, +9:u10:cmtr2, +9:u01:CMTR2, +9:u00:CMTR2, +9:u08:RASA1, +9:u07:RASA1, +9:u06:RASA1, +9:u14:rasa1, +9:u05:RASA1, +9:u13:rasa1, +9:u04:RASA1, +9:u12:rasa1, +9:u03:RASA1, +9:u11:rasa1, +9:u02:RASA1, +16:u08:histologies., +9:u10:rasa1, +9:u01:RASA1, +9:u00:RASA1, +16:u07:histologies., +9:u08:1,110, +16:u06:histologies., +16:u14:histologies., +16:u05:histologies., +9:u07:1,110, +14:u08:histology., +16:u13:histologies., +16:u04:histologies., +9:u06:1,110, +16:u12:histologies., +9:u14:1,110, +12:uI2:(,,(),,,, +16:u03:histologies., +9:u05:1,110, +14:u07:histology., +16:u11:histologies., +9:u13:1,110, +12:uI1:(,,(),,,, +16:u02:histologies., +9:u04:1,110, +14:u06:histology., +8:u08:1873, +16:u10:histologies., +9:u12:1,110, +14:u14:histology., +8:u23:1,11, +12:uI0:(,,(),,,, +16:u01:histologies., +9:u03:1,110, +14:u05:histology., +9:u11:1,110, +14:u13:histology., +16:u00:histologies., +9:u02:1,110, +14:u04:histology., +8:u07:1873, +9:u10:1,110, +14:u12:histology., +9:u01:1,110, +14:u03:histology., +8:u06:1873, +14:u11:histology., +8:u14:1873, +9:u00:1,110, +14:u02:histology., +8:u05:1873, +19:u08:'druggability',, +14:u10:histology., +8:u13:1873, +14:u01:histology., +8:u04:1873, +8:u12:1873, +8:u23:1873, +14:u00:histology., +8:u03:1873, +19:u07:'druggability',, +8:u11:1873, +8:u02:1873, +19:u06:'druggability',, +8:u10:1873, +19:u14:'druggability',, +8:u01:1873, +19:u05:'druggability',, +19:u13:'druggability',, +8:u00:1873, +19:u04:'druggability',, +19:u12:'druggability',, +8:u23:'dru, +19:u03:'druggability',, +19:u11:'druggability',, +19:u02:'druggability',, +19:u10:'druggability',, +19:u01:'druggability',, +19:u00:'druggability',, +18:u08:cancer-network, +10:uI2:.,.-)., +14:u08:proteins)., +10:uI1:.,.-)., +18:u07:cancer-network, +14:u07:proteins)., +9:u08:CDK1,, +10:uI0:.,.-)., +18:u06:cancer-network, +14:u08:targetable, +14:u06:proteins)., +9:u07:CDK1,, +18:u14:cancer-network, +18:u05:cancer-network, +14:u05:proteins)., +9:u06:CDK1,, +18:u13:cancer-network, +18:u04:cancer-network, +14:u07:targetable, +14:u04:proteins)., +9:u05:CDK1,, +18:u12:cancer-network, +18:u03:cancer-network, +14:u06:targetable, +14:u03:proteins)., +9:u04:CDK1,, +18:u11:cancer-network, +14:u14:targetable, +18:u02:cancer-network, +14:u05:targetable, +14:u02:proteins)., +9:u03:CDK1,, +18:u10:cancer-network, +14:u13:targetable, +18:u01:cancer-network, +14:u04:targetable, +14:u01:proteins)., +9:u02:CDK1,, +14:u12:targetable, +18:u00:cancer-network, +14:u03:targetable, +14:u00:proteins)., +9:u01:CDK1,, +14:u11:targetable, +14:u02:targetable, +11:u08:pre-RNA, +9:u00:CDK1,, +14:u10:targetable, +14:u01:targetable, +12:u08:splicing, +14:u00:targetable, +11:u07:pre-RNA, +11:u08:lineage, +12:u07:splicing, +11:u06:pre-RNA, +12:u06:splicing, +11:u14:pre-rna, +9:uI2:,,()/, +11:u05:pre-RNA, +11:u07:lineage, +12:u05:splicing, +11:u13:pre-rna, +9:uI1:,,()/, +11:u04:pre-RNA, +11:u06:lineage, +12:u04:splicing, +11:u12:pre-rna, +11:u14:lineage, +9:uI0:,,()/, +11:u03:pre-RNA, +11:u05:lineage, +12:u03:splicing, +11:u11:pre-rna, +11:u13:lineage, +11:u02:pre-RNA, +11:u04:lineage, +12:u02:splicing, +11:u10:pre-rna, +11:u12:lineage, +11:u01:pre-RNA, +11:u03:lineage, +12:u01:splicing, +11:u11:lineage, +11:u00:pre-RNA, +11:u02:lineage, +12:u00:splicing, +11:u10:lineage, +11:u01:lineage, +11:u00:lineage, +17:u08:consideration, +11:u08:ylation, +17:u07:consideration, +17:u06:consideration, +11:u07:ylation, +17:u14:consideration, +17:u05:consideration, +11:u06:ylation, +17:u13:consideration, +11:u14:ylation, +17:u04:consideration, +11:u05:ylation, +17:u12:consideration, +11:u13:ylation, +17:u03:consideration, +11:u04:ylation, +17:u11:consideration, +11:u12:ylation, +10:u14:serves, +7:u22:yla, +8:u23:ylat, +17:u02:consideration, +11:u03:ylation, +17:u10:consideration, +11:u11:ylation, +10:u13:serves, +17:u01:consideration, +11:u02:ylation, +11:u10:ylation, +10:u12:serves, +9:u14:imply, +17:u00:consideration, +11:u01:ylation, +10:u11:serves, +9:u13:imply, +11:u00:ylation, +10:u10:serves, +9:u12:imply, +9:u11:imply, +9:u10:imply, +13:u08:approvals, +9:u08:proxy, +9:u07:proxy, +13:u07:approvals, +9:u06:proxy, +13:u06:approvals, +9:u05:proxy, +13:u14:approvals, +13:u05:approvals, +9:u04:proxy, +13:u13:approvals, +13:u04:approvals, +9:u03:proxy, +13:u12:approvals, +13:u03:approvals, +9:u02:proxy, +13:u11:approvals, +13:u02:approvals, +9:u01:proxy, +13:u10:approvals, +13:u01:approvals, +13:u08:endeavors, +9:u00:proxy, +13:u00:approvals, +13:u07:endeavors, +13:u06:endeavors, +13:u14:endeavors, +13:u05:endeavors, +13:u13:endeavors, +13:u04:endeavors, +13:u12:endeavors, +13:u03:endeavors, +13:u11:endeavors, +13:u02:endeavors, +9:u08:BCL9L, +13:u10:endeavors, +13:u01:endeavors, +13:u00:endeavors, +9:u07:BCL9L, +9:u06:BCL9L, +9:u14:bcl9l, +9:u05:BCL9L, +10:u08:INPPL1, +9:u13:bcl9l, +9:u04:BCL9L, +9:u12:bcl9l, +7:u22:BCL, +8:u23:BCL9, +9:u03:BCL9L, +10:u07:INPPL1, +9:u11:bcl9l, +9:u02:BCL9L, +10:u06:INPPL1, +9:u10:bcl9l, +10:u14:inppl1, +9:u01:BCL9L, +10:u05:INPPL1, +10:u13:inppl1, +9:u00:BCL9L, +10:u04:INPPL1, +10:u12:inppl1, +7:u22:INP, +8:u23:INPP, +10:u03:INPPL1, +10:u11:inppl1, +10:u02:INPPL1, +10:u10:inppl1, +10:u01:INPPL1, +10:u00:INPPL1, +11:u08:ZFP36L2, +11:u07:ZFP36L2, +11:u06:ZFP36L2, +11:u14:zfp36l2, +11:u05:ZFP36L2, +11:u13:zfp36l2, +11:u04:ZFP36L2, +11:u12:zfp36l2, +8:u23:ZFP3, +11:u03:ZFP36L2, +11:u11:zfp36l2, +11:u02:ZFP36L2, +11:u10:zfp36l2, +11:u01:ZFP36L2, +11:u00:ZFP36L2, +9:u08:3,000, +9:u07:3,000, +9:u06:3,000, +9:u14:3,000, +9:u05:3,000, +9:u13:3,000, +9:u04:3,000, +9:u12:3,000, +8:u23:3,00, +9:u03:3,000, +9:u11:3,000, +9:u02:3,000, +9:u10:3,000, +9:u01:3,000, +9:u00:3,000, +14:u08:mutations., +14:u07:mutations., +13:u14:oncogenic, +14:u06:mutations., +13:u13:oncogenic, +14:u05:mutations., +13:u12:oncogenic, +14:u04:mutations., +13:u11:oncogenic, +14:u03:mutations., +13:u10:oncogenic, +13:u08:subclonal, +14:u02:mutations., +14:u01:mutations., +13:u07:subclonal, +14:u00:mutations., +13:u06:subclonal, +13:u14:subclonal, +13:u05:subclonal, +8:u08:1874, +13:u13:subclonal, +13:u04:subclonal, +13:u12:subclonal, +13:u03:subclonal, +8:u07:1874, +13:u11:subclonal, +13:u02:subclonal, +8:u06:1874, +13:u10:subclonal, +8:u14:1874, +13:u01:subclonal, +8:u05:1874, +8:u13:1874, +13:u00:subclonal, +8:u04:1874, +8:u12:1874, +8:u23:1874, +8:u03:1874, +8:u11:1874, +8:u02:1874, +12:u08:ensuring, +8:u10:1874, +8:u01:1874, +8:u00:1874, +12:u07:ensuring, +12:u06:ensuring, +12:u08:Kingdom,, +12:u14:ensuring, +12:u05:ensuring, +12:u13:ensuring, +12:u04:ensuring, +12:u07:Kingdom,, +15:u08:early-stage, +12:u12:ensuring, +12:u03:ensuring, +12:u06:Kingdom,, +15:u07:early-stage, +12:u11:ensuring, +12:u14:kingdom,, +12:u02:ensuring, +12:u05:Kingdom,, +15:u06:early-stage, +12:u10:ensuring, +12:u13:kingdom,, +12:u01:ensuring, +12:u04:Kingdom,, +15:u05:early-stage, +12:u12:kingdom,, +12:u14:ancestry, +12:u00:ensuring, +12:u03:Kingdom,, +15:u04:early-stage, +12:u11:kingdom,, +12:u13:ancestry, +12:u02:Kingdom,, +15:u03:early-stage, +12:u10:kingdom,, +12:u12:ancestry, +12:u01:Kingdom,, +15:u02:early-stage, +12:u11:ancestry, +12:u00:Kingdom,, +15:u01:early-stage, +12:u10:ancestry, +15:u00:early-stage, +10:u08:OncoKB, +17:u08:actionability, +10:u07:OncoKB, +17:u07:actionability, +10:u06:OncoKB, +17:u06:actionability, +10:u14:oncokb, +10:u05:OncoKB, +17:u05:actionability, +10:u13:oncokb, +10:u04:OncoKB, +17:u04:actionability, +10:u12:oncokb, +10:u03:OncoKB, +12:u08:Approved, +17:u03:actionability, +10:u11:oncokb, +10:u02:OncoKB, +17:u02:actionability, +12:u08:marketed, +10:u10:oncokb, +10:u01:OncoKB, +12:u07:Approved, +17:u01:actionability, +12:u07:marketed, +10:u00:OncoKB, +12:u06:Approved, +17:u00:actionability, +12:u06:marketed, +12:u05:Approved, +12:u05:marketed, +12:u04:Approved, +12:u04:marketed, +12:u03:Approved, +12:u03:marketed, +12:u02:Approved, +12:u02:marketed, +12:u01:Approved, +12:u01:marketed, +12:u00:Approved, +12:u00:marketed, +9:u08:gene., +9:u07:gene., +9:u06:gene., +9:u14:gene., +9:u05:gene., +9:u13:gene., +9:u04:gene., +9:u12:gene., +9:u03:gene., +9:u11:gene., +9:u02:gene., +9:u10:gene., +9:u01:gene., +8:u08:1875, +9:u00:gene., +8:u07:1875, +8:u06:1875, +8:u14:1875, +8:u05:1875, +8:u13:1875, +8:u04:1875, +13:u08:Accepting, +8:u12:1875, +8:u23:1875, +8:u03:1875, +8:u11:1875, +8:u02:1875, +13:u07:Accepting, +8:u10:1875, +8:u01:1875, +13:u06:Accepting, +11:u08:driver., +13:u14:accepting, +8:u00:1875, +13:u05:Accepting, +13:u13:accepting, +13:u04:Accepting, +11:u07:driver., +13:u12:accepting, +13:u03:Accepting, +11:u06:driver., +13:u11:accepting, +11:u14:driver., +13:u02:Accepting, +11:u05:driver., +13:u10:accepting, +11:u13:driver., +13:u01:Accepting, +11:u04:driver., +18:u08:FDA-recognized, +11:u12:driver., +13:u00:Accepting, +11:u03:driver., +11:u08:grouped, +11:u11:driver., +11:u02:driver., +18:u07:FDA-recognized, +11:u10:driver., +11:u01:driver., +18:u06:FDA-recognized, +11:u07:grouped, +15:u08:erroneously, +18:u14:fda-recognized, +11:u00:driver., +18:u05:FDA-recognized, +11:u06:grouped, +15:u07:erroneously, +18:u13:fda-recognized, +11:u14:grouped, +18:u04:FDA-recognized, +11:u05:grouped, +15:u06:erroneously, +18:u12:fda-recognized, +11:u13:grouped, +8:u23:FDA-, +18:u03:FDA-recognized, +11:u04:grouped, +15:u05:erroneously, +18:u11:fda-recognized, +11:u12:grouped, +18:u02:FDA-recognized, +11:u03:grouped, +13:u08:biomarker, +15:u04:erroneously, +18:u10:fda-recognized, +11:u11:grouped, +18:u01:FDA-recognized, +11:u02:grouped, +15:u03:erroneously, +11:u10:grouped, +18:u00:FDA-recognized, +11:u01:grouped, +13:u07:biomarker, +15:u02:erroneously, +11:u00:grouped, +13:u06:biomarker, +15:u01:erroneously, +13:u14:biomarker, +13:u05:biomarker, +15:u00:erroneously, +13:u13:biomarker, +13:u04:biomarker, +13:u12:biomarker, +13:u03:biomarker, +13:u11:biomarker, +13:u02:biomarker, +20:u08:well-established, +13:u10:biomarker, +13:u01:biomarker, +20:u07:well-established, +13:u00:biomarker, +20:u06:well-established, +20:u05:well-established, +19:u08:cancer-specific, +20:u04:well-established, +19:u07:cancer-specific, +20:u03:well-established, +19:u06:cancer-specific, +9:u08:100×, +20:u02:well-established, +19:u05:cancer-specific, +9:u07:100×, +20:u01:well-established, +19:u04:cancer-specific, +9:u06:100×, +11:u08:barrier, +9:uI2:--,.,, +20:u00:well-established, +19:u03:cancer-specific, +9:u05:100×, +11:u07:barrier, +9:uI1:--,.,, +19:u02:cancer-specific, +9:u04:100×, +11:u06:barrier, +9:uI0:--,.,, +16:u08:oncoprotein., +19:u01:cancer-specific, +9:u03:100×, +11:u05:barrier, +19:u00:cancer-specific, +9:u02:100×, +11:u04:barrier, +16:u07:oncoprotein., +9:u01:100×, +11:u03:barrier, +14:u08:degraders,, +16:u06:oncoprotein., +7:u08:WGS, +9:u00:100×, +11:u02:barrier, +14:u07:degraders,, +8:u08:seek, +16:u14:oncoprotein., +16:u05:oncoprotein., +11:u01:barrier, +14:u06:degraders,, +8:u07:seek, +16:u13:oncoprotein., +16:u04:oncoprotein., +7:u07:WGS, +11:u00:barrier, +14:u05:degraders,, +8:u06:seek, +16:u12:oncoprotein., +16:u03:oncoprotein., +7:u06:WGS, +14:u04:degraders,, +8:u05:seek, +16:u11:oncoprotein., +7:u14:wgs, +9:uI2:''-.,, +16:u02:oncoprotein., +7:u05:WGS, +14:u03:degraders,, +8:u04:seek, +16:u10:oncoprotein., +7:u13:wgs, +9:uI1:''-.,, +16:u01:oncoprotein., +7:u04:WGS, +8:u08:PARP, +14:u02:degraders,, +8:u03:seek, +7:u12:wgs, +11:u14:benefit, +7:u22:WGS, +7:u23:WGS, +9:uI0:''-.,, +16:u00:oncoprotein., +7:u03:WGS, +14:u01:degraders,, +8:u02:seek, +15:u08:inhibition,, +7:u11:wgs, +11:u13:benefit, +7:u02:WGS, +8:u07:PARP, +14:u00:degraders,, +8:u01:seek, +15:u07:inhibition,, +7:u10:wgs, +11:u12:benefit, +7:u01:WGS, +8:u06:PARP, +8:u00:seek, +15:u06:inhibition,, +11:u11:benefit, +8:u14:parp, +7:u00:WGS, +8:u05:PARP, +15:u05:inhibition,, +11:u10:benefit, +8:u13:parp, +8:u04:PARP, +15:u04:inhibition,, +14:u08:mutational, +8:u12:parp, +8:u23:PARP, +8:u03:PARP, +14:u08:signatures, +15:u03:inhibition,, +14:u07:mutational, +13:u08:companion, +8:u11:parp, +8:u02:PARP, +15:u02:inhibition,, +14:u06:mutational, +13:u07:companion, +8:u10:parp, +8:u01:PARP, +14:u07:signatures, +15:u01:inhibition,, +14:u05:mutational, +13:u06:companion, +8:u00:PARP, +14:u06:signatures, +15:u00:inhibition,, +14:u04:mutational, +13:u05:companion, +14:u14:signatures, +14:u05:signatures, +14:u03:mutational, +13:u04:companion, +14:u13:signatures, +14:u04:signatures, +14:u02:mutational, +13:u03:companion, +14:u12:signatures, +14:u03:signatures, +14:u01:mutational, +13:u02:companion, +18:u08:tumor-specific, +14:u11:signatures, +14:u02:signatures, +14:u00:mutational, +13:u01:companion, +18:u07:tumor-specific, +14:u10:signatures, +14:u01:signatures, +13:u00:companion, +18:u06:tumor-specific, +14:u00:signatures, +18:u05:tumor-specific, +18:u04:tumor-specific, +18:u03:tumor-specific, +14:u08:platforms., +18:u02:tumor-specific, +14:u07:platforms., +18:u01:tumor-specific, +14:u06:platforms., +18:u00:tumor-specific, +14:u05:platforms., +14:u04:platforms., +14:u03:platforms., +14:u02:platforms., +14:u01:platforms., +14:u00:platforms., +12:u08:formalin, +12:u07:formalin, +12:u06:formalin, +12:u08:41,56,57, +12:u05:formalin, +12:u07:41,56,57, +12:u04:formalin, +12:u06:41,56,57, +12:u08:robustly, +12:u03:formalin, +12:u05:41,56,57, +12:u07:robustly, +10:u08:incurs, +12:u02:formalin, +12:u04:41,56,57, +12:u06:robustly, +12:u01:formalin, +12:u03:41,56,57, +12:u05:robustly, +10:u07:incurs, +12:u00:formalin, +12:u02:41,56,57, +12:u04:robustly, +10:u06:incurs, +12:u01:41,56,57, +12:u03:robustly, +10:u14:incurs, +10:u05:incurs, +12:u00:41,56,57, +12:u02:robustly, +10:u13:incurs, +10:u04:incurs, +10:u08:cates,, +12:u01:robustly, +10:u12:incurs, +10:u03:incurs, +12:u00:robustly, +10:u11:incurs, +10:u02:incurs, +10:u07:cates,, +10:u10:incurs, +10:u01:incurs, +10:u06:cates,, +10:u14:cates,, +10:u00:incurs, +10:u05:cates,, +10:u13:cates,, +10:u04:cates,, +11:u08:maries,, +10:u12:cates,, +10:u03:cates,, +21:u08:acknowledgements,, +10:u11:cates,, +10:u02:cates,, +11:u07:maries,, +8:u08:peer, +10:u10:cates,, +10:u01:cates,, +11:u06:maries,, +21:u07:acknowledgements,, +8:u07:peer, +11:u14:maries,, +10:u00:cates,, +11:u05:maries,, +21:u06:acknowledgements,, +8:u06:peer, +11:u13:maries,, +21:u14:acknowledgements,, +11:u04:maries,, +21:u05:acknowledgements,, +8:u05:peer, +11:u12:maries,, +21:u13:acknowledgements,, +11:u03:maries,, +21:u04:acknowledgements,, +8:u08:157,, +8:u04:peer, +10:u08:Topol,, +11:u11:maries,, +21:u12:acknowledgements,, +11:u02:maries,, +21:u03:acknowledgements,, +8:u03:peer, +10:u07:Topol,, +11:u08:241-253, +11:u10:maries,, +21:u11:acknowledgements,, +11:u01:maries,, +21:u02:acknowledgements,, +8:u07:157,, +13:u08:oncology:, +8:u02:peer, +10:u06:Topol,, +11:u07:241-253, +17:u08:Schwartzberg,, +21:u10:acknowledgements,, +11:u00:maries,, +21:u01:acknowledgements,, +8:u06:157,, +10:u08:Oncol., +8:u01:peer, +10:u05:Topol,, +11:u06:241-253, +17:u07:Schwartzberg,, +8:u08:who,, +8:u14:157,, +21:u00:acknowledgements,, +8:u05:157,, +13:u07:oncology:, +8:u00:peer, +10:u04:Topol,, +11:u05:241-253, +17:u06:Schwartzberg,, +8:u07:who,, +9:u08:Educ., +8:u13:157,, +8:u04:157,, +13:u06:oncology:, +10:u07:Oncol., +10:u03:Topol,, +11:u04:241-253, +17:u05:Schwartzberg,, +8:u06:who,, +9:u07:Educ., +13:u08:Stratton,, +8:u12:157,, +13:u14:oncology:, +8:u23:157,, +16:uI2:.,.,,..,,.,., +8:u03:157,, +13:u05:oncology:, +10:u06:Oncol., +10:u02:Topol,, +11:u03:241-253, +17:u04:Schwartzberg,, +8:u05:who,, +9:u06:Educ., +13:u07:Stratton,, +8:u08:458,, +8:u11:157,, +13:u13:oncology:, +10:u14:oncol., +16:uI1:.,.,,..,,.,., +12:uI2::,,,?..., +8:u02:157,, +13:u04:oncology:, +10:u05:Oncol., +10:u01:Topol,, +11:u02:241-253, +17:u03:Schwartzberg,, +8:u04:who,, +9:u05:Educ., +13:u06:Stratton,, +8:u07:458,, +23:u08:Martínez-Jiménez,, +8:u10:157,, +13:u12:oncology:, +10:u13:oncol., +16:uI0:.,.,,..,,.,., +12:uI1::,,,?..., +8:u01:157,, +13:u03:oncology:, +10:u04:Oncol., +10:u00:Topol,, +11:u01:241-253, +17:u02:Schwartzberg,, +8:u03:who,, +9:u04:Educ., +13:u05:Stratton,, +8:u06:458,, +23:u07:Martínez-Jiménez,, +13:u11:oncology:, +10:u12:oncol., +12:uI0::,,,?..., +16:uI2:.,..,,..,..., +8:u00:157,, +13:u02:oncology:, +10:u03:Oncol., +11:u00:241-253, +17:u01:Schwartzberg,, +8:u02:who,, +9:u03:Educ., +13:u04:Stratton,, +8:u05:458,, +23:u06:Martínez-Jiménez,, +16:u08:Chakravarty,, +13:u10:oncology:, +10:u11:oncol., +16:uI1:.,..,,..,..., +13:u01:oncology:, +10:u02:Oncol., +17:u00:Schwartzberg,, +8:u01:who,, +9:u02:Educ., +13:u03:Stratton,, +8:u04:458,, +23:u05:Martínez-Jiménez,, +16:u07:Chakravarty,, +10:u10:oncol., +16:uI0:.,..,,..,..., +13:u00:oncology:, +10:u01:Oncol., +8:u00:who,, +9:u01:Educ., +13:u02:Stratton,, +8:u03:458,, +23:u04:Martínez-Jiménez,, +16:u06:Chakravarty,, +10:u08:Cheng,, +10:u00:Oncol., +17:u08:hybridization, +9:u00:Educ., +13:u01:Stratton,, +8:u02:458,, +23:u03:Martínez-Jiménez,, +16:u05:Chakravarty,, +10:u07:Cheng,, +13:u00:Stratton,, +8:u01:458,, +23:u02:Martínez-Jiménez,, +16:u04:Chakravarty,, +10:u06:Cheng,, +17:u08:capture-based, +17:u07:hybridization, +11:u08:251-264, +8:u00:458,, +23:u01:Martínez-Jiménez,, +16:u03:Chakravarty,, +10:u05:Cheng,, +17:u07:capture-based, +17:u06:hybridization, +23:u00:Martínez-Jiménez,, +16:u02:Chakravarty,, +10:u04:Cheng,, +17:u06:capture-based, +17:u14:hybridization, +8:uI2:(-):, +17:u05:hybridization, +11:u07:251-264, +16:u01:Chakravarty,, +10:u03:Cheng,, +17:u05:capture-based, +10:u08:Redig,, +17:u13:hybridization, +8:uI1:(-):, +17:u04:hybridization, +11:u06:251-264, +11:u08:975-977, +16:u00:Chakravarty,, +10:u02:Cheng,, +17:u04:capture-based, +10:u07:Redig,, +17:u12:hybridization, +11:u14:251-264, +8:uI0:(-):, +17:u03:hybridization, +11:u05:251-264, +10:u01:Cheng,, +17:u03:capture-based, +10:u06:Redig,, +17:u11:hybridization, +11:u13:251-264, +17:u02:hybridization, +11:u04:251-264, +11:u07:975-977, +17:u08:genome-driven, +10:u00:Cheng,, +17:u02:capture-based, +10:u05:Redig,, +10:u08:Hyman,, +17:u10:hybridization, +11:u12:251-264, +8:u23:251-, +17:u01:hybridization, +11:u03:251-264, +11:u06:975-977, +17:u01:capture-based, +10:u04:Redig,, +10:u07:Hyman,, +13:u08:oncology., +11:u11:251-264, +11:u14:975-977, +17:u00:hybridization, +11:u02:251-264, +11:u05:975-977, +17:u07:genome-driven, +17:u00:capture-based, +10:u03:Redig,, +10:u06:Hyman,, +13:u07:oncology., +10:u08:Zehir,, +11:u10:251-264, +11:u13:975-977, +11:u01:251-264, +11:u04:975-977, +17:u06:genome-driven, +10:u02:Redig,, +10:u05:Hyman,, +13:u06:oncology., +10:u07:Zehir,, +11:u12:975-977, +17:u14:genome-driven, +7:u22:975, +8:u23:975-, +14:uI2:.,..,,..,., +11:u00:251-264, +11:u03:975-977, +17:u05:genome-driven, +10:u01:Redig,, +10:u04:Hyman,, +13:u05:oncology., +10:u06:Zehir,, +11:u11:975-977, +17:u13:genome-driven, +14:uI1:.,..,,..,., +11:uI2:-.,-()., +11:u02:975-977, +17:u04:genome-driven, +10:u00:Redig,, +10:u03:Hyman,, +13:u04:oncology., +10:u05:Zehir,, +11:u08:Cuppen,, +11:u10:975-977, +17:u12:genome-driven, +14:uI0:.,..,,..,., +11:uI1:-.,-()., +11:u01:975-977, +17:u03:genome-driven, +10:u02:Hyman,, +13:u03:oncology., +10:u04:Zehir,, +11:u07:Cuppen,, +17:u11:genome-driven, +11:uI0:-.,-()., +11:u00:975-977, +17:u02:genome-driven, +10:u01:Hyman,, +13:u02:oncology., +10:u03:Zehir,, +11:u06:Cuppen,, +17:u10:genome-driven, +17:u01:genome-driven, +10:u00:Hyman,, +13:u01:oncology., +10:u02:Zehir,, +11:u05:Cuppen,, +13:u08:Turnbull,, +17:u00:genome-driven, +13:u00:oncology., +10:u01:Zehir,, +11:u04:Cuppen,, +13:u07:Turnbull,, +14:u08:Pan-cancer, +10:u00:Zehir,, +11:u03:Cuppen,, +13:u06:Turnbull,, +13:u08:ICGC/TCGA, +11:u02:Cuppen,, +13:u05:Turnbull,, +13:u07:ICGC/TCGA, +14:u07:Pan-cancer, +11:u01:Cuppen,, +13:u04:Turnbull,, +13:u06:ICGC/TCGA, +11:u08:Bailey,, +14:u06:Pan-cancer, +11:u00:Cuppen,, +13:u03:Turnbull,, +13:u05:ICGC/TCGA, +11:u07:Bailey,, +14:u14:pan-cancer, +14:u05:Pan-cancer, +13:u02:Turnbull,, +13:u04:ICGC/TCGA, +11:u06:Bailey,, +14:u13:pan-cancer, +14:u04:Pan-cancer, +13:u01:Turnbull,, +13:u03:ICGC/TCGA, +11:u05:Bailey,, +14:u12:pan-cancer, +8:u23:Pan-, +14:u03:Pan-cancer, +13:u00:Turnbull,, +13:u02:ICGC/TCGA, +11:u04:Bailey,, +14:u11:pan-cancer, +14:u02:Pan-cancer, +8:u08:1876, +13:u01:ICGC/TCGA, +11:u03:Bailey,, +14:u10:pan-cancer, +14:u01:Pan-cancer, +13:u00:ICGC/TCGA, +11:u02:Bailey,, +14:u00:Pan-cancer, +8:u07:1876, +11:u01:Bailey,, +8:u06:1876, +11:u00:Bailey,, +8:u14:1876, +8:u05:1876, +13:u08:Gerstung,, +8:u13:1876, +8:u04:1876, +13:u07:Gerstung,, +8:u08:578,, +8:u12:1876, +8:u23:1876, +8:u03:1876, +13:u06:Gerstung,, +8:u07:578,, +14:u08:Gerlinger,, +8:u11:1876, +8:u02:1876, +13:u05:Gerstung,, +8:u06:578,, +14:u07:Gerlinger,, +8:u10:1876, +8:u01:1876, +13:u04:Gerstung,, +8:u05:578,, +14:u06:Gerlinger,, +8:u00:1876, +15:u08:endometrial, +13:u03:Gerstung,, +8:u04:578,, +14:u05:Gerlinger,, +11:u08:Gibson,, +13:u02:Gerstung,, +8:u03:578,, +14:u04:Gerlinger,, +11:u07:Gibson,, +15:u07:endometrial, +13:u01:Gerstung,, +8:u02:578,, +14:u03:Gerlinger,, +11:u06:Gibson,, +15:u06:endometrial, +13:u00:Gerstung,, +8:u01:578,, +14:u02:Gerlinger,, +11:u05:Gibson,, +15:u14:endometrial, +15:u05:endometrial, +8:u00:578,, +14:u01:Gerlinger,, +11:u04:Gibson,, +12:u08:relapse., +15:u13:endometrial, +15:u14:metastasis., +15:u04:endometrial, +21:u08:receptor-positive, +14:u00:Gerlinger,, +11:u03:Gibson,, +12:u07:relapse., +11:u08:André,, +15:u12:endometrial, +15:u13:metastasis., +15:u03:endometrial, +13:u08:1929-1940, +11:u02:Gibson,, +12:u06:relapse., +11:u07:André,, +15:u11:endometrial, +15:u12:metastasis., +15:u02:endometrial, +21:u07:receptor-positive, +11:u01:Gibson,, +12:u05:relapse., +11:u06:André,, +15:u10:endometrial, +15:u11:metastasis., +15:u01:endometrial, +21:u06:receptor-positive, +13:u07:1929-1940, +13:u08:on-target, +11:u00:Gibson,, +12:u04:relapse., +11:u05:André,, +13:u08:Varkaris,, +15:u10:metastasis., +21:u14:receptor-positive, +10:uI2:.,..-,, +15:u00:endometrial, +21:u05:receptor-positive, +13:u06:1929-1940, +12:u03:relapse., +11:u04:André,, +13:u07:Varkaris,, +21:u13:receptor-positive, +13:u14:1929-1940, +10:uI1:.,..-,, +11:uI2:-.....,, +21:u04:receptor-positive, +13:u05:1929-1940, +13:u07:on-target, +12:u02:relapse., +11:u03:André,, +13:u06:Varkaris,, +21:u12:receptor-positive, +13:u13:1929-1940, +10:uI0:.,..-,, +11:uI1:-.....,, +21:u03:receptor-positive, +13:u04:1929-1940, +13:u06:on-target, +14:u08:candidate,, +12:u01:relapse., +11:u02:André,, +13:u05:Varkaris,, +9:u08:Fell,, +21:u11:receptor-positive, +13:u12:1929-1940, +13:u14:on-target, +8:u23:1929, +11:uI0:-.....,, +21:u02:receptor-positive, +13:u03:1929-1940, +13:u05:on-target, +12:u00:relapse., +11:u01:André,, +13:u04:Varkaris,, +9:u07:Fell,, +21:u10:receptor-positive, +13:u11:1929-1940, +13:u13:on-target, +21:u01:receptor-positive, +13:u02:1929-1940, +13:u04:on-target, +14:u07:candidate,, +11:u00:André,, +13:u03:Varkaris,, +9:u06:Fell,, +13:u10:1929-1940, +13:u12:on-target, +7:u22:on-, +8:u23:on-t, +21:u00:receptor-positive, +13:u01:1929-1940, +13:u03:on-target, +14:u06:candidate,, +15:u08:anti-tumour, +13:u02:Varkaris,, +9:u05:Fell,, +10:u08:Canon,, +13:u11:on-target, +14:u14:candidate,, +13:u00:1929-1940, +13:u02:on-target, +14:u05:candidate,, +13:u01:Varkaris,, +9:u04:Fell,, +10:u07:Canon,, +13:u10:on-target, +14:u13:candidate,, +13:u01:on-target, +14:u04:candidate,, +15:u07:anti-tumour, +20:u08:phosphoinositide, +13:u00:Varkaris,, +9:u03:Fell,, +10:u06:Canon,, +10:u08:Mateo,, +14:u12:candidate,, +13:u00:on-target, +14:u03:candidate,, +15:u06:anti-tumour, +9:u02:Fell,, +10:u05:Canon,, +10:u07:Mateo,, +14:u11:candidate,, +15:u14:anti-tumour, +14:u02:candidate,, +15:u05:anti-tumour, +20:u07:phosphoinositide, +9:u01:Fell,, +10:u04:Canon,, +10:u06:Mateo,, +14:u10:candidate,, +15:u13:anti-tumour, +14:u01:candidate,, +15:u04:anti-tumour, +20:u06:phosphoinositide, +9:u00:Fell,, +10:u03:Canon,, +10:u05:Mateo,, +11:u08:Chopra,, +15:u12:anti-tumour, +20:u14:phosphoinositide, +12:uI2:.,..---,, +14:u00:candidate,, +15:u03:anti-tumour, +20:u05:phosphoinositide, +10:u02:Canon,, +10:u04:Mateo,, +11:u07:Chopra,, +15:u11:anti-tumour, +20:u13:phosphoinositide, +12:uI1:.,..---,, +15:u02:anti-tumour, +20:u04:phosphoinositide, +10:u01:Canon,, +10:u03:Mateo,, +11:u06:Chopra,, +15:u10:anti-tumour, +20:u12:phosphoinositide, +12:uI0:.,..---,, +15:u01:anti-tumour, +20:u03:phosphoinositide, +10:u00:Canon,, +10:u02:Mateo,, +11:u05:Chopra,, +11:u08:Farmer,, +20:u11:phosphoinositide, +15:u00:anti-tumour, +20:u02:phosphoinositide, +10:u01:Mateo,, +11:u04:Chopra,, +11:u07:Farmer,, +20:u10:phosphoinositide, +20:u01:phosphoinositide, +10:u00:Mateo,, +11:u03:Chopra,, +11:u06:Farmer,, +9:u08:Fong,, +20:u00:phosphoinositide, +11:u02:Chopra,, +11:u05:Farmer,, +9:u07:Fong,, +11:u01:Chopra,, +11:u04:Farmer,, +9:u06:Fong,, +12:u08:BRCAness, +11:u00:Chopra,, +11:u03:Farmer,, +9:u05:Fong,, +22:u08:Konstantinopoulos,, +12:uI2:.,...(-), +11:u02:Farmer,, +9:u04:Fong,, +22:u07:Konstantinopoulos,, +12:uI1:.,...(-), +11:uI2:.....,-, +12:u07:BRCAness, +11:u01:Farmer,, +9:u03:Fong,, +22:u06:Konstantinopoulos,, +12:uI0:.,...(-), +11:uI1:.....,-, +12:u06:BRCAness, +11:u00:Farmer,, +9:u02:Fong,, +22:u05:Konstantinopoulos,, +12:u14:brcaness, +11:uI0:.....,-, +12:u05:BRCAness, +9:u01:Fong,, +22:u04:Konstantinopoulos,, +11:u08:Purwar,, +12:u13:brcaness, +12:u04:BRCAness, +9:u00:Fong,, +22:u03:Konstantinopoulos,, +11:u07:Purwar,, +12:u12:brcaness, +12:u03:BRCAness, +22:u02:Konstantinopoulos,, +11:u06:Purwar,, +12:u11:brcaness, +12:u02:BRCAness, +22:u01:Konstantinopoulos,, +11:u05:Purwar,, +12:u10:brcaness, +12:u01:BRCAness, +14:u08:alteration, +22:u00:Konstantinopoulos,, +11:u04:Purwar,, +12:u08:Everall,, +12:u00:BRCAness, +11:u03:Purwar,, +12:u07:Everall,, +14:u07:alteration, +35:u08:org/10.1101/2023.06.07.23290970, +11:u02:Purwar,, +12:u06:Everall,, +10:u08:10,983, +14:u06:alteration, +11:u01:Purwar,, +12:u05:Everall,, +10:u07:10,983, +11:u08:(2023)., +14:u14:alteration, +14:u05:alteration, +35:u07:org/10.1101/2023.06.07.23290970, +11:u00:Purwar,, +12:u04:Everall,, +10:u06:10,983, +11:u07:(2023)., +14:u08:Marabelle,, +14:u13:alteration, +14:u04:alteration, +35:u06:org/10.1101/2023.06.07.23290970, +12:u03:Everall,, +10:u05:10,983, +11:u06:(2023)., +14:u07:Marabelle,, +14:u12:alteration, +35:u14:org/10.1101/2023.06.07.23290970, +10:uI2:,.://., +14:u03:alteration, +35:u05:org/10.1101/2023.06.07.23290970, +16:u08:multicohort,, +12:u02:Everall,, +10:u04:10,983, +11:u05:(2023)., +14:u06:Marabelle,, +18:u08:pembrolizumab:, +14:u11:alteration, +35:u13:org/10.1101/2023.06.07.23290970, +10:uI1:,.://., +13:uI2:/./...()., +14:u02:alteration, +35:u04:org/10.1101/2023.06.07.23290970, +12:u01:Everall,, +10:u03:10,983, +11:u04:(2023)., +14:u05:Marabelle,, +18:u07:pembrolizumab:, +15:u08:open-label,, +14:u10:alteration, +35:u12:org/10.1101/2023.06.07.23290970, +10:uI0:,.://., +13:uI1:/./...()., +14:u01:alteration, +35:u03:org/10.1101/2023.06.07.23290970, +16:u07:multicohort,, +12:u00:Everall,, +10:u02:10,983, +11:u03:(2023)., +14:u04:Marabelle,, +18:u06:pembrolizumab:, +15:u07:open-label,, +35:u11:org/10.1101/2023.06.07.23290970, +13:uI0:/./...()., +14:u00:alteration, +35:u02:org/10.1101/2023.06.07.23290970, +16:u06:multicohort,, +10:u01:10,983, +11:u02:(2023)., +14:u03:Marabelle,, +18:u05:pembrolizumab:, +15:u06:open-label,, +35:u10:org/10.1101/2023.06.07.23290970, +16:u14:multicohort,, +35:u01:org/10.1101/2023.06.07.23290970, +16:u05:multicohort,, +10:u00:10,983, +11:u01:(2023)., +14:u02:Marabelle,, +18:u04:pembrolizumab:, +15:u05:open-label,, +7:u08:JCO, +16:u13:multicohort,, +9:uI2:,-,-., +35:u00:org/10.1101/2023.06.07.23290970, +16:u04:multicohort,, +11:u00:(2023)., +14:u01:Marabelle,, +18:u03:pembrolizumab:, +15:u04:open-label,, +7:u07:JCO, +16:u12:multicohort,, +9:uI1:,-,-., +16:u03:multicohort,, +16:u08:shinyDepMap,, +14:u00:Marabelle,, +18:u02:pembrolizumab:, +15:u03:open-label,, +7:u06:JCO, +12:u08:Shimada,, +16:u11:multicohort,, +9:uI0:,-,-., +16:u02:multicohort,, +18:u01:pembrolizumab:, +15:u02:open-label,, +7:u05:JCO, +12:u07:Shimada,, +16:u10:multicohort,, +16:uI2:...://././.., +16:u01:multicohort,, +16:u07:shinyDepMap,, +18:u00:pembrolizumab:, +15:u01:open-label,, +7:u04:JCO, +12:u06:Shimada,, +16:uI1:...://././.., +16:u00:multicohort,, +16:u06:shinyDepMap,, +15:u00:open-label,, +7:u03:JCO, +12:u05:Shimada,, +10:u08:e57116, +16:u14:shinydepmap,, +16:uI0:...://././.., +18:uI2:.,.,,..,,..,.., +16:u05:shinyDepMap,, +7:u02:JCO, +12:u04:Shimada,, +10:u07:e57116, +16:u08:Mitsopoulos,, +16:u13:shinydepmap,, +18:uI1:.,.,,..,,..,.., +16:u04:shinyDepMap,, +7:u01:JCO, +12:u03:Shimada,, +10:u06:e57116, +16:u07:Mitsopoulos,, +16:u12:shinydepmap,, +18:uI0:.,.,,..,,..,.., +16:u03:shinyDepMap,, +7:u00:JCO, +12:u02:Shimada,, +10:u05:e57116, +16:u06:Mitsopoulos,, +15:u08:D1074-D1082, +16:u11:shinydepmap,, +16:u02:shinyDepMap,, +17:u08:bromodomains., +12:u01:Shimada,, +10:u04:e57116, +16:u05:Mitsopoulos,, +15:u07:D1074-D1082, +20:u08:Filippakopoulos,, +16:u10:shinydepmap,, +16:u01:shinyDepMap,, +12:u00:Shimada,, +10:u03:e57116, +16:u04:Mitsopoulos,, +15:u06:D1074-D1082, +20:u07:Filippakopoulos,, +16:u00:shinyDepMap,, +17:u07:bromodomains., +10:u02:e57116, +16:u03:Mitsopoulos,, +15:u05:D1074-D1082, +20:u06:Filippakopoulos,, +17:u06:bromodomains., +15:u08:inhibitors), +10:u01:e57116, +16:u02:Mitsopoulos,, +15:u04:D1074-D1082, +20:u05:Filippakopoulos,, +17:u14:bromodomains., +17:u05:bromodomains., +13:u08:1038-1052, +10:u00:e57116, +16:u01:Mitsopoulos,, +15:u03:D1074-D1082, +20:u04:Filippakopoulos,, +17:u13:bromodomains., +17:u04:bromodomains., +15:u07:inhibitors), +16:u00:Mitsopoulos,, +15:u02:D1074-D1082, +20:u03:Filippakopoulos,, +17:u12:bromodomains., +16:uI2:.,.,,.,,.,.-, +17:u03:bromodomains., +15:u06:inhibitors), +13:u07:1038-1052, +15:u08:Myb-related, +15:u01:D1074-D1082, +20:u02:Filippakopoulos,, +10:u08:Burns,, +17:u11:bromodomains., +15:u14:inhibitors), +16:uI1:.,.,,.,,.,.-, +17:u02:bromodomains., +15:u05:inhibitors), +13:u06:1038-1052, +15:u00:D1074-D1082, +20:u01:Filippakopoulos,, +10:u07:Burns,, +8:u08:CDC5, +17:u10:bromodomains., +15:u13:inhibitors), +13:u14:1038-1052, +16:uI0:.,.,,.,,.,.-, +10:uI2:)....,, +17:u01:bromodomains., +15:u04:inhibitors), +13:u05:1038-1052, +15:u07:Myb-related, +20:u00:Filippakopoulos,, +10:u06:Burns,, +8:u07:CDC5, +15:u12:inhibitors), +13:u13:1038-1052, +10:uI1:)....,, +17:u00:bromodomains., +15:u03:inhibitors), +13:u04:1038-1052, +15:u06:Myb-related, +10:u05:Burns,, +8:u06:CDC5, +13:u08:Freedman,, +15:u11:inhibitors), +13:u12:1038-1052, +15:u14:myb-related, +10:uI0:)....,, +18:uI2:.,..,,.,,..,.., +15:u02:inhibitors), +13:u03:1038-1052, +15:u05:Myb-related, +10:u04:Burns,, +8:u05:CDC5, +13:u07:Freedman,, +15:u10:inhibitors), +13:u11:1038-1052, +15:u13:myb-related, +18:uI1:.,..,,.,,..,.., +15:u01:inhibitors), +13:u02:1038-1052, +15:u04:Myb-related, +39:u08:https://doi.org/10.1200/PO.18.00169, +10:u03:Burns,, +8:u04:CDC5, +13:u06:Freedman,, +13:u10:1038-1052, +15:u12:myb-related, +7:u22:Myb, +8:u23:Myb-, +18:uI0:.,..,,.,,..,.., +15:u00:inhibitors), +13:u01:1038-1052, +15:u03:Myb-related, +10:u02:Burns,, +8:u03:CDC5, +13:u05:Freedman,, +15:u11:myb-related, +13:u00:1038-1052, +15:u02:Myb-related, +39:u07:https://doi.org/10.1200/PO.18.00169, +10:u01:Burns,, +8:u02:CDC5, +13:u04:Freedman,, +15:u10:myb-related, +15:u01:Myb-related, +39:u06:https://doi.org/10.1200/PO.18.00169, +38:u08:national-genomic-test-directories/, +10:u00:Burns,, +8:u01:CDC5, +13:u03:Freedman,, +10:u08:2023);, +39:u14:https://doi.org/10.1200/po.18.00169, +15:u00:Myb-related, +39:u05:https://doi.org/10.1200/PO.18.00169, +8:u00:CDC5, +13:u02:Freedman,, +10:u07:2023);, +39:u13:https://doi.org/10.1200/po.18.00169, +16:uI2:://././..()., +39:u04:https://doi.org/10.1200/PO.18.00169, +38:u07:national-genomic-test-directories/, +13:u01:Freedman,, +10:u06:2023);, +13:u08:Michaeli,, +39:u12:https://doi.org/10.1200/po.18.00169, +16:uI1:://././..()., +39:u03:https://doi.org/10.1200/PO.18.00169, +38:u06:national-genomic-test-directories/, +13:u00:Freedman,, +10:u05:2023);, +13:u07:Michaeli,, +39:u11:https://doi.org/10.1200/po.18.00169, +38:u14:national-genomic-test-directories/, +16:uI0:://././..()., +14:uI2:);://...//, +39:u02:https://doi.org/10.1200/PO.18.00169, +38:u05:national-genomic-test-directories/, +10:u04:2023);, +13:u06:Michaeli,, +39:u10:https://doi.org/10.1200/po.18.00169, +38:u13:national-genomic-test-directories/, +14:uI1:);://...//, +39:u01:https://doi.org/10.1200/PO.18.00169, +38:u04:national-genomic-test-directories/, +10:u03:2023);, +13:u05:Michaeli,, +38:u12:national-genomic-test-directories/, +14:uI0:);://...//, +12:uI2:.,..,.,-, +39:u00:https://doi.org/10.1200/PO.18.00169, +38:u03:national-genomic-test-directories/, +10:u02:2023);, +13:u04:Michaeli,, +38:u11:national-genomic-test-directories/, +12:uI1:.,..,.,-, +38:u02:national-genomic-test-directories/, +21:u08:cancer-associated, +10:u01:2023);, +13:u03:Michaeli,, +38:u10:national-genomic-test-directories/, +12:uI0:.,..,.,-, +38:u01:national-genomic-test-directories/, +10:u00:2023);, +13:u02:Michaeli,, +12:uI2:,-....,-, +38:u00:national-genomic-test-directories/, +21:u07:cancer-associated, +13:u01:Michaeli,, +11:u08:874-884, +12:uI1:,-....,-, +21:u06:cancer-associated, +13:u00:Michaeli,, +11:u07:874-884, +21:u14:cancer-associated, +12:uI0:,-....,-, +21:u05:cancer-associated, +11:u06:874-884, +21:u13:cancer-associated, +7:u14:40,, +21:u04:cancer-associated, +11:u05:874-884, +21:u12:cancer-associated, +7:u13:40,, +21:u03:cancer-associated, +11:u04:874-884, +16:u08:Ansari-Pour,, +21:u11:cancer-associated, +7:u12:40,, +7:u23:40,, +21:u02:cancer-associated, +11:u03:874-884, +16:u07:Ansari-Pour,, +21:u10:cancer-associated, +7:u11:40,, +21:u01:cancer-associated, +11:u02:874-884, +16:u06:Ansari-Pour,, +7:u10:40,, +21:u00:cancer-associated, +11:u01:874-884, +16:u05:Ansari-Pour,, +10:u08:Hoang,, +10:uI2:.-,..-, +11:u00:874-884, +16:u04:Ansari-Pour,, +10:u07:Hoang,, +10:uI1:.-,..-, +16:u03:Ansari-Pour,, +10:u06:Hoang,, +10:uI0:.-,..-, +8:u08:537,, +16:u02:Ansari-Pour,, +10:u05:Hoang,, +11:u08:Prasad,, +16:u01:Ansari-Pour,, +10:u04:Hoang,, +11:u07:Prasad,, +7:u08:S63, +8:u07:537,, +16:u00:Ansari-Pour,, +10:u03:Hoang,, +11:u06:Prasad,, +7:u07:S63, +14:u08:Cibulskis,, +8:u06:537,, +10:u02:Hoang,, +11:u05:Prasad,, +7:u06:S63, +14:u07:Cibulskis,, +10:u08:impure, +8:u14:537,, +10:uI2:.,.:-., +8:u05:537,, +10:u01:Hoang,, +11:u04:Prasad,, +7:u05:S63, +14:u06:Cibulskis,, +10:u07:impure, +11:u08:213-219, +8:u13:537,, +10:uI1:.,.:-., +8:u04:537,, +14:u08:AlphaFold., +10:u00:Hoang,, +11:u03:Prasad,, +7:u04:S63, +14:u05:Cibulskis,, +10:u06:impure, +11:u07:213-219, +11:u08:Jumper,, +8:u12:537,, +7:u22:537, +8:u23:537,, +10:uI0:.,.:-., +8:u03:537,, +11:u02:Prasad,, +7:u03:S63, +14:u04:Cibulskis,, +10:u05:impure, +11:u06:213-219, +11:u07:Jumper,, +8:u11:537,, +8:u02:537,, +14:u07:AlphaFold., +14:u08:landscapes, +11:u01:Prasad,, +7:u02:S63, +14:u03:Cibulskis,, +10:u04:impure, +11:u05:213-219, +11:u06:Jumper,, +10:u08:Faure,, +8:u10:537,, +8:u01:537,, +14:u06:AlphaFold., +11:u00:Prasad,, +7:u01:S63, +14:u02:Cibulskis,, +10:u03:impure, +11:u04:213-219, +11:u05:Jumper,, +10:u07:Faure,, +14:u14:alphafold., +8:u00:537,, +14:u05:AlphaFold., +14:u07:landscapes, +7:u00:S63, +14:u01:Cibulskis,, +10:u02:impure, +11:u03:213-219, +11:u04:Jumper,, +10:u06:Faure,, +14:u13:alphafold., +14:u04:AlphaFold., +14:u06:landscapes, +14:u00:Cibulskis,, +10:u01:impure, +11:u02:213-219, +11:u03:Jumper,, +10:u05:Faure,, +14:u12:alphafold., +14:u14:landscapes, +7:u22:Alp, +8:u23:Alph, +14:u03:AlphaFold., +14:u05:landscapes, +10:u00:impure, +11:u01:213-219, +11:u02:Jumper,, +10:u04:Faure,, +14:u11:alphafold., +14:u13:landscapes, +14:u02:AlphaFold., +14:u04:landscapes, +11:u00:213-219, +11:u01:Jumper,, +10:u03:Faure,, +14:u10:alphafold., +14:u12:landscapes, +14:u01:AlphaFold., +14:u03:landscapes, +11:u00:Jumper,, +10:u02:Faure,, +13:u08:Sakamoto,, +14:u11:landscapes, +17:uI2:.,.,,..,,..,., +14:u00:AlphaFold., +14:u02:landscapes, +10:u01:Faure,, +13:u07:Sakamoto,, +14:u10:landscapes, +17:uI1:.,.,,..,,..,., +10:uI2:....,-, +14:u01:landscapes, +10:u00:Faure,, +13:u06:Sakamoto,, +17:uI0:.,.,,..,,..,., +10:uI1:....,-, +14:u00:landscapes, +13:u05:Sakamoto,, +10:uI0:....,-, +13:u04:Sakamoto,, +10:u08:Brady,, +13:u03:Sakamoto,, +10:u07:Brady,, +13:u02:Sakamoto,, +10:u06:Brady,, +25:u08:immunoglobulin-T-cell, +13:u01:Sakamoto,, +10:u05:Brady,, +10:u08:Gross,, +13:u00:Sakamoto,, +10:u04:Brady,, +10:u07:Gross,, +25:u07:immunoglobulin-T-cell, +10:u03:Brady,, +10:u06:Gross,, +25:u06:immunoglobulin-T-cell, +10:u02:Brady,, +10:u05:Gross,, +25:u14:immunoglobulin-t-cell, +25:u05:immunoglobulin-T-cell, +11:u08:Milone,, +10:u01:Brady,, +10:u04:Gross,, +25:u13:immunoglobulin-t-cell, +25:u04:immunoglobulin-T-cell, +10:u00:Brady,, +10:u03:Gross,, +25:u12:immunoglobulin-t-cell, +25:u03:immunoglobulin-T-cell, +11:u07:Milone,, +10:u02:Gross,, +8:u08:359,, +25:u11:immunoglobulin-t-cell, +25:u02:immunoglobulin-T-cell, +11:u06:Milone,, +10:u01:Gross,, +8:u07:359,, +11:u08:Hundal,, +25:u10:immunoglobulin-t-cell, +11:u14:milone,, +20:uI2:.,..,',..,,..,,., +25:u01:immunoglobulin-T-cell, +11:u05:Milone,, +10:u00:Gross,, +8:u06:359,, +11:u07:Hundal,, +11:u13:milone,, +20:uI1:.,..,',..,,..,,., +25:u00:immunoglobulin-T-cell, +11:u04:Milone,, +8:u05:359,, +11:u06:Hundal,, +14:u08:Sarkizova,, +11:u12:milone,, +8:u23:Milo, +20:uI0:.,..,',..,,..,,., +11:u03:Milone,, +8:u04:359,, +11:u05:Hundal,, +14:u07:Sarkizova,, +11:u11:milone,, +11:uI2:.,..-:-, +11:u02:Milone,, +8:u03:359,, +11:u04:Hundal,, +14:u06:Sarkizova,, +11:u10:milone,, +11:uI1:.,..-:-, +11:u01:Milone,, +8:u02:359,, +11:u03:Hundal,, +14:u05:Sarkizova,, +13:u08:Schwarze,, +11:uI0:.,..-:-, +11:u00:Milone,, +8:u01:359,, +11:u02:Hundal,, +14:u04:Sarkizova,, +13:u07:Schwarze,, +16:u08:microcosting, +8:u00:359,, +11:u01:Hundal,, +14:u03:Sarkizova,, +13:u06:Schwarze,, +16:u07:microcosting, +18:u08:formalin-fixed, +11:u00:Hundal,, +14:u02:Sarkizova,, +13:u05:Schwarze,, +16:u06:microcosting, +7:u08:Do,, +14:u01:Sarkizova,, +13:u04:Schwarze,, +16:u05:microcosting, +7:u07:Do,, +12:u08:tissues:, +18:u07:formalin-fixed, +14:u00:Sarkizova,, +13:u03:Schwarze,, +16:u04:microcosting, +7:u06:Do,, +12:u07:tissues:, +18:u06:formalin-fixed, +13:u02:Schwarze,, +16:u03:microcosting, +7:u05:Do,, +12:u06:tissues:, +18:u14:formalin-fixed, +18:u05:formalin-fixed, +13:u01:Schwarze,, +16:u02:microcosting, +7:u04:Do,, +12:u05:tissues:, +18:u13:formalin-fixed, +18:u04:formalin-fixed, +13:u00:Schwarze,, +16:u01:microcosting, +7:u03:Do,, +12:u04:tissues:, +18:u12:formalin-fixed, +18:u03:formalin-fixed, +16:u00:microcosting, +7:u02:Do,, +12:u03:tissues:, +18:u11:formalin-fixed, +18:u02:formalin-fixed, +7:u01:Do,, +12:u02:tissues:, +18:u10:formalin-fixed, +18:u01:formalin-fixed, +13:u08:massively, +7:u00:Do,, +12:u01:tissues:, +11:u08:tumours, +18:u00:formalin-fixed, +12:u00:tissues:, +11:u07:tumours, +13:u07:massively, +11:u06:tumours, +13:u06:massively, +11:u05:tumours, +13:u14:massively, +13:u05:massively, +11:u04:tumours, +13:u13:massively, +11:u14:(2014)., +13:u04:massively, +11:u03:tumours, +11:u08:Kosugi,, +13:u12:massively, +11:u13:(2014)., +13:u03:massively, +11:u02:tumours, +11:u07:Kosugi,, +13:u11:massively, +11:u12:(2014)., +13:u02:massively, +11:u01:tumours, +11:u06:Kosugi,, +13:u10:massively, +11:u11:(2014)., +13:u01:massively, +11:u00:tumours, +11:u05:Kosugi,, +16:u08:Amarasinghe,, +11:u10:(2014)., +13:u00:massively, +11:u08:(2020)., +11:u04:Kosugi,, +16:u07:Amarasinghe,, +11:u03:Kosugi,, +16:u06:Amarasinghe,, +11:u07:(2020)., +18:u08:jurisdictional, +11:u02:Kosugi,, +16:u05:Amarasinghe,, +13:u14:long-read, +11:u06:(2020)., +11:u01:Kosugi,, +16:u04:Amarasinghe,, +13:u13:long-read, +11:u14:(2020)., +11:u05:(2020)., +18:u07:jurisdictional, +11:u00:Kosugi,, +16:u03:Amarasinghe,, +13:u12:long-read, +11:u13:(2020)., +11:u04:(2020)., +18:u06:jurisdictional, +16:u02:Amarasinghe,, +13:u11:long-read, +11:u12:(2020)., +18:u14:jurisdictional, +11:u03:(2020)., +18:u05:jurisdictional, +16:u01:Amarasinghe,, +13:u10:long-read, +11:u11:(2020)., +18:u13:jurisdictional, +11:u02:(2020)., +18:u04:jurisdictional, +11:u08:source,, +16:u00:Amarasinghe,, +11:u10:(2020)., +18:u12:jurisdictional, +7:u22:jur, +8:u23:juri, +11:u01:(2020)., +18:u03:jurisdictional, +18:u11:jurisdictional, +11:u00:(2020)., +18:u02:jurisdictional, +11:u07:source,, +18:u10:jurisdictional, +18:u01:jurisdictional, +11:u06:source,, +11:u14:source,, +18:u00:jurisdictional, +11:u05:source,, +11:u13:source,, +11:u04:source,, +11:u12:source,, +11:u03:source,, +11:u11:source,, +11:u02:source,, +11:u10:source,, +11:u01:source,, +11:u00:source,, +11:u14:holder., +11:u13:holder., +11:u12:holder., +11:u11:holder., +11:u02:holder., +11:u10:holder., +11:u01:holder., +10:u08:100kGP, +11:u00:holder., +10:u07:100kGP, +10:u06:100kGP, +10:u05:100kGP, +10:u04:100kGP, +10:u03:100kGP, +10:u02:100kGP, +11:u08:rectal,, +10:u01:100kGP, +10:u08:10,470, +9:u08:1,045, +10:u00:100kGP, +10:u07:10,470, +11:u07:rectal,, +10:u06:10,470, +11:u06:rectal,, +9:u07:1,045, +10:u05:10,470, +11:u14:rectal,, +12:uI2:,(,,,,,-, +11:u05:rectal,, +9:u06:1,045, +20:u08:clinicopathology, +10:u04:10,470, +11:u13:rectal,, +9:u14:1,045, +12:uI1:,(,,,,,-, +11:u04:rectal,, +9:u05:1,045, +10:u03:10,470, +11:u12:rectal,, +9:u13:1,045, +12:uI0:,(,,,,,-, +11:u03:rectal,, +9:u04:1,045, +20:u07:clinicopathology, +10:u02:10,470, +11:u11:rectal,, +9:u12:1,045, +14:u14:testicular, +8:u23:1,04, +11:u02:rectal,, +9:u03:1,045, +20:u06:clinicopathology, +10:u01:10,470, +11:u10:rectal,, +9:u11:1,045, +14:u13:testicular, +20:u14:clinicopathology, +11:u01:rectal,, +9:u02:1,045, +20:u05:clinicopathology, +10:u00:10,470, +9:u10:1,045, +14:u12:testicular, +20:u13:clinicopathology, +11:u00:rectal,, +9:u01:1,045, +20:u04:clinicopathology, +8:u08:dMMR, +14:u11:testicular, +20:u12:clinicopathology, +9:u00:1,045, +20:u03:clinicopathology, +14:u10:testicular, +20:u11:clinicopathology, +10:uI2:(.),,,, +20:u02:clinicopathology, +8:u07:dMMR, +10:u08:mSINGS, +20:u10:clinicopathology, +10:uI1:(.),,,, +20:u01:clinicopathology, +8:u06:dMMR, +10:u07:mSINGS, +8:u14:dmmr, +10:uI0:(.),,,, +20:u00:clinicopathology, +8:u05:dMMR, +10:u06:mSINGS, +8:u13:dmmr, +8:u04:dMMR, +10:u05:mSINGS, +8:u12:dmmr, +8:u03:dMMR, +10:u04:mSINGS, +8:u11:dmmr, +8:u02:dMMR, +10:u03:mSINGS, +8:u10:dmmr, +8:u01:dMMR, +10:u02:mSINGS, +8:u00:dMMR, +14:u08:Metastatic, +10:u01:mSINGS, +20:u14:well-established, +7:u08:MSK, +10:u00:mSINGS, +20:u13:well-established, +14:u07:Metastatic, +20:u12:well-established, +14:u06:Metastatic, +7:u07:MSK, +17:u08:MutationTimeR, +11:u08:timings, +20:u11:well-established, +14:u14:metastatic, +14:u05:Metastatic, +7:u06:MSK, +11:u07:timings, +20:u10:well-established, +14:u13:metastatic, +7:u14:msk, +14:u04:Metastatic, +7:u05:MSK, +17:u07:MutationTimeR, +11:u06:timings, +14:u12:metastatic, +7:u13:msk, +14:u03:Metastatic, +7:u04:MSK, +17:u06:MutationTimeR, +11:u05:timings, +14:u11:metastatic, +7:u12:msk, +17:u14:mutationtimer, +7:u22:MSK, +7:u23:MSK, +14:u02:Metastatic, +7:u03:MSK, +17:u05:MutationTimeR, +11:u04:timings, +12:u08:Oncology, +14:u10:metastatic, +7:u11:msk, +17:u13:mutationtimer, +14:u01:Metastatic, +7:u02:MSK, +17:u04:MutationTimeR, +11:u03:timings, +12:u07:Oncology, +7:u10:msk, +17:u12:mutationtimer, +14:u00:Metastatic, +7:u01:MSK, +17:u03:MutationTimeR, +11:u02:timings, +12:u06:Oncology, +17:u11:mutationtimer, +7:u00:MSK, +17:u02:MutationTimeR, +11:u01:timings, +12:u05:Oncology, +17:u10:mutationtimer, +17:u01:MutationTimeR, +11:u00:timings, +12:u04:Oncology, +12:u14:marketed, +17:u00:MutationTimeR, +12:u03:Oncology, +12:u13:marketed, +12:u02:Oncology, +9:u08:drug., +12:u12:marketed, +13:u14:evidence., +12:u01:Oncology, +9:u07:drug., +13:u08:undertake, +12:u11:marketed, +13:u13:evidence., +12:u00:Oncology, +9:u06:drug., +13:u07:undertake, +12:u10:marketed, +13:u12:evidence., +9:u05:drug., +13:u06:undertake, +13:u11:evidence., +8:u08:IMeX, +9:u04:drug., +13:u05:undertake, +13:u10:evidence., +9:u03:drug., +13:u04:undertake, +8:u07:IMeX, +9:u02:drug., +13:u03:undertake, +8:u06:IMeX, +9:u01:drug., +13:u02:undertake, +8:u14:imex, +8:u05:IMeX, +9:u00:drug., +13:u01:undertake, +8:u13:imex, +8:u04:IMeX, +13:u00:undertake, +8:u12:imex, +7:u22:IMe, +8:u23:IMeX, +8:u03:IMeX, +8:u11:imex, +8:u02:IMeX, +13:u08:Portfolio, +8:u10:imex, +8:u01:IMeX, +13:u14:reporting, +8:u00:IMeX, +13:u07:Portfolio, +13:u13:reporting, +13:u06:Portfolio, +13:u12:reporting, +13:u14:portfolio, +13:u05:Portfolio, +13:u11:reporting, +13:u13:portfolio, +13:u04:Portfolio, +19:u08:sample-specific, +13:u10:reporting, +13:u12:portfolio, +13:u03:Portfolio, +11:u08:England, +19:u07:sample-specific, +13:u11:portfolio, +13:u02:Portfolio, +19:u06:sample-specific, +13:u10:portfolio, +13:u01:Portfolio, +11:u07:England, +66:u08:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +19:u05:sample-specific, +13:u00:Portfolio, +11:u06:England, +7:u08:y)., +19:u04:sample-specific, +11:u14:england, +11:u05:England, +66:u07:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +19:u03:sample-specific, +11:u13:england, +11:u04:England, +66:u06:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u07:y)., +48:u08:sengland.co.uk/research/academic/join-gecip., +19:u02:sample-specific, +11:u12:england, +66:u14:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +11:uI2:'(://.-, +11:u03:England, +66:u05:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u06:y)., +19:u01:sample-specific, +11:u11:england, +66:u13:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u14:y)., +11:uI1:'(://.-, +13:uI2:..//-----, +11:u02:England, +66:u04:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u05:y)., +48:u07:sengland.co.uk/research/academic/join-gecip., +11:u08:pletion, +19:u00:sample-specific, +11:u10:england, +66:u12:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u13:y)., +11:uI0:'(://.-, +13:uI1:..//-----, +11:u01:England, +66:u03:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u04:y)., +48:u06:sengland.co.uk/research/academic/join-gecip., +12:u08:fication, +66:u11:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u12:y)., +48:u14:sengland.co.uk/research/academic/join-gecip., +6:u21:y), +7:u22:y)., +7:u23:y)., +13:uI0:..//-----, +11:u00:England, +66:u02:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u03:y)., +48:u05:sengland.co.uk/research/academic/join-gecip., +11:u07:pletion, +43:u08:genomicsengland.co.uk/research/academic, +66:u10:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u11:y)., +48:u13:sengland.co.uk/research/academic/join-gecip., +11:uI2:..///-., +66:u01:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u02:y)., +48:u04:sengland.co.uk/research/academic/join-gecip., +11:u06:pletion, +12:u07:fication, +7:u10:y)., +48:u12:sengland.co.uk/research/academic/join-gecip., +11:u14:pletion, +8:u23:seng, +11:uI1:..///-., +8:uI2:,',-, +66:u00:land.co.uk/research/pan-cancer-and-molecular-oncology-communit, +7:u01:y)., +48:u03:sengland.co.uk/research/academic/join-gecip., +11:u05:pletion, +12:u06:fication, +43:u07:genomicsengland.co.uk/research/academic, +12:u08:figshare, +48:u11:sengland.co.uk/research/academic/join-gecip., +11:u13:pletion, +12:u14:fication, +11:uI0:..///-., +8:uI1:,',-, +7:u00:y)., +48:u02:sengland.co.uk/research/academic/join-gecip., +11:u04:pletion, +12:u05:fication, +43:u06:genomicsengland.co.uk/research/academic, +48:u10:sengland.co.uk/research/academic/join-gecip., +11:u12:pletion, +12:u13:fication, +43:u14:genomicsengland.co.uk/research/academic, +8:uI0:,',-, +9:uI2:.://., +48:u01:sengland.co.uk/research/academic/join-gecip., +11:u03:pletion, +12:u04:fication, +43:u05:genomicsengland.co.uk/research/academic, +12:u07:figshare, +11:u11:pletion, +12:u12:fication, +43:u13:genomicsengland.co.uk/research/academic, +9:uI1:.://., +9:uI2:..//., +48:u00:sengland.co.uk/research/academic/join-gecip., +11:u02:pletion, +12:u03:fication, +43:u04:genomicsengland.co.uk/research/academic, +12:u06:figshare, +39:u08:co.uk/understanding-genomics/data)., +11:u10:pletion, +12:u11:fication, +43:u12:genomicsengland.co.uk/research/academic, +12:u14:figshare, +9:uI0:.://., +9:uI1:..//., +11:u01:pletion, +12:u02:fication, +43:u03:genomicsengland.co.uk/research/academic, +12:u05:figshare, +12:u10:fication, +43:u11:genomicsengland.co.uk/research/academic, +12:u13:figshare, +9:uI0:..//., +18:uI2:://././...(.)., +11:u00:pletion, +12:u01:fication, +43:u02:genomicsengland.co.uk/research/academic, +12:u04:figshare, +39:u07:co.uk/understanding-genomics/data)., +46:u08:icsengland.co.uk/about-gecip/publications., +43:u10:genomicsengland.co.uk/research/academic, +12:u12:figshare, +18:uI1:://././...(.)., +12:u00:fication, +43:u01:genomicsengland.co.uk/research/academic, +12:u03:figshare, +39:u06:co.uk/understanding-genomics/data)., +12:u11:figshare, +39:u14:co.uk/understanding-genomics/data)., +18:uI0:://././...(.)., +10:uI2:(://.., +43:u00:genomicsengland.co.uk/research/academic, +12:u02:figshare, +39:u05:co.uk/understanding-genomics/data)., +46:u07:icsengland.co.uk/about-gecip/publications., +48:u08:shared_allGeCIPs/pancancer_drivers/results/., +12:u10:figshare, +39:u13:co.uk/understanding-genomics/data)., +10:uI1:(://.., +12:uI2:./-/).,-, +12:u01:figshare, +39:u04:co.uk/understanding-genomics/data)., +46:u06:icsengland.co.uk/about-gecip/publications., +39:u12:co.uk/understanding-genomics/data)., +46:u14:icsengland.co.uk/about-gecip/publications., +7:u22:co., +8:u23:co.u, +10:uI0:(://.., +12:uI1:./-/).,-, +12:u00:figshare, +39:u03:co.uk/understanding-genomics/data)., +46:u05:icsengland.co.uk/about-gecip/publications., +48:u07:shared_allGeCIPs/pancancer_drivers/results/., +57:u08:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +39:u11:co.uk/understanding-genomics/data)., +46:u13:icsengland.co.uk/about-gecip/publications., +12:uI0:./-/).,-, +10:uI2:../-/., +39:u02:co.uk/understanding-genomics/data)., +46:u04:icsengland.co.uk/about-gecip/publications., +48:u06:shared_allGeCIPs/pancancer_drivers/results/., +39:u10:co.uk/understanding-genomics/data)., +46:u12:icsengland.co.uk/about-gecip/publications., +48:u14:shared_allgecips/pancancer_drivers/results/., +8:u23:icse, +10:uI1:../-/., +39:u01:co.uk/understanding-genomics/data)., +46:u03:icsengland.co.uk/about-gecip/publications., +48:u05:shared_allGeCIPs/pancancer_drivers/results/., +57:u07:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u08:sanger.ac.uk/actionability, +46:u11:icsengland.co.uk/about-gecip/publications., +48:u13:shared_allgecips/pancancer_drivers/results/., +10:uI0:../-/., +9:uI2:///.-, +39:u00:co.uk/understanding-genomics/data)., +46:u02:icsengland.co.uk/about-gecip/publications., +48:u04:shared_allGeCIPs/pancancer_drivers/results/., +57:u06:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +22:u08:Genes#sections=Tx,, +46:u10:icsengland.co.uk/about-gecip/publications., +48:u12:shared_allgecips/pancancer_drivers/results/., +57:u14:re_gecip/shared_allgecips/pancancer_drivers/results/., +9:uI1:///.-, +46:u01:icsengland.co.uk/about-gecip/publications., +48:u03:shared_allGeCIPs/pancancer_drivers/results/., +57:u05:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u07:sanger.ac.uk/actionability, +48:u11:shared_allgecips/pancancer_drivers/results/., +57:u13:re_gecip/shared_allgecips/pancancer_drivers/results/., +9:uI0:///.-, +9:uI2:////., +46:u00:icsengland.co.uk/about-gecip/publications., +48:u02:shared_allGeCIPs/pancancer_drivers/results/., +57:u04:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u06:sanger.ac.uk/actionability, +22:u07:Genes#sections=Tx,, +48:u10:shared_allgecips/pancancer_drivers/results/., +57:u12:re_gecip/shared_allgecips/pancancer_drivers/results/., +30:u14:sanger.ac.uk/actionability, +7:u22:re_, +8:u23:re_g, +9:uI1:////., +48:u01:shared_allGeCIPs/pancancer_drivers/results/., +57:u03:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u05:sanger.ac.uk/actionability, +22:u06:Genes#sections=Tx,, +39:u08:national-genomic-test-directories/., +57:u11:re_gecip/shared_allgecips/pancancer_drivers/results/., +30:u13:sanger.ac.uk/actionability, +22:u14:genes#sections=tx,, +9:uI0:////., +13:uI2:../://../, +48:u00:shared_allGeCIPs/pancancer_drivers/results/., +57:u02:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u04:sanger.ac.uk/actionability, +22:u05:Genes#sections=Tx,, +9:u08:Lists, +57:u10:re_gecip/shared_allgecips/pancancer_drivers/results/., +30:u12:sanger.ac.uk/actionability, +22:u13:genes#sections=tx,, +8:u23:sang, +13:uI1:../://../, +7:uI2:#,., +57:u01:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u03:sanger.ac.uk/actionability, +22:u04:Genes#sections=Tx,, +39:u07:national-genomic-test-directories/., +10:u08:home),, +9:u07:Lists, +30:u11:sanger.ac.uk/actionability, +22:u12:genes#sections=tx,, +13:uI0:../://../, +7:uI1:#,., +57:u00:re_gecip/shared_allGeCIPs/pancancer_drivers/results/., +30:u02:sanger.ac.uk/actionability, +22:u03:Genes#sections=Tx,, +39:u06:national-genomic-test-directories/., +9:u06:Lists, +11:u08:IntOGen, +30:u10:sanger.ac.uk/actionability, +22:u11:genes#sections=tx,, +39:u14:national-genomic-test-directories/., +7:uI0:#,., +30:u01:sanger.ac.uk/actionability, +22:u02:Genes#sections=Tx,, +39:u05:national-genomic-test-directories/., +10:u07:home),, +11:u08:Somatic, +9:u05:Lists, +11:u07:IntOGen, +9:u08:Atlas, +22:u10:genes#sections=tx,, +39:u13:national-genomic-test-directories/., +10:uI2:---/.-, +30:u00:sanger.ac.uk/actionability, +22:u01:Genes#sections=Tx,, +39:u04:national-genomic-test-directories/., +10:u06:home),, +9:u04:Lists, +11:u06:IntOGen, +9:u07:Atlas, +39:u12:national-genomic-test-directories/., +10:u14:home),, +10:uI1:---/.-, +22:u00:Genes#sections=Tx,, +39:u03:national-genomic-test-directories/., +10:u05:home),, +11:u07:Somatic, +9:u03:Lists, +11:u05:IntOGen, +9:u06:Atlas, +7:u08:VEP, +39:u11:national-genomic-test-directories/., +10:u13:home),, +10:uI0:---/.-, +14:uI2:),(://../), +39:u02:national-genomic-test-directories/., +10:u04:home),, +11:u06:Somatic, +9:u02:Lists, +11:u04:IntOGen, +9:u05:Atlas, +7:u07:VEP, +39:u10:national-genomic-test-directories/., +10:u12:home),, +14:uI1:),(://../), +9:uI2:()-.., +39:u01:national-genomic-test-directories/., +10:u03:home),, +11:u05:Somatic, +56:u08:https://intogen.readthedocs.io/en/latest/index.html., +9:u01:Lists, +11:u03:IntOGen, +9:u04:Atlas, +7:u06:VEP, +10:u11:home),, +14:uI0:),(://../), +9:uI1:()-.., +39:u00:national-genomic-test-directories/., +10:u02:home),, +11:u04:Somatic, +9:u00:Lists, +11:u02:IntOGen, +9:u03:Atlas, +7:u05:VEP, +10:u10:home),, +8:u23:Soma, +9:uI0:()-.., +10:u01:home),, +11:u03:Somatic, +56:u07:https://intogen.readthedocs.io/en/latest/index.html., +11:u01:IntOGen, +9:u02:Atlas, +7:u04:VEP, +10:u00:home),, +11:u02:Somatic, +56:u06:https://intogen.readthedocs.io/en/latest/index.html., +12:u08:access/), +11:u00:IntOGen, +9:u01:Atlas, +7:u03:VEP, +56:u14:https://intogen.readthedocs.io/en/latest/index.html., +7:u22:Cod, +8:u23:Code, +11:u01:Somatic, +56:u05:https://intogen.readthedocs.io/en/latest/index.html., +9:u00:Atlas, +7:u02:VEP, +56:u13:https://intogen.readthedocs.io/en/latest/index.html., +14:uI2:://..///.., +11:u00:Somatic, +56:u04:https://intogen.readthedocs.io/en/latest/index.html., +12:u07:access/), +7:u01:VEP, +56:u12:https://intogen.readthedocs.io/en/latest/index.html., +14:uI1:://..///.., +56:u03:https://intogen.readthedocs.io/en/latest/index.html., +12:u06:access/), +7:u00:VEP, +56:u11:https://intogen.readthedocs.io/en/latest/index.html., +12:u14:access/), +14:uI0:://..///.., +13:uI2:(://-.../, +56:u02:https://intogen.readthedocs.io/en/latest/index.html., +12:u05:access/), +56:u10:https://intogen.readthedocs.io/en/latest/index.html., +12:u13:access/), +13:uI1:(://-.../, +12:uI2:/)/////., +56:u01:https://intogen.readthedocs.io/en/latest/index.html., +12:u04:access/), +44:u08:(https://doi.org/10.5281/zenodo.8329054), +10:u08:canSAR, +12:u12:access/), +13:uI0:(://-.../, +12:uI1:/)/////., +56:u00:https://intogen.readthedocs.io/en/latest/index.html., +12:u03:access/), +10:u07:canSAR, +9:u08:(ref., +12:u11:access/), +12:uI0:/)/////., +12:u02:access/), +44:u07:(https://doi.org/10.5281/zenodo.8329054), +10:u06:canSAR, +9:u07:(ref., +12:u10:access/), +12:u01:access/), +44:u06:(https://doi.org/10.5281/zenodo.8329054), +10:u05:canSAR, +9:u06:(ref., +44:u14:(https://doi.org/10.5281/zenodo.8329054), +12:u00:access/), +44:u05:(https://doi.org/10.5281/zenodo.8329054), +10:u04:canSAR, +9:u05:(ref., +44:u13:(https://doi.org/10.5281/zenodo.8329054), +18:uI2:(://././.)(.)., +44:u04:(https://doi.org/10.5281/zenodo.8329054), +10:u03:canSAR, +9:u04:(ref., +44:u12:(https://doi.org/10.5281/zenodo.8329054), +18:uI1:(://././.)(.)., +44:u03:(https://doi.org/10.5281/zenodo.8329054), +10:u02:canSAR, +9:u03:(ref., +14:u08:Salipante,, +44:u11:(https://doi.org/10.5281/zenodo.8329054), +18:uI0:(://././.)(.)., +44:u02:(https://doi.org/10.5281/zenodo.8329054), +10:u01:canSAR, +9:u02:(ref., +14:u07:Salipante,, +14:u08:Pritchard,, +44:u10:(https://doi.org/10.5281/zenodo.8329054), +44:u01:(https://doi.org/10.5281/zenodo.8329054), +10:u00:canSAR, +9:u01:(ref., +14:u06:Salipante,, +14:u07:Pritchard,, +44:u00:(https://doi.org/10.5281/zenodo.8329054), +9:u00:(ref., +14:u05:Salipante,, +14:u06:Pritchard,, +11:u08:563-575, +14:u04:Salipante,, +14:u05:Pritchard,, +14:u03:Salipante,, +14:u04:Pritchard,, +11:u07:563-575, +14:u02:Salipante,, +14:u03:Pritchard,, +9:u08:Tate,, +11:u06:563-575, +14:u01:Salipante,, +14:u02:Pritchard,, +9:u07:Tate,, +11:u14:563-575, +11:u05:563-575, +14:u00:Salipante,, +14:u01:Pritchard,, +9:u06:Tate,, +12:u08:Orchard,, +11:u13:563-575, +11:u04:563-575, +14:u00:Pritchard,, +9:u05:Tate,, +12:u07:Orchard,, +11:u12:563-575, +8:u23:563-, +11:u03:563-575, +9:u04:Tate,, +12:u06:Orchard,, +11:u11:563-575, +11:u02:563-575, +19:u08:recalibrations., +9:u03:Tate,, +12:u05:Orchard,, +13:u08:Hornbeck,, +11:u10:563-575, +11:u01:563-575, +9:u02:Tate,, +12:u04:Orchard,, +13:u07:Hornbeck,, +11:u00:563-575, +19:u07:recalibrations., +9:u01:Tate,, +12:u03:Orchard,, +13:u06:Hornbeck,, +14:u08:Caulfield,, +19:u06:recalibrations., +9:u00:Tate,, +12:u02:Orchard,, +13:u05:Hornbeck,, +14:u07:Caulfield,, +50:u08:https://doi.org/10.6084/m9.figshare.4530893.v7, +19:u14:recalibrations., +12:uI2:.,...,:,, +19:u05:recalibrations., +10:u08:Zenodo, +12:u01:Orchard,, +13:u04:Hornbeck,, +14:u06:Caulfield,, +50:u07:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u08:Lärkeryd,, +19:u13:recalibrations., +12:uI1:.,...,:,, +19:u04:recalibrations., +12:u00:Orchard,, +13:u03:Hornbeck,, +14:u05:Caulfield,, +50:u06:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u07:Lärkeryd,, +42:u08:https://doi.org/10.5281/zenodo.8329054, +19:u12:recalibrations., +12:uI0:.,...,:,, +11:uI2:.,..[]., +19:u03:recalibrations., +10:u07:Zenodo, +13:u02:Hornbeck,, +14:u04:Caulfield,, +50:u05:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u06:Lärkeryd,, +42:u07:https://doi.org/10.5281/zenodo.8329054, +12:u08:Shannon,, +19:u11:recalibrations., +11:uI1:.,..[]., +17:uI2:://././...()., +19:u02:recalibrations., +10:u06:Zenodo, +13:u01:Hornbeck,, +14:u03:Caulfield,, +50:u04:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u05:Lärkeryd,, +42:u06:https://doi.org/10.5281/zenodo.8329054, +12:u07:Shannon,, +19:u10:recalibrations., +10:u14:zenodo, +11:uI0:.,..[]., +17:uI1:://././...()., +17:uI2:.,./-:..(..)., +19:u01:recalibrations., +10:u05:Zenodo, +13:u00:Hornbeck,, +14:u02:Caulfield,, +50:u03:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u04:Lärkeryd,, +42:u05:https://doi.org/10.5281/zenodo.8329054, +12:u06:Shannon,, +10:u13:zenodo, +17:uI0:://././...()., +17:uI1:.,./-:..(..)., +19:u00:recalibrations., +10:u04:Zenodo, +14:u01:Caulfield,, +50:u02:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u03:Lärkeryd,, +42:u04:https://doi.org/10.5281/zenodo.8329054, +12:u05:Shannon,, +10:u12:zenodo, +7:u22:Zen, +8:u23:Zeno, +17:uI0:.,./-:..(..)., +10:u03:Zenodo, +14:u00:Caulfield,, +50:u01:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u02:Lärkeryd,, +42:u03:https://doi.org/10.5281/zenodo.8329054, +12:u04:Shannon,, +10:u11:zenodo, +10:u02:Zenodo, +50:u00:https://doi.org/10.6084/m9.figshare.4530893.v7, +14:u01:Lärkeryd,, +42:u02:https://doi.org/10.5281/zenodo.8329054, +12:u03:Shannon,, +10:u10:zenodo, +10:u01:Zenodo, +14:u00:Lärkeryd,, +42:u01:https://doi.org/10.5281/zenodo.8329054, +12:u02:Shannon,, +10:u00:Zenodo, +42:u00:https://doi.org/10.5281/zenodo.8329054, +12:u01:Shannon,, +12:u00:Shannon,, +20:u08:(227000/Z/23/Z)., +11:u08:Marsden, +20:u07:(227000/Z/23/Z)., +20:u06:(227000/Z/23/Z)., +11:u07:Marsden, +20:u05:(227000/Z/23/Z)., +10:uI2:(///)., +11:u06:Marsden, +20:u04:(227000/Z/23/Z)., +11:u14:marsden, +10:uI1:(///)., +11:u05:Marsden, +20:u03:(227000/Z/23/Z)., +11:u13:marsden, +10:uI0:(///)., +11:u04:Marsden, +20:u02:(227000/Z/23/Z)., +11:u12:marsden, +11:u03:Marsden, +20:u01:(227000/Z/23/Z)., +11:u11:marsden, +11:u02:Marsden, +20:u00:(227000/Z/23/Z)., +11:u10:marsden, +11:u01:Marsden, +11:u14:100,000, +11:u00:Marsden, +11:u13:100,000, +11:u12:100,000, +11:u11:100,000, +11:u10:100,000, +9:u08:B.K.,, +9:u07:B.K.,, +9:u06:B.K.,, +11:u08:A.J.G.,, +9:u14:b.k.,, +9:u05:B.K.,, +15:u08:manuscript;, +11:u07:A.J.G.,, +9:u13:b.k.,, +21:uI2:..,.......,..,..., +9:u04:B.K.,, +11:u06:A.J.G.,, +9:u12:b.k.,, +9:u14:r.c.,, +7:u22:B.K, +8:u23:B.K., +21:uI1:..,.......,..,..., +23:uI2:.....,..,..,...,..,, +9:u03:B.K.,, +15:u07:manuscript;, +11:u05:A.J.G.,, +9:u11:b.k.,, +9:u13:r.c.,, +21:uI0:..,.......,..,..., +23:uI1:.....,..,..,...,..,, +18:uI2:..,...,..,...., +9:u02:B.K.,, +15:u06:manuscript;, +11:u04:A.J.G.,, +9:u10:b.k.,, +9:u12:r.c.,, +15:u14:manuscript;, +23:uI0:.....,..,..,...,..,, +18:uI1:..,...,..,...., +15:uI2:...,..,...., +9:u01:B.K.,, +15:u05:manuscript;, +11:u03:A.J.G.,, +9:u11:r.c.,, +15:u13:manuscript;, +18:uI0:..,...,..,...., +15:uI1:...,..,...., +9:u00:B.K.,, +15:u04:manuscript;, +11:u02:A.J.G.,, +9:u10:r.c.,, +15:u12:manuscript;, +15:uI0:...,..,...., +15:u03:manuscript;, +47:u08:https://doi.org/10.1038/s41588-024-01785-9., +11:u01:A.J.G.,, +15:u11:manuscript;, +15:u02:manuscript;, +11:u00:A.J.G.,, +15:u10:manuscript;, +15:u01:manuscript;, +47:u07:https://doi.org/10.1038/s41588-024-01785-9., +15:u00:manuscript;, +47:u06:https://doi.org/10.1038/s41588-024-01785-9., +47:u14:https://doi.org/10.1038/s41588-024-01785-9., +47:u05:https://doi.org/10.1038/s41588-024-01785-9., +47:u13:https://doi.org/10.1038/s41588-024-01785-9., +47:u04:https://doi.org/10.1038/s41588-024-01785-9., +47:u12:https://doi.org/10.1038/s41588-024-01785-9., +47:u03:https://doi.org/10.1038/s41588-024-01785-9., +13:u08:Houlston., +47:u11:https://doi.org/10.1038/s41588-024-01785-9., +47:u02:https://doi.org/10.1038/s41588-024-01785-9., +13:u07:Houlston., +47:u10:https://doi.org/10.1038/s41588-024-01785-9., +47:u01:https://doi.org/10.1038/s41588-024-01785-9., +13:u06:Houlston., +47:u00:https://doi.org/10.1038/s41588-024-01785-9., +13:u05:Houlston., +28:u08:www.nature.com/reprints., +13:u04:Houlston., +13:u03:Houlston., +28:u07:www.nature.com/reprints., +13:u02:Houlston., +28:u06:www.nature.com/reprints., +13:u01:Houlston., +28:u14:www.nature.com/reprints., +28:u05:www.nature.com/reprints., +13:u00:Houlston., +28:u13:www.nature.com/reprints., +28:u04:www.nature.com/reprints., +28:u12:www.nature.com/reprints., +28:u03:www.nature.com/reprints., +28:u11:www.nature.com/reprints., +28:u02:www.nature.com/reprints., +28:u10:www.nature.com/reprints., +28:u01:www.nature.com/reprints., +28:u00:www.nature.com/reprints., +14:u08:Colorectum, +14:u07:Colorectum, +14:u06:Colorectum, +12:u08:Melanoma, +14:u14:colorectum, +14:u05:Colorectum, +14:u08:Oesophagus, +14:u13:colorectum, +14:u04:Colorectum, +12:u07:Melanoma, +9:u08:Ovary, +14:u12:colorectum, +14:u03:Colorectum, +12:u06:Melanoma, +14:u07:Oesophagus, +12:u08:Pancreas, +14:u11:colorectum, +12:u14:melanoma, +14:u02:Colorectum, +12:u05:Melanoma, +14:u06:Oesophagus, +9:u07:Ovary, +12:u08:Prostate, +14:u10:colorectum, +12:u13:melanoma, +14:u14:oesophagus, +14:u01:Colorectum, +12:u04:Melanoma, +14:u05:Oesophagus, +9:u06:Ovary, +12:u07:Pancreas, +10:u08:Testis, +12:u12:melanoma, +14:u13:oesophagus, +9:u14:ovary, +14:u00:Colorectum, +12:u03:Melanoma, +14:u04:Oesophagus, +9:u05:Ovary, +12:u06:Pancreas, +12:u07:Prostate, +10:u08:Uterus, +12:u11:melanoma, +14:u12:oesophagus, +9:u13:ovary, +12:u14:pancreas, +6:u21:Oe, +7:u22:Oes, +8:u23:Oeso, +12:u02:Melanoma, +14:u03:Oesophagus, +9:u04:Ovary, +12:u05:Pancreas, +12:u06:Prostate, +10:u07:Testis, +8:u08:Site, +12:u10:melanoma, +14:u11:oesophagus, +9:u12:ovary, +12:u13:pancreas, +12:u14:prostate, +12:u01:Melanoma, +14:u02:Oesophagus, +9:u03:Ovary, +12:u04:Pancreas, +12:u05:Prostate, +10:u06:Testis, +10:u07:Uterus, +14:u10:oesophagus, +9:u11:ovary, +12:u12:pancreas, +12:u13:prostate, +10:u14:testis, +12:u00:Melanoma, +14:u01:Oesophagus, +9:u02:Ovary, +12:u03:Pancreas, +12:u04:Prostate, +10:u05:Testis, +10:u06:Uterus, +8:u07:Site, +9:u10:ovary, +12:u11:pancreas, +12:u12:prostate, +10:u13:testis, +10:u14:uterus, +14:u00:Oesophagus, +9:u01:Ovary, +12:u02:Pancreas, +12:u03:Prostate, +10:u04:Testis, +10:u05:Uterus, +8:u06:Site, +12:u10:pancreas, +12:u11:prostate, +10:u12:testis, +10:u13:uterus, +9:u00:Ovary, +12:u01:Pancreas, +12:u02:Prostate, +10:u03:Testis, +10:u04:Uterus, +8:u05:Site, +12:u10:prostate, +10:u11:testis, +10:u12:uterus, +12:u00:Pancreas, +12:u01:Prostate, +10:u02:Testis, +10:u03:Uterus, +8:u04:Site, +10:u10:testis, +10:u11:uterus, +12:u00:Prostate, +10:u01:Testis, +10:u02:Uterus, +8:u03:Site, +10:u10:uterus, +10:u00:Testis, +10:u01:Uterus, +8:u02:Site, +10:u00:Uterus, +8:u01:Site, +8:u00:Site, +10:u08:panel:, +10:u07:panel:, +10:u06:panel:, +10:u14:panel:, +10:u05:panel:, +10:u13:panel:, +10:u04:panel:, +10:u12:panel:, +10:u03:panel:, +10:u11:panel:, +10:u02:panel:, +10:u10:panel:, +10:u01:panel:, +10:u00:panel:, +8:u08:2324, +8:u07:2324, +8:u06:2324, +8:u14:2324, +8:u05:2324, +7:u08:126, +8:u13:2324, +8:u04:2324, +8:u12:2324, +8:u23:2324, +8:u03:2324, +7:u07:126, +8:u11:2324, +8:u02:2324, +7:u06:126, +8:u10:2324, +7:u14:126, +8:u01:2324, +7:u05:126, +7:u13:126, +8:u00:2324, +7:u04:126, +7:u12:126, +7:u23:126, +7:u03:126, +7:u11:126, +7:u02:126, +7:u10:126, +7:u01:126, +7:u00:126, +7:u14:133, +7:u13:133, +7:u12:133, +7:u23:133, +7:u08:872, +7:u11:133, +7:u10:133, +7:u07:872, +7:u06:872, +7:u14:872, +7:u05:872, +7:u08:677, +7:u13:872, +7:u04:872, +7:u12:872, +7:u22:872, +7:u23:872, +7:u03:872, +7:u07:677, +7:u11:872, +7:u02:872, +7:u06:677, +7:u10:872, +7:u14:677, +7:u01:872, +7:u05:677, +7:u13:677, +7:u00:872, +7:u04:677, +7:u12:677, +7:u22:677, +7:u23:677, +7:u03:677, +7:u11:677, +7:u02:677, +7:u10:677, +7:u01:677, +7:u00:677, +10:u08:100000, +11:u08:1000000, +10:u07:100000, +12:u08:10000000, +10:u06:100000, +11:u07:1000000, +10:u14:100000, +10:u05:100000, +11:u06:1000000, +12:u07:10000000, +10:u13:100000, +11:u14:1000000, +10:u04:100000, +11:u05:1000000, +12:u06:10000000, +10:u12:100000, +11:u13:1000000, +12:u14:10000000, +10:u03:100000, +11:u04:1000000, +12:u05:10000000, +10:u11:100000, +11:u12:1000000, +12:u13:10000000, +10:u02:100000, +11:u03:1000000, +12:u04:10000000, +10:u10:100000, +11:u11:1000000, +12:u12:10000000, +10:u01:100000, +11:u02:1000000, +12:u03:10000000, +11:u10:1000000, +12:u11:10000000, +10:u00:100000, +11:u01:1000000, +12:u02:10000000, +12:u10:10000000, +11:u00:1000000, +12:u01:10000000, +12:u00:10000000, +7:u08:SNV, +7:u07:SNV, +8:u08:SNV,, +7:u06:SNV, +7:u14:snv, +7:u05:SNV, +8:u07:SNV,, +7:u13:snv, +7:u04:SNV, +8:u06:SNV,, +7:u12:snv, +8:u14:snv,, +7:u22:SNV, +7:u23:SNV, +7:u03:SNV, +8:u05:SNV,, +7:u11:snv, +8:u13:snv,, +7:u02:SNV, +8:u04:SNV,, +7:u10:snv, +8:u12:snv,, +8:u23:SNV,, +7:u01:SNV, +8:u03:SNV,, +8:u11:snv,, +7:u00:SNV, +8:u02:SNV,, +8:u10:snv,, +8:u01:SNV,, +18:u08:Recep_L_domain, +8:u00:SNV,, +14:u08:Furin-like, +18:u07:Recep_L_domain, +15:u08:GF_recep_IV, +18:u06:Recep_L_domain, +14:u07:Furin-like, +18:u08:PK_Tyr_Ser-Thr, +18:u14:recep_l_domain, +18:u05:Recep_L_domain, +14:u06:Furin-like, +15:u07:GF_recep_IV, +18:u13:recep_l_domain, +18:u04:Recep_L_domain, +14:u05:Furin-like, +15:u06:GF_recep_IV, +18:u07:PK_Tyr_Ser-Thr, +18:u12:recep_l_domain, +15:u14:gf_recep_iv, +18:u03:Recep_L_domain, +14:u04:Furin-like, +15:u05:GF_recep_IV, +18:u06:PK_Tyr_Ser-Thr, +18:u11:recep_l_domain, +15:u13:gf_recep_iv, +18:u14:pk_tyr_ser-thr, +8:u23:Furi, +18:u02:Recep_L_domain, +14:u03:Furin-like, +15:u04:GF_recep_IV, +18:u05:PK_Tyr_Ser-Thr, +18:u10:recep_l_domain, +15:u12:gf_recep_iv, +18:u13:pk_tyr_ser-thr, +7:u22:GF_, +8:u23:GF_r, +18:u01:Recep_L_domain, +14:u02:Furin-like, +15:u03:GF_recep_IV, +18:u04:PK_Tyr_Ser-Thr, +15:u11:gf_recep_iv, +18:u12:pk_tyr_ser-thr, +7:u22:PK_, +8:u23:PK_T, +18:u00:Recep_L_domain, +14:u01:Furin-like, +15:u02:GF_recep_IV, +18:u03:PK_Tyr_Ser-Thr, +15:u10:gf_recep_iv, +18:u11:pk_tyr_ser-thr, +14:u00:Furin-like, +15:u01:GF_recep_IV, +18:u02:PK_Tyr_Ser-Thr, +18:u10:pk_tyr_ser-thr, +15:u00:GF_recep_IV, +18:u01:PK_Tyr_Ser-Thr, +18:u00:PK_Tyr_Ser-Thr, +6:u08:lu, +6:u08:.G, +6:u07:.G, +6:u07:lu, +6:u06:.G, +6:u06:lu, +6:u05:.G, +6:u05:lu, +6:u04:.G, +6:u04:lu, +6:u03:.G, +6:u22:lu, +6:u23:lu, +6:u03:lu, +6:u02:.G, +6:u02:lu, +6:u01:.G, +6:u01:lu, +6:u00:.G, +6:u00:lu, +6:u08:.L, +6:u07:.L, +6:u06:.L, +6:u05:.L, +6:u04:.L, +6:u03:.L, +6:u02:.L, +6:u01:.L, +6:u00:.L, +6:u08:.A, +6:u07:.A, +6:u06:.A, +6:u05:.A, +6:u04:.A, +6:u03:.A, +6:u02:.A, +6:u01:.A, +6:u00:.A, +6:u08:.S, +6:u07:.S, +6:u08:r7, +6:u06:.S, +6:u07:r7, +6:u05:.S, +6:u06:r7, +6:u04:.S, +6:u05:r7, +6:u03:.S, +6:u04:r7, +6:u02:.S, +6:u03:r7, +6:u01:.S, +6:u02:r7, +6:u00:.S, +6:u01:r7, +6:u00:r7, +6:u08:ro, +6:u08:.P, +6:u07:.P, +6:u07:ro, +6:u06:.P, +6:u06:ro, +6:u05:.P, +6:u14:ro, +6:u05:ro, +6:u04:.P, +6:u13:ro, +6:u04:ro, +6:u03:.P, +6:u12:ro, +6:u22:ro, +6:u23:ro, +6:u03:ro, +6:u02:.P, +6:u11:ro, +6:u02:ro, +6:u01:.P, +6:u10:ro, +6:u01:ro, +6:u00:.P, +6:u14:ln, +6:u00:ro, +6:u13:ln, +6:u12:ln, +6:u22:ln, +6:u23:ln, +6:u11:ln, +6:u10:ln, +6:u08:.H, +6:u07:.H, +6:u06:.H, +6:u05:.H, +6:u04:.H, +6:u03:.H, +6:u02:.H, +6:u01:.H, +6:u00:.H, +6:u08:.T, +6:u07:.T, +6:u06:.T, +6:u05:.T, +6:u04:.T, +6:u03:.T, +6:u02:.T, +6:u01:.T, +6:u00:.T, +11:u08:Inframe, +11:u07:Inframe, +12:u08:Missense, +11:u06:Inframe, +17:u08:Nonsynonymous, +11:u14:inframe, +11:u05:Inframe, +12:u07:Missense, +7:u08:VUS, +11:u13:inframe, +11:u04:Inframe, +12:u06:Missense, +17:u07:Nonsynonymous, +11:u12:inframe, +8:u23:Infr, +11:u03:Inframe, +12:u05:Missense, +17:u06:Nonsynonymous, +7:u07:VUS, +6:u08:AA, +11:u11:inframe, +17:u14:nonsynonymous, +11:u02:Inframe, +12:u04:Missense, +17:u05:Nonsynonymous, +7:u06:VUS, +11:u10:inframe, +17:u13:nonsynonymous, +7:u14:vus, +8:u23:Miss, +11:u01:Inframe, +12:u03:Missense, +17:u04:Nonsynonymous, +7:u05:VUS, +6:u07:AA, +21:u08:(ENST00000275493), +17:u12:nonsynonymous, +7:u13:vus, +11:u00:Inframe, +12:u02:Missense, +17:u03:Nonsynonymous, +7:u04:VUS, +6:u06:AA, +21:u07:(ENST00000275493), +17:u11:nonsynonymous, +7:u12:vus, +6:u21:VU, +7:u22:VUS, +7:u23:VUS, +12:u01:Missense, +17:u02:Nonsynonymous, +7:u03:VUS, +6:u05:AA, +21:u06:(ENST00000275493), +17:u10:nonsynonymous, +7:u11:vus, +12:u00:Missense, +17:u01:Nonsynonymous, +7:u02:VUS, +6:u04:AA, +21:u05:(ENST00000275493), +7:u10:vus, +6:u22:AA, +6:u23:AA, +17:u00:Nonsynonymous, +7:u01:VUS, +6:u03:AA, +21:u04:(ENST00000275493), +7:u00:VUS, +6:u02:AA, +21:u03:(ENST00000275493), +6:u01:AA, +21:u02:(ENST00000275493), +6:u00:AA, +21:u01:(ENST00000275493), +21:u00:(ENST00000275493), +6:u08:rg, +6:u07:rg, +6:u06:rg, +6:u14:rg, +6:u05:rg, +6:u13:rg, +6:u04:rg, +6:u12:rg, +6:u21:rg, +6:u22:rg, +6:u23:rg, +6:u03:rg, +6:u11:rg, +6:u02:rg, +6:u10:rg, +6:u01:rg, +6:u00:rg, +6:u08:r2, +6:u07:r2, +6:u06:r2, +6:u05:r2, +6:u04:r2, +6:u03:r2, +6:u02:r2, +6:u01:r2, +6:u00:r2, +6:u08:r3, +6:u07:r3, +6:u06:r3, +6:u05:r3, +6:u04:r3, +6:u03:r3, +6:u02:r3, +6:u01:r3, +6:u00:r3, +6:u08:r6, +6:u07:r6, +6:u06:r6, +6:u05:r6, +6:u04:r6, +6:u03:r6, +6:u02:r6, +6:u01:r6, +6:u00:r6, +8:u08:GBM,, +12:u08:PI3K_rbd, +7:u08:IDH, +8:u07:GBM,, +18:u08:PI3_PI4_kinase, +7:u07:IDH, +8:u06:GBM,, +12:u07:PI3K_rbd, +11:u08:PI3K_C2, +7:u06:IDH, +8:u14:gbm,, +8:u05:GBM,, +12:u06:PI3K_rbd, +18:u07:PI3_PI4_kinase, +13:u08:PI3K_p85B, +7:u05:IDH, +8:u13:gbm,, +12:u14:pi3k_rbd, +8:u04:GBM,, +12:u05:PI3K_rbd, +18:u06:PI3_PI4_kinase, +11:u07:PI3K_C2, +9:u08:PI3Ka, +7:u04:IDH, +8:u12:gbm,, +12:u13:pi3k_rbd, +18:u14:pi3_pi4_kinase, +7:u22:GBM, +8:u23:GBM,, +8:u03:GBM,, +12:u04:PI3K_rbd, +18:u05:PI3_PI4_kinase, +11:u06:PI3K_C2, +13:u07:PI3K_p85B, +7:u03:IDH, +8:u11:gbm,, +12:u12:pi3k_rbd, +18:u13:pi3_pi4_kinase, +11:u14:pi3k_c2, +7:u22:PI3, +8:u23:PI3K, +8:u02:GBM,, +12:u03:PI3K_rbd, +18:u04:PI3_PI4_kinase, +11:u05:PI3K_C2, +13:u06:PI3K_p85B, +9:u07:PI3Ka, +7:u02:IDH, +8:u10:gbm,, +12:u11:pi3k_rbd, +18:u12:pi3_pi4_kinase, +11:u13:pi3k_c2, +13:u14:pi3k_p85b, +8:u23:PI3_, +8:u01:GBM,, +12:u02:PI3K_rbd, +18:u03:PI3_PI4_kinase, +11:u04:PI3K_C2, +13:u05:PI3K_p85B, +9:u06:PI3Ka, +7:u01:IDH, +12:u10:pi3k_rbd, +18:u11:pi3_pi4_kinase, +11:u12:pi3k_c2, +13:u13:pi3k_p85b, +9:u14:pi3ka, +8:u00:GBM,, +12:u01:PI3K_rbd, +18:u02:PI3_PI4_kinase, +11:u03:PI3K_C2, +13:u04:PI3K_p85B, +9:u05:PI3Ka, +7:u08:375, +7:u00:IDH, +18:u10:pi3_pi4_kinase, +11:u11:pi3k_c2, +13:u12:pi3k_p85b, +9:u13:pi3ka, +12:u00:PI3K_rbd, +18:u01:PI3_PI4_kinase, +11:u02:PI3K_C2, +13:u03:PI3K_p85B, +9:u04:PI3Ka, +11:u10:pi3k_c2, +13:u11:pi3k_p85b, +9:u12:pi3ka, +18:u00:PI3_PI4_kinase, +11:u01:PI3K_C2, +13:u02:PI3K_p85B, +9:u03:PI3Ka, +7:u07:375, +13:u10:pi3k_p85b, +9:u11:pi3ka, +11:u00:PI3K_C2, +13:u01:PI3K_p85B, +9:u02:PI3Ka, +7:u06:375, +9:u10:pi3ka, +7:u14:375, +13:u00:PI3K_p85B, +9:u01:PI3Ka, +7:u05:375, +7:u13:375, +9:u00:PI3Ka, +7:u04:375, +7:u12:375, +7:u14:625, +7:u23:375, +7:u03:375, +8:u08:1068, +7:u11:375, +7:u13:625, +7:u02:375, +7:u10:375, +7:u12:625, +7:u22:625, +7:u23:625, +7:u01:375, +8:u07:1068, +7:u11:625, +7:u00:375, +8:u06:1068, +7:u10:625, +8:u14:1068, +8:u05:1068, +8:u13:1068, +8:u04:1068, +8:u12:1068, +8:u23:1068, +8:u03:1068, +8:u11:1068, +8:u02:1068, +8:u10:1068, +8:u01:1068, +8:u00:1068, +14:u08:Frameshift, +14:u07:Frameshift, +14:u06:Frameshift, +14:u14:frameshift, +14:u05:Frameshift, +14:u13:frameshift, +14:u04:Frameshift, +11:u08:Uterine, +21:u08:(ENST00000263967), +14:u12:frameshift, +14:u03:Frameshift, +21:u07:(ENST00000263967), +14:u11:frameshift, +14:u02:Frameshift, +11:u07:Uterine, +21:u06:(ENST00000263967), +14:u10:frameshift, +14:u01:Frameshift, +11:u06:Uterine, +21:u05:(ENST00000263967), +14:u00:Frameshift, +11:u05:Uterine, +21:u04:(ENST00000263967), +11:u04:Uterine, +21:u03:(ENST00000263967), +11:u03:Uterine, +21:u02:(ENST00000263967), +11:u02:Uterine, +21:u01:(ENST00000263967), +11:u01:Uterine, +21:u00:(ENST00000263967), +11:u00:Uterine, +6:u08:.C, +6:u07:.C, +6:u06:.C, +6:u05:.C, +6:u04:.C, +6:u03:.C, +6:u02:.C, +6:u01:.C, +6:u00:.C, +13:u08:smRegions, +13:u07:smRegions, +13:u06:smRegions, +13:u14:smregions, +13:u05:smRegions, +13:u13:smregions, +13:u04:smRegions, +13:u12:smregions, +7:u22:smR, +8:u23:smRe, +13:u03:smRegions, +13:u11:smregions, +13:u02:smRegions, +13:u10:smregions, +13:u01:smRegions, +13:u00:smRegions, +10:u08:Tumour, +10:u07:Tumour, +10:u06:Tumour, +10:u08:tumour, +10:u14:tumour, +10:u05:Tumour, +10:u13:tumour, +10:u04:Tumour, +10:u07:tumour, +10:u12:tumour, +10:u03:Tumour, +10:u06:tumour, +16:u08:Oncogenicity, +10:u11:tumour, +10:u02:Tumour, +10:u05:tumour, +16:u07:Oncogenicity, +10:u10:tumour, +10:u01:Tumour, +10:u04:tumour, +16:u06:Oncogenicity, +10:u00:Tumour, +10:u03:tumour, +16:u05:Oncogenicity, +10:u02:tumour, +16:u04:Oncogenicity, +10:u01:tumour, +16:u03:Oncogenicity, +10:u00:tumour, +16:u02:Oncogenicity, +16:u01:Oncogenicity, +16:u00:Oncogenicity, +10:u08:TCF7L2, +10:u08:TGFBR2, +10:u07:TCF7L2, +10:u06:TCF7L2, +10:u07:TGFBR2, +10:u14:tcf7l2, +10:u05:TCF7L2, +10:u06:TGFBR2, +10:u13:tcf7l2, +10:u14:tgfbr2, +10:u04:TCF7L2, +10:u05:TGFBR2, +8:u08:SOX9, +10:u12:tcf7l2, +10:u13:tgfbr2, +7:u22:TCF, +8:u23:TCF7, +10:u03:TCF7L2, +10:u04:TGFBR2, +10:u11:tcf7l2, +10:u12:tgfbr2, +10:u02:TCF7L2, +10:u03:TGFBR2, +8:u07:SOX9, +10:u10:tcf7l2, +10:u11:tgfbr2, +10:u01:TCF7L2, +10:u02:TGFBR2, +8:u06:SOX9, +10:u10:tgfbr2, +8:u14:sox9, +10:u00:TCF7L2, +10:u01:TGFBR2, +8:u05:SOX9, +8:u13:sox9, +10:u00:TGFBR2, +8:u04:SOX9, +8:u12:sox9, +8:u23:SOX9, +8:u03:SOX9, +8:u11:sox9, +8:u02:SOX9, +8:u10:sox9, +8:u01:SOX9, +8:u00:SOX9, +9:u08:BRCA1, +9:u08:SMAD2, +9:u07:BRCA1, +9:u06:BRCA1, +9:u07:SMAD2, +9:u14:brca1, +9:u05:BRCA1, +9:u06:SMAD2, +9:u13:brca1, +9:u14:smad2, +9:u04:BRCA1, +9:u05:SMAD2, +9:u12:brca1, +9:u13:smad2, +9:u03:BRCA1, +9:u04:SMAD2, +9:u08:AMER1, +9:u11:brca1, +9:u12:smad2, +9:u02:BRCA1, +9:u03:SMAD2, +9:u10:brca1, +9:u11:smad2, +9:u01:BRCA1, +9:u02:SMAD2, +9:u07:AMER1, +9:u10:smad2, +9:u00:BRCA1, +9:u01:SMAD2, +9:u06:AMER1, +9:u14:amer1, +9:u00:SMAD2, +9:u05:AMER1, +9:u08:SMAD3, +9:u13:amer1, +9:u04:AMER1, +9:u12:amer1, +7:u22:AME, +8:u23:AMER, +9:u03:AMER1, +9:u07:SMAD3, +9:u11:amer1, +9:u02:AMER1, +9:u06:SMAD3, +8:u08:XPO1, +9:u10:amer1, +9:u14:smad3, +9:u01:AMER1, +9:u05:SMAD3, +9:u13:smad3, +9:u00:AMER1, +9:u04:SMAD3, +8:u07:XPO1, +10:u08:FCGR3A, +9:u12:smad3, +9:u03:SMAD3, +8:u06:XPO1, +9:u08:ACVR1, +9:u11:smad3, +8:u14:xpo1, +9:u02:SMAD3, +8:u05:XPO1, +10:u07:FCGR3A, +8:u08:XCL2, +9:u10:smad3, +8:u13:xpo1, +9:u01:SMAD3, +8:u04:XPO1, +10:u06:FCGR3A, +9:u07:ACVR1, +11:u08:ANKRD36, +8:u12:xpo1, +10:u14:fcgr3a, +6:u21:XP, +7:u22:XPO, +8:u23:XPO1, +9:u00:SMAD3, +8:u03:XPO1, +10:u05:FCGR3A, +9:u06:ACVR1, +8:u07:XCL2, +11:u08:CNTNAP3, +8:u11:xpo1, +10:u13:fcgr3a, +9:u14:acvr1, +8:u02:XPO1, +10:u04:FCGR3A, +9:u05:ACVR1, +8:u06:XCL2, +11:u07:ANKRD36, +9:u08:IGSF3, +8:u10:xpo1, +10:u12:fcgr3a, +9:u13:acvr1, +8:u14:xcl2, +7:u22:FCG, +8:u23:FCGR, +8:u01:XPO1, +10:u03:FCGR3A, +9:u04:ACVR1, +8:u05:XCL2, +11:u06:ANKRD36, +11:u07:CNTNAP3, +9:u08:PCBP1, +10:u11:fcgr3a, +9:u12:acvr1, +8:u13:xcl2, +11:u14:ankrd36, +8:u00:XPO1, +10:u02:FCGR3A, +9:u03:ACVR1, +8:u04:XCL2, +11:u05:ANKRD36, +11:u06:CNTNAP3, +9:u07:IGSF3, +9:u08:PNRC2, +10:u10:fcgr3a, +9:u11:acvr1, +8:u12:xcl2, +11:u13:ankrd36, +11:u14:cntnap3, +6:u21:XC, +7:u22:XCL, +8:u23:XCL2, +10:u01:FCGR3A, +9:u02:ACVR1, +8:u03:XCL2, +11:u04:ANKRD36, +11:u05:CNTNAP3, +9:u06:IGSF3, +9:u07:PCBP1, +9:u10:acvr1, +8:u11:xcl2, +11:u12:ankrd36, +11:u13:cntnap3, +9:u14:igsf3, +8:u23:ANKR, +10:u00:FCGR3A, +9:u01:ACVR1, +8:u02:XCL2, +11:u03:ANKRD36, +11:u04:CNTNAP3, +9:u05:IGSF3, +9:u06:PCBP1, +9:u07:PNRC2, +8:u10:xcl2, +11:u11:ankrd36, +11:u12:cntnap3, +9:u13:igsf3, +9:u14:pcbp1, +9:u00:ACVR1, +8:u01:XCL2, +11:u02:ANKRD36, +11:u03:CNTNAP3, +9:u04:IGSF3, +9:u05:PCBP1, +9:u06:PNRC2, +11:u10:ankrd36, +11:u11:cntnap3, +9:u12:igsf3, +9:u13:pcbp1, +9:u14:pnrc2, +6:u21:IG, +7:u22:IGS, +8:u23:IGSF, +8:u00:XCL2, +11:u01:ANKRD36, +11:u02:CNTNAP3, +9:u03:IGSF3, +9:u04:PCBP1, +9:u05:PNRC2, +13:u08:PANCANCER, +11:u10:cntnap3, +9:u11:igsf3, +9:u12:pcbp1, +9:u13:pnrc2, +7:u22:PCB, +8:u23:PCBP, +11:u00:ANKRD36, +11:u01:CNTNAP3, +9:u02:IGSF3, +9:u03:PCBP1, +9:u04:PNRC2, +15:u08:(Oncogenic), +9:u10:igsf3, +9:u11:pcbp1, +9:u12:pnrc2, +7:u22:PNR, +8:u23:PNRC, +11:u00:CNTNAP3, +9:u01:IGSF3, +9:u02:PCBP1, +9:u03:PNRC2, +13:u07:PANCANCER, +15:u07:(Oncogenic), +9:u10:pcbp1, +9:u11:pnrc2, +9:u00:IGSF3, +9:u01:PCBP1, +9:u02:PNRC2, +13:u06:PANCANCER, +15:u06:(Oncogenic), +9:u10:pnrc2, +13:u14:pancancer, +9:u00:PCBP1, +9:u01:PNRC2, +13:u05:PANCANCER, +15:u05:(Oncogenic), +13:u13:pancancer, +9:u00:PNRC2, +13:u04:PANCANCER, +10:u08:Clonal, +15:u04:(Oncogenic), +13:u12:pancancer, +7:u22:PAN, +8:u23:PANC, +13:u03:PANCANCER, +15:u03:(Oncogenic), +8:u08:(NA), +13:u11:pancancer, +13:u02:PANCANCER, +10:u07:Clonal, +15:u02:(Oncogenic), +8:u07:(NA), +11:u08:(early), +13:u10:pancancer, +13:u01:PANCANCER, +10:u06:Clonal, +13:u08:Subclonal, +15:u01:(Oncogenic), +8:u06:(NA), +11:u07:(early), +10:u08:(late), +13:u00:PANCANCER, +10:u05:Clonal, +15:u00:(Oncogenic), +8:u05:(NA), +11:u06:(early), +10:u07:(late), +10:u04:Clonal, +13:u07:Subclonal, +8:u04:(NA), +11:u05:(early), +10:u06:(late), +10:u03:Clonal, +13:u06:Subclonal, +8:u03:(NA), +11:u04:(early), +10:u05:(late), +10:u02:Clonal, +13:u05:Subclonal, +8:u02:(NA), +11:u03:(early), +10:u04:(late), +10:u01:Clonal, +13:u04:Subclonal, +8:u01:(NA), +11:u02:(early), +10:u03:(late), +8:u23:Subc, +10:u00:Clonal, +13:u03:Subclonal, +8:u00:(NA), +11:u01:(early), +10:u02:(late), +13:u02:Subclonal, +11:u00:(early), +10:u01:(late), +13:u01:Subclonal, +10:u00:(late), +13:u00:Subclonal, +6:u14:d), +10:u08:LRRC4C, +6:u13:d), +6:u12:d), +6:u22:d), +6:u23:d), +10:u07:LRRC4C, +6:u11:d), +10:u06:LRRC4C, +6:u10:d), +10:u14:lrrc4c, +10:u05:LRRC4C, +9:u08:BCL7A, +10:u13:lrrc4c, +10:u04:LRRC4C, +10:u12:lrrc4c, +10:u03:LRRC4C, +9:u07:BCL7A, +10:u11:lrrc4c, +10:u02:LRRC4C, +9:u06:BCL7A, +9:u08:PREX2, +10:u10:lrrc4c, +9:u14:bcl7a, +10:u01:LRRC4C, +9:u05:BCL7A, +9:u13:bcl7a, +10:u00:LRRC4C, +9:u04:BCL7A, +9:u07:PREX2, +9:u12:bcl7a, +8:u23:BCL7, +9:u03:BCL7A, +9:u06:PREX2, +9:u11:bcl7a, +9:u14:prex2, +9:u02:BCL7A, +9:u05:PREX2, +9:u10:bcl7a, +9:u13:prex2, +9:u01:BCL7A, +9:u04:PREX2, +9:u12:prex2, +8:u23:PREX, +9:u00:BCL7A, +9:u03:PREX2, +9:u11:prex2, +9:u02:PREX2, +9:u10:prex2, +9:u01:PREX2, +9:u00:PREX2, +7:u08:SMO, +7:u07:SMO, +7:u06:SMO, +7:u14:smo, +7:u05:SMO, +7:u13:smo, +7:u04:SMO, +7:u12:smo, +7:u22:SMO, +7:u23:SMO, +7:u03:SMO, +7:u11:smo, +7:u02:SMO, +7:u10:smo, +7:u01:SMO, +7:u00:SMO, +9:u08:NIPBL, +9:u07:NIPBL, +9:u06:NIPBL, +9:u08:TCF12, +9:u14:nipbl, +9:u05:NIPBL, +9:u13:nipbl, +9:u04:NIPBL, +9:u07:TCF12, +9:u12:nipbl, +7:u22:NIP, +8:u23:NIPB, +9:u03:NIPBL, +9:u06:TCF12, +9:u11:nipbl, +9:u14:tcf12, +9:u02:NIPBL, +9:u05:TCF12, +10:u08:ZBTB20, +9:u10:nipbl, +9:u13:tcf12, +9:u01:NIPBL, +9:u04:TCF12, +9:u12:tcf12, +8:u23:TCF1, +9:u00:NIPBL, +9:u03:TCF12, +10:u07:ZBTB20, +9:u11:tcf12, +9:u02:TCF12, +10:u06:ZBTB20, +9:u10:tcf12, +10:u14:zbtb20, +9:u01:TCF12, +10:u05:ZBTB20, +10:u13:zbtb20, +9:u00:TCF12, +10:u04:ZBTB20, +10:u12:zbtb20, +6:u21:ZB, +7:u22:ZBT, +8:u23:ZBTB, +10:u03:ZBTB20, +10:u11:zbtb20, +10:u02:ZBTB20, +10:u10:zbtb20, +10:u01:ZBTB20, +10:u00:ZBTB20, +13:uI2::);););)., +8:u08:IFNG, +13:uI1::);););)., +13:uI0::);););)., +8:u07:IFNG, +8:u06:IFNG, +8:u14:ifng, +8:u05:IFNG, +9:u08:HNF4A, +8:u13:ifng, +8:u04:IFNG, +9:u08:PRKCI, +8:u12:ifng, +7:u22:IFN, +8:u23:IFNG, +8:u03:IFNG, +9:u07:HNF4A, +9:u08:HDAC6, +8:u11:ifng, +8:u02:IFNG, +9:u06:HNF4A, +9:u07:PRKCI, +8:u08:CDK1, +8:u10:ifng, +9:u14:hnf4a, +8:u01:IFNG, +9:u05:HNF4A, +9:u06:PRKCI, +9:u07:HDAC6, +9:u13:hnf4a, +9:u14:prkci, +8:u00:IFNG, +9:u04:HNF4A, +9:u05:PRKCI, +9:u06:HDAC6, +8:u07:CDK1, +7:u08:BTK, +9:u12:hnf4a, +9:u13:prkci, +9:u14:hdac6, +6:u21:HN, +7:u22:HNF, +8:u23:HNF4, +9:u03:HNF4A, +9:u04:PRKCI, +9:u05:HDAC6, +8:u06:CDK1, +8:u08:BCL2, +9:u11:hnf4a, +9:u12:prkci, +9:u13:hdac6, +8:u14:cdk1, +9:u02:HNF4A, +9:u03:PRKCI, +9:u04:HDAC6, +8:u05:CDK1, +7:u07:BTK, +10:u08:MT-ND4, +9:u10:hnf4a, +9:u11:prkci, +9:u12:hdac6, +8:u13:cdk1, +9:u01:HNF4A, +9:u02:PRKCI, +9:u03:HDAC6, +8:u04:CDK1, +7:u06:BTK, +8:u07:BCL2, +9:u08:ERBB4, +9:u10:prkci, +9:u11:hdac6, +8:u12:cdk1, +7:u14:btk, +9:u00:HNF4A, +9:u01:PRKCI, +9:u02:HDAC6, +8:u03:CDK1, +7:u05:BTK, +8:u06:BCL2, +10:u07:MT-ND4, +7:u08:PLG, +9:u10:hdac6, +8:u11:cdk1, +7:u13:btk, +8:u14:bcl2, +9:u00:PRKCI, +9:u01:HDAC6, +8:u02:CDK1, +7:u04:BTK, +8:u05:BCL2, +10:u06:MT-ND4, +9:u07:ERBB4, +7:u08:ALK, +8:u10:cdk1, +7:u12:btk, +8:u13:bcl2, +10:u14:mt-nd4, +7:u22:BTK, +7:u23:BTK, +9:u00:HDAC6, +8:u01:CDK1, +7:u03:BTK, +8:u04:BCL2, +10:u05:MT-ND4, +9:u06:ERBB4, +7:u07:PLG, +8:u08:BCL9, +7:u11:btk, +8:u12:bcl2, +10:u13:mt-nd4, +8:u23:BCL2, +8:u00:CDK1, +7:u02:BTK, +8:u03:BCL2, +10:u04:MT-ND4, +9:u05:ERBB4, +7:u06:PLG, +7:u07:ALK, +9:u08:SPTA1, +7:u10:btk, +8:u11:bcl2, +10:u12:mt-nd4, +7:u14:plg, +7:u22:MT-, +8:u23:MT-N, +7:u01:BTK, +8:u02:BCL2, +10:u03:MT-ND4, +9:u04:ERBB4, +7:u05:PLG, +7:u06:ALK, +8:u07:BCL9, +8:u10:bcl2, +10:u11:mt-nd4, +7:u13:plg, +7:u14:alk, +7:u00:BTK, +8:u01:BCL2, +10:u02:MT-ND4, +9:u03:ERBB4, +7:u04:PLG, +7:u05:ALK, +8:u06:BCL9, +9:u07:SPTA1, +10:u10:mt-nd4, +7:u12:plg, +7:u13:alk, +8:u14:bcl9, +7:u22:PLG, +7:u23:PLG, +8:u00:BCL2, +10:u01:MT-ND4, +9:u02:ERBB4, +7:u03:PLG, +7:u04:ALK, +8:u05:BCL9, +9:u06:SPTA1, +7:u11:plg, +7:u12:alk, +8:u13:bcl9, +9:u14:spta1, +7:u22:ALK, +7:u23:ALK, +10:u00:MT-ND4, +9:u01:ERBB4, +7:u02:PLG, +7:u03:ALK, +8:u04:BCL9, +9:u05:SPTA1, +10:u08:PIK3CB, +7:u10:plg, +7:u11:alk, +8:u12:bcl9, +9:u13:spta1, +9:u00:ERBB4, +7:u01:PLG, +7:u02:ALK, +8:u03:BCL9, +9:u04:SPTA1, +8:u08:MC4R, +7:u10:alk, +8:u11:bcl9, +9:u12:spta1, +7:u22:SPT, +8:u23:SPTA, +7:u00:PLG, +7:u01:ALK, +8:u02:BCL9, +9:u03:SPTA1, +10:u07:PIK3CB, +10:u08:TNRC6B, +8:u10:bcl9, +9:u11:spta1, +7:u00:ALK, +8:u01:BCL9, +9:u02:SPTA1, +10:u06:PIK3CB, +8:u07:MC4R, +8:u08:CDK2, +9:u10:spta1, +10:u14:pik3cb, +8:u00:BCL9, +9:u01:SPTA1, +10:u05:PIK3CB, +8:u06:MC4R, +10:u07:TNRC6B, +10:u13:pik3cb, +8:u14:mc4r, +9:u00:SPTA1, +10:u04:PIK3CB, +8:u05:MC4R, +10:u06:TNRC6B, +8:u07:CDK2, +10:u08:MAPK11, +10:u12:pik3cb, +8:u13:mc4r, +10:u14:tnrc6b, +10:u03:PIK3CB, +8:u04:MC4R, +10:u05:TNRC6B, +8:u06:CDK2, +8:u08:THRB, +10:u11:pik3cb, +8:u12:mc4r, +10:u13:tnrc6b, +8:u14:cdk2, +7:u22:MC4, +8:u23:MC4R, +10:u02:PIK3CB, +8:u03:MC4R, +10:u04:TNRC6B, +8:u05:CDK2, +10:u07:MAPK11, +9:u08:PSMA3, +10:u10:pik3cb, +8:u11:mc4r, +10:u12:tnrc6b, +8:u13:cdk2, +7:u22:TNR, +8:u23:TNRC, +10:u01:PIK3CB, +8:u02:MC4R, +10:u03:TNRC6B, +8:u04:CDK2, +10:u06:MAPK11, +8:u07:THRB, +9:u08:RPS27, +8:u10:mc4r, +10:u11:tnrc6b, +8:u12:cdk2, +10:u14:mapk11, +8:u23:CDK2, +10:u00:PIK3CB, +8:u01:MC4R, +10:u02:TNRC6B, +8:u03:CDK2, +10:u05:MAPK11, +8:u06:THRB, +9:u07:PSMA3, +9:u08:TOP2B, +10:u10:tnrc6b, +8:u11:cdk2, +10:u13:mapk11, +8:u14:thrb, +8:u00:MC4R, +10:u01:TNRC6B, +8:u02:CDK2, +10:u04:MAPK11, +8:u05:THRB, +9:u06:PSMA3, +9:u07:RPS27, +8:u10:cdk2, +10:u12:mapk11, +8:u13:thrb, +9:u14:psma3, +8:u23:MAPK, +10:u00:TNRC6B, +8:u01:CDK2, +10:u03:MAPK11, +8:u04:THRB, +9:u05:PSMA3, +9:u06:RPS27, +9:u07:TOP2B, +10:u11:mapk11, +8:u12:thrb, +9:u13:psma3, +9:u14:rps27, +7:u22:THR, +8:u23:THRB, +8:u00:CDK2, +10:u02:MAPK11, +8:u03:THRB, +9:u04:PSMA3, +9:u05:RPS27, +9:u06:TOP2B, +10:u08:MAPK14, +10:u10:mapk11, +8:u11:thrb, +9:u12:psma3, +9:u13:rps27, +9:u14:top2b, +7:u22:PSM, +8:u23:PSMA, +10:u01:MAPK11, +8:u02:THRB, +9:u03:PSMA3, +9:u04:RPS27, +9:u05:TOP2B, +7:u08:BCR, +8:u10:thrb, +9:u11:psma3, +9:u12:rps27, +9:u13:top2b, +7:u22:RPS, +8:u23:RPS2, +10:u00:MAPK11, +8:u01:THRB, +9:u02:PSMA3, +9:u03:RPS27, +9:u04:TOP2B, +10:u07:MAPK14, +9:u08:RPL13, +9:u10:psma3, +9:u11:rps27, +9:u12:top2b, +7:u22:TOP, +8:u23:TOP2, +8:u00:THRB, +9:u01:PSMA3, +9:u02:RPS27, +9:u03:TOP2B, +10:u06:MAPK14, +7:u07:BCR, +7:u08:FRK, +9:u10:rps27, +9:u11:top2b, +10:u14:mapk14, +9:u00:PSMA3, +9:u01:RPS27, +9:u02:TOP2B, +10:u05:MAPK14, +7:u06:BCR, +9:u07:RPL13, +11:u08:MAP3K21, +9:u10:top2b, +10:u13:mapk14, +7:u14:bcr, +9:u00:RPS27, +9:u01:TOP2B, +10:u04:MAPK14, +7:u05:BCR, +9:u06:RPL13, +7:u07:FRK, +10:u12:mapk14, +7:u13:bcr, +9:u14:rpl13, +9:u00:TOP2B, +10:u03:MAPK14, +7:u04:BCR, +9:u05:RPL13, +7:u06:FRK, +11:u07:MAP3K21, +10:u11:mapk14, +7:u12:bcr, +9:u13:rpl13, +7:u14:frk, +7:u22:BCR, +7:u23:BCR, +10:u02:MAPK14, +7:u03:BCR, +9:u04:RPL13, +7:u05:FRK, +11:u06:MAP3K21, +8:u08:SMG1, +10:u10:mapk14, +7:u11:bcr, +9:u12:rpl13, +7:u13:frk, +11:u14:map3k21, +7:u22:RPL, +8:u23:RPL1, +10:u01:MAPK14, +7:u02:BCR, +9:u03:RPL13, +7:u04:FRK, +11:u05:MAP3K21, +8:u08:TOP1, +7:u10:bcr, +9:u11:rpl13, +7:u12:frk, +11:u13:map3k21, +7:u22:FRK, +7:u23:FRK, +10:u00:MAPK14, +7:u01:BCR, +9:u02:RPL13, +7:u03:FRK, +11:u04:MAP3K21, +8:u07:SMG1, +9:u08:NTRK1, +9:u10:rpl13, +7:u11:frk, +11:u12:map3k21, +7:u00:BCR, +9:u01:RPL13, +7:u02:FRK, +11:u03:MAP3K21, +8:u06:SMG1, +8:u07:TOP1, +9:u08:PTGIR, +7:u10:frk, +11:u11:map3k21, +8:u14:smg1, +9:u00:RPL13, +7:u01:FRK, +11:u02:MAP3K21, +8:u05:SMG1, +8:u06:TOP1, +9:u07:NTRK1, +9:u08:PPARD, +11:u10:map3k21, +8:u13:smg1, +8:u14:top1, +7:u00:FRK, +11:u01:MAP3K21, +8:u04:SMG1, +8:u05:TOP1, +9:u06:NTRK1, +9:u07:PTGIR, +9:u08:CHEK1, +8:u12:smg1, +8:u13:top1, +9:u14:ntrk1, +7:u22:SMG, +8:u23:SMG1, +11:u00:MAP3K21, +8:u03:SMG1, +8:u04:TOP1, +9:u05:NTRK1, +9:u06:PTGIR, +9:u07:PPARD, +8:u11:smg1, +8:u12:top1, +9:u13:ntrk1, +9:u14:ptgir, +8:u23:TOP1, +8:u02:SMG1, +8:u03:TOP1, +9:u04:NTRK1, +9:u05:PTGIR, +9:u06:PPARD, +9:u07:CHEK1, +9:u08:HDAC9, +8:u10:smg1, +8:u11:top1, +9:u12:ntrk1, +9:u13:ptgir, +9:u14:ppard, +7:u22:NTR, +8:u23:NTRK, +8:u01:SMG1, +8:u02:TOP1, +9:u03:NTRK1, +9:u04:PTGIR, +9:u05:PPARD, +9:u06:CHEK1, +9:u08:TOP2A, +8:u10:top1, +9:u11:ntrk1, +9:u12:ptgir, +9:u13:ppard, +9:u14:chek1, +7:u22:PTG, +8:u23:PTGI, +8:u00:SMG1, +8:u01:TOP1, +9:u02:NTRK1, +9:u03:PTGIR, +9:u04:PPARD, +9:u05:CHEK1, +9:u07:HDAC9, +8:u08:INSR, +9:u10:ntrk1, +9:u11:ptgir, +9:u12:ppard, +9:u13:chek1, +7:u22:PPA, +8:u23:PPAR, +8:u00:TOP1, +9:u01:NTRK1, +9:u02:PTGIR, +9:u03:PPARD, +9:u04:CHEK1, +9:u06:HDAC9, +9:u07:TOP2A, +9:u08:GLP1R, +9:u10:ptgir, +9:u11:ppard, +9:u12:chek1, +9:u14:hdac9, +7:u22:CHE, +8:u23:CHEK, +9:u00:NTRK1, +9:u01:PTGIR, +9:u02:PPARD, +9:u03:CHEK1, +9:u05:HDAC9, +9:u06:TOP2A, +8:u07:INSR, +9:u10:ppard, +9:u11:chek1, +9:u13:hdac9, +9:u14:top2a, +9:u00:PTGIR, +9:u01:PPARD, +9:u02:CHEK1, +9:u04:HDAC9, +9:u05:TOP2A, +8:u06:INSR, +9:u07:GLP1R, +9:u10:chek1, +9:u12:hdac9, +9:u13:top2a, +8:u14:insr, +9:u00:PPARD, +9:u01:CHEK1, +9:u03:HDAC9, +9:u04:TOP2A, +8:u05:INSR, +9:u06:GLP1R, +8:u08:MMP1, +9:u11:hdac9, +9:u12:top2a, +8:u13:insr, +9:u14:glp1r, +9:u00:CHEK1, +9:u02:HDAC9, +9:u03:TOP2A, +8:u04:INSR, +9:u05:GLP1R, +11:u08:CYP17A1, +9:u10:hdac9, +9:u11:top2a, +8:u12:insr, +9:u13:glp1r, +7:u22:INS, +8:u23:INSR, +9:u01:HDAC9, +9:u02:TOP2A, +8:u03:INSR, +9:u04:GLP1R, +8:u07:MMP1, +7:u08:VDR, +9:u10:top2a, +8:u11:insr, +9:u12:glp1r, +7:u22:GLP, +8:u23:GLP1, +9:u00:HDAC9, +9:u01:TOP2A, +8:u02:INSR, +9:u03:GLP1R, +8:u06:MMP1, +11:u07:CYP17A1, +7:u08:RET, +8:u10:insr, +9:u11:glp1r, +8:u14:mmp1, +9:u00:TOP2A, +8:u01:INSR, +9:u02:GLP1R, +8:u05:MMP1, +11:u06:CYP17A1, +7:u07:VDR, +7:u08:SYK, +9:u10:glp1r, +8:u13:mmp1, +11:u14:cyp17a1, +8:u00:INSR, +9:u01:GLP1R, +8:u04:MMP1, +11:u05:CYP17A1, +7:u06:VDR, +7:u07:RET, +9:u08:PPARA, +8:u12:mmp1, +11:u13:cyp17a1, +7:u14:vdr, +7:u22:MMP, +8:u23:MMP1, +9:u00:GLP1R, +8:u03:MMP1, +11:u04:CYP17A1, +7:u05:VDR, +7:u06:RET, +7:u07:SYK, +7:u08:SRC, +8:u11:mmp1, +11:u12:cyp17a1, +7:u13:vdr, +7:u14:ret, +8:u02:MMP1, +11:u03:CYP17A1, +7:u04:VDR, +7:u05:RET, +7:u06:SYK, +9:u07:PPARA, +8:u10:mmp1, +11:u11:cyp17a1, +7:u12:vdr, +7:u13:ret, +7:u14:syk, +6:u21:VD, +7:u22:VDR, +7:u23:VDR, +8:u01:MMP1, +11:u02:CYP17A1, +7:u03:VDR, +7:u04:RET, +7:u05:SYK, +9:u06:PPARA, +7:u07:SRC, +11:u08:CYP11A1, +11:u10:cyp17a1, +7:u11:vdr, +7:u12:ret, +7:u13:syk, +9:u14:ppara, +7:u22:RET, +7:u23:RET, +8:u00:MMP1, +11:u01:CYP17A1, +7:u02:VDR, +7:u03:RET, +7:u04:SYK, +9:u05:PPARA, +7:u06:SRC, +8:u08:CDK4, +7:u10:vdr, +7:u11:ret, +7:u12:syk, +9:u13:ppara, +7:u14:src, +7:u22:SYK, +7:u23:SYK, +11:u00:CYP17A1, +7:u01:VDR, +7:u02:RET, +7:u03:SYK, +9:u04:PPARA, +7:u05:SRC, +11:u07:CYP11A1, +7:u10:ret, +7:u11:syk, +9:u12:ppara, +7:u13:src, +7:u00:VDR, +7:u01:RET, +7:u02:SYK, +9:u03:PPARA, +7:u04:SRC, +11:u06:CYP11A1, +8:u07:CDK4, +11:u08:MAP3K11, +7:u10:syk, +9:u11:ppara, +7:u12:src, +11:u14:cyp11a1, +7:u22:SRC, +7:u23:SRC, +7:u00:RET, +7:u01:SYK, +9:u02:PPARA, +7:u03:SRC, +11:u05:CYP11A1, +8:u06:CDK4, +7:u08:ITK, +9:u10:ppara, +7:u11:src, +11:u13:cyp11a1, +8:u14:cdk4, +7:u00:SYK, +9:u01:PPARA, +7:u02:SRC, +11:u04:CYP11A1, +8:u05:CDK4, +11:u07:MAP3K11, +10:u08:CTNND1, +7:u10:src, +11:u12:cyp11a1, +8:u13:cdk4, +9:u00:PPARA, +7:u01:SRC, +11:u03:CYP11A1, +8:u04:CDK4, +11:u06:MAP3K11, +7:u07:ITK, +11:u11:cyp11a1, +8:u12:cdk4, +11:u14:map3k11, +8:u23:CDK4, +7:u00:SRC, +11:u02:CYP11A1, +8:u03:CDK4, +11:u05:MAP3K11, +7:u06:ITK, +10:u07:CTNND1, +7:u08:IL6, +11:u10:cyp11a1, +8:u11:cdk4, +11:u13:map3k11, +7:u14:itk, +11:u01:CYP11A1, +8:u02:CDK4, +11:u04:MAP3K11, +7:u05:ITK, +10:u06:CTNND1, +8:u08:RARG, +8:u10:cdk4, +11:u12:map3k11, +7:u13:itk, +10:u14:ctnnd1, +11:u00:CYP11A1, +8:u01:CDK4, +11:u03:MAP3K11, +7:u04:ITK, +10:u05:CTNND1, +7:u07:IL6, +7:u08:KDR, +11:u11:map3k11, +7:u12:itk, +10:u13:ctnnd1, +7:u22:ITK, +7:u23:ITK, +8:u00:CDK4, +11:u02:MAP3K11, +7:u03:ITK, +10:u04:CTNND1, +7:u06:IL6, +8:u07:RARG, +8:u08:GCGR, +11:u10:map3k11, +7:u11:itk, +10:u12:ctnnd1, +7:u14:il6, +11:u01:MAP3K11, +7:u02:ITK, +10:u03:CTNND1, +7:u05:IL6, +8:u06:RARG, +7:u07:KDR, +9:u08:SMAD1, +7:u10:itk, +10:u11:ctnnd1, +7:u13:il6, +8:u14:rarg, +11:u00:MAP3K11, +7:u01:ITK, +10:u02:CTNND1, +7:u04:IL6, +8:u05:RARG, +7:u06:KDR, +8:u07:GCGR, +9:u08:PRKCA, +10:u10:ctnnd1, +7:u12:il6, +8:u13:rarg, +7:u14:kdr, +7:u22:IL6, +7:u23:IL6, +7:u00:ITK, +10:u01:CTNND1, +7:u03:IL6, +8:u04:RARG, +7:u05:KDR, +8:u06:GCGR, +9:u07:SMAD1, +8:u08:RAF1, +7:u11:il6, +8:u12:rarg, +7:u13:kdr, +8:u14:gcgr, +7:u22:RAR, +8:u23:RARG, +10:u00:CTNND1, +7:u02:IL6, +8:u03:RARG, +7:u04:KDR, +8:u05:GCGR, +9:u06:SMAD1, +9:u07:PRKCA, +9:u08:RPLP0, +7:u10:il6, +8:u11:rarg, +7:u12:kdr, +8:u13:gcgr, +9:u14:smad1, +7:u22:KDR, +7:u23:KDR, +7:u01:IL6, +8:u02:RARG, +7:u03:KDR, +8:u04:GCGR, +9:u05:SMAD1, +9:u06:PRKCA, +8:u07:RAF1, +8:u08:EEF2, +8:u10:rarg, +7:u11:kdr, +8:u12:gcgr, +9:u13:smad1, +9:u14:prkca, +7:u22:GCG, +8:u23:GCGR, +7:u00:IL6, +8:u01:RARG, +7:u02:KDR, +8:u03:GCGR, +9:u04:SMAD1, +9:u05:PRKCA, +8:u06:RAF1, +9:u07:RPLP0, +8:u08:FLT3, +7:u10:kdr, +8:u11:gcgr, +9:u12:smad1, +9:u13:prkca, +8:u14:raf1, +8:u00:RARG, +7:u01:KDR, +8:u02:GCGR, +9:u03:SMAD1, +9:u04:PRKCA, +8:u05:RAF1, +9:u06:RPLP0, +8:u07:EEF2, +8:u10:gcgr, +9:u11:smad1, +9:u12:prkca, +8:u13:raf1, +9:u14:rplp0, +7:u00:KDR, +8:u01:GCGR, +9:u02:SMAD1, +9:u03:PRKCA, +8:u04:RAF1, +9:u05:RPLP0, +8:u06:EEF2, +8:u07:FLT3, +9:u08:OLIG2, +9:u10:smad1, +9:u11:prkca, +8:u12:raf1, +9:u13:rplp0, +8:u14:eef2, +7:u22:RAF, +8:u23:RAF1, +8:u00:GCGR, +9:u01:SMAD1, +9:u02:PRKCA, +8:u03:RAF1, +9:u04:RPLP0, +8:u05:EEF2, +8:u06:FLT3, +11:u08:CSNK1A1, +9:u10:prkca, +8:u11:raf1, +9:u12:rplp0, +8:u13:eef2, +8:u14:flt3, +8:u23:RPLP, +9:u00:SMAD1, +9:u01:PRKCA, +8:u02:RAF1, +9:u03:RPLP0, +8:u04:EEF2, +8:u05:FLT3, +9:u07:OLIG2, +9:u08:NR3C1, +8:u10:raf1, +9:u11:rplp0, +8:u12:eef2, +8:u13:flt3, +6:u21:EE, +7:u22:EEF, +8:u23:EEF2, +9:u00:PRKCA, +8:u01:RAF1, +9:u02:RPLP0, +8:u03:EEF2, +8:u04:FLT3, +9:u06:OLIG2, +11:u07:CSNK1A1, +8:u08:RARB, +9:u10:rplp0, +8:u11:eef2, +8:u12:flt3, +9:u14:olig2, +7:u22:FLT, +8:u23:FLT3, +8:u00:RAF1, +9:u01:RPLP0, +8:u02:EEF2, +8:u03:FLT3, +9:u05:OLIG2, +11:u06:CSNK1A1, +9:u07:NR3C1, +9:u08:ADRB3, +8:u10:eef2, +8:u11:flt3, +9:u13:olig2, +11:u14:csnk1a1, +9:u00:RPLP0, +8:u01:EEF2, +8:u02:FLT3, +9:u04:OLIG2, +11:u05:CSNK1A1, +9:u06:NR3C1, +8:u07:RARB, +10:u08:TGFBR1, +8:u10:flt3, +9:u12:olig2, +11:u13:csnk1a1, +9:u14:nr3c1, +7:u22:OLI, +8:u23:OLIG, +8:u00:EEF2, +8:u01:FLT3, +9:u03:OLIG2, +11:u04:CSNK1A1, +9:u05:NR3C1, +8:u06:RARB, +9:u07:ADRB3, +9:u11:olig2, +11:u12:csnk1a1, +9:u13:nr3c1, +8:u14:rarb, +7:u22:CSN, +8:u23:CSNK, +8:u00:FLT3, +9:u02:OLIG2, +11:u03:CSNK1A1, +9:u04:NR3C1, +8:u05:RARB, +9:u06:ADRB3, +10:u07:TGFBR1, +9:u10:olig2, +11:u11:csnk1a1, +9:u12:nr3c1, +8:u13:rarb, +9:u14:adrb3, +7:u22:NR3, +8:u23:NR3C, +9:u01:OLIG2, +11:u02:CSNK1A1, +9:u03:NR3C1, +8:u04:RARB, +9:u05:ADRB3, +10:u06:TGFBR1, +10:u08:CSNK1E, +11:u10:csnk1a1, +9:u11:nr3c1, +8:u12:rarb, +9:u13:adrb3, +10:u14:tgfbr1, +8:u23:RARB, +9:u00:OLIG2, +11:u01:CSNK1A1, +9:u02:NR3C1, +8:u03:RARB, +9:u04:ADRB3, +10:u05:TGFBR1, +9:u10:nr3c1, +8:u11:rarb, +9:u12:adrb3, +10:u13:tgfbr1, +7:u22:ADR, +8:u23:ADRB, +11:u00:CSNK1A1, +9:u01:NR3C1, +8:u02:RARB, +9:u03:ADRB3, +10:u04:TGFBR1, +10:u07:CSNK1E, +9:u08:HDAC4, +8:u10:rarb, +9:u11:adrb3, +10:u12:tgfbr1, +9:u00:NR3C1, +8:u01:RARB, +9:u02:ADRB3, +10:u03:TGFBR1, +10:u06:CSNK1E, +9:u10:adrb3, +10:u11:tgfbr1, +10:u14:csnk1e, +8:u00:RARB, +9:u01:ADRB3, +10:u02:TGFBR1, +10:u05:CSNK1E, +9:u07:HDAC4, +10:u10:tgfbr1, +10:u13:csnk1e, +9:u00:ADRB3, +10:u01:TGFBR1, +10:u04:CSNK1E, +9:u06:HDAC4, +10:u08:MTNR1B, +10:u12:csnk1e, +9:u14:hdac4, +10:u00:TGFBR1, +10:u03:CSNK1E, +9:u05:HDAC4, +10:u11:csnk1e, +9:u13:hdac4, +10:u02:CSNK1E, +9:u04:HDAC4, +10:u07:MTNR1B, +9:u08:PRKCE, +10:u10:csnk1e, +9:u12:hdac4, +10:u01:CSNK1E, +9:u03:HDAC4, +10:u06:MTNR1B, +8:u08:JAK2, +9:u11:hdac4, +10:u14:mtnr1b, +10:u00:CSNK1E, +9:u02:HDAC4, +10:u05:MTNR1B, +9:u07:PRKCE, +9:u08:PRKD1, +9:u10:hdac4, +10:u13:mtnr1b, +9:u01:HDAC4, +10:u04:MTNR1B, +9:u06:PRKCE, +8:u07:JAK2, +8:u08:NCF1, +10:u12:mtnr1b, +9:u14:prkce, +7:u22:MTN, +8:u23:MTNR, +9:u00:HDAC4, +10:u03:MTNR1B, +9:u05:PRKCE, +8:u06:JAK2, +9:u07:PRKD1, +8:u08:WEE1, +10:u11:mtnr1b, +9:u13:prkce, +8:u14:jak2, +10:u02:MTNR1B, +9:u04:PRKCE, +8:u05:JAK2, +9:u06:PRKD1, +8:u07:NCF1, +8:u08:HTR6, +10:u10:mtnr1b, +9:u12:prkce, +8:u13:jak2, +9:u14:prkd1, +10:u01:MTNR1B, +9:u03:PRKCE, +8:u04:JAK2, +9:u05:PRKD1, +8:u06:NCF1, +8:u07:WEE1, +10:u08:PABPC1, +9:u11:prkce, +8:u12:jak2, +9:u13:prkd1, +8:u14:ncf1, +7:u22:JAK, +8:u23:JAK2, +10:u00:MTNR1B, +9:u02:PRKCE, +8:u03:JAK2, +9:u04:PRKD1, +8:u05:NCF1, +8:u06:WEE1, +8:u07:HTR6, +8:u08:ABL1, +9:u10:prkce, +8:u11:jak2, +9:u12:prkd1, +8:u13:ncf1, +8:u14:wee1, +8:u23:PRKD, +9:u01:PRKCE, +8:u02:JAK2, +9:u03:PRKD1, +8:u04:NCF1, +8:u05:WEE1, +8:u06:HTR6, +10:u07:PABPC1, +8:u08:TYMS, +8:u10:jak2, +9:u11:prkd1, +8:u12:ncf1, +8:u13:wee1, +8:u14:htr6, +8:u23:NCF1, +9:u00:PRKCE, +8:u01:JAK2, +9:u02:PRKD1, +8:u03:NCF1, +8:u04:WEE1, +8:u05:HTR6, +10:u06:PABPC1, +8:u07:ABL1, +8:u08:ESR2, +9:u10:prkd1, +8:u11:ncf1, +8:u12:wee1, +8:u13:htr6, +10:u14:pabpc1, +7:u22:WEE, +8:u23:WEE1, +8:u00:JAK2, +9:u01:PRKD1, +8:u02:NCF1, +8:u03:WEE1, +8:u04:HTR6, +10:u05:PABPC1, +8:u06:ABL1, +8:u07:TYMS, +9:u08:IL1R1, +8:u10:ncf1, +8:u11:wee1, +8:u12:htr6, +10:u13:pabpc1, +8:u14:abl1, +7:u22:HTR, +8:u23:HTR6, +9:u00:PRKD1, +8:u01:NCF1, +8:u02:WEE1, +8:u03:HTR6, +10:u04:PABPC1, +8:u05:ABL1, +8:u06:TYMS, +8:u07:ESR2, +9:u08:AVPR2, +8:u10:wee1, +8:u11:htr6, +10:u12:pabpc1, +8:u13:abl1, +8:u14:tyms, +7:u22:PAB, +8:u23:PABP, +8:u00:NCF1, +8:u01:WEE1, +8:u02:HTR6, +10:u03:PABPC1, +8:u04:ABL1, +8:u05:TYMS, +8:u06:ESR2, +9:u07:IL1R1, +8:u10:htr6, +10:u11:pabpc1, +8:u12:abl1, +8:u13:tyms, +8:u14:esr2, +7:u22:ABL, +8:u23:ABL1, +8:u00:WEE1, +8:u01:HTR6, +10:u02:PABPC1, +8:u03:ABL1, +8:u04:TYMS, +8:u05:ESR2, +9:u06:IL1R1, +9:u07:AVPR2, +10:u10:pabpc1, +8:u11:abl1, +8:u12:tyms, +8:u13:esr2, +9:u14:il1r1, +7:u22:TYM, +8:u23:TYMS, +8:u00:HTR6, +10:u01:PABPC1, +8:u02:ABL1, +8:u03:TYMS, +8:u04:ESR2, +9:u05:IL1R1, +9:u06:AVPR2, +8:u10:abl1, +8:u11:tyms, +8:u12:esr2, +9:u13:il1r1, +9:u14:avpr2, +8:u23:ESR2, +10:u00:PABPC1, +8:u01:ABL1, +8:u02:TYMS, +8:u03:ESR2, +9:u04:IL1R1, +9:u05:AVPR2, +7:u08:FYN, +8:u10:tyms, +8:u11:esr2, +9:u12:il1r1, +9:u13:avpr2, +7:u22:IL1, +8:u23:IL1R, +8:u00:ABL1, +8:u01:TYMS, +8:u02:ESR2, +9:u03:IL1R1, +9:u04:AVPR2, +7:u08:LCK, +8:u10:esr2, +9:u11:il1r1, +9:u12:avpr2, +8:u23:AVPR, +8:u00:TYMS, +8:u01:ESR2, +9:u02:IL1R1, +9:u03:AVPR2, +7:u07:FYN, +8:u08:PAK1, +9:u10:il1r1, +9:u11:avpr2, +8:u00:ESR2, +9:u01:IL1R1, +9:u02:AVPR2, +7:u06:FYN, +7:u07:LCK, +7:u08:AXL, +9:u10:avpr2, +7:u14:fyn, +9:u00:IL1R1, +9:u01:AVPR2, +7:u05:FYN, +7:u06:LCK, +8:u07:PAK1, +8:u08:PEX5, +7:u13:fyn, +9:u00:AVPR2, +7:u04:FYN, +7:u05:LCK, +8:u06:PAK1, +7:u07:AXL, +8:u08:EZH2, +7:u12:fyn, +8:u14:pak1, +6:u21:FY, +7:u22:FYN, +7:u23:FYN, +7:u03:FYN, +7:u04:LCK, +8:u05:PAK1, +7:u06:AXL, +8:u07:PEX5, +7:u11:fyn, +8:u13:pak1, +7:u14:axl, +7:u22:LCK, +7:u23:LCK, +7:u02:FYN, +7:u03:LCK, +8:u04:PAK1, +7:u05:AXL, +8:u06:PEX5, +8:u07:EZH2, +8:u08:YES1, +7:u10:fyn, +8:u12:pak1, +7:u13:axl, +8:u14:pex5, +7:u22:PAK, +8:u23:PAK1, +7:u01:FYN, +7:u02:LCK, +8:u03:PAK1, +7:u04:AXL, +8:u05:PEX5, +8:u06:EZH2, +7:u08:PGR, +8:u11:pak1, +7:u12:axl, +8:u13:pex5, +8:u14:ezh2, +6:u21:AX, +7:u22:AXL, +7:u23:AXL, +7:u00:FYN, +7:u01:LCK, +8:u02:PAK1, +7:u03:AXL, +8:u04:PEX5, +8:u05:EZH2, +8:u07:YES1, +9:u08:VEGFA, +8:u10:pak1, +7:u11:axl, +8:u12:pex5, +8:u13:ezh2, +7:u22:PEX, +8:u23:PEX5, +7:u00:LCK, +8:u01:PAK1, +7:u02:AXL, +8:u03:PEX5, +8:u04:EZH2, +8:u06:YES1, +7:u07:PGR, +10:u08:ADORA1, +7:u10:axl, +8:u11:pex5, +8:u12:ezh2, +8:u14:yes1, +6:u21:EZ, +7:u22:EZH, +8:u23:EZH2, +8:u00:PAK1, +7:u01:AXL, +8:u02:PEX5, +8:u03:EZH2, +8:u05:YES1, +7:u06:PGR, +9:u07:VEGFA, +7:u08:BLK, +8:u10:pex5, +8:u11:ezh2, +8:u13:yes1, +7:u14:pgr, +7:u00:AXL, +8:u01:PEX5, +8:u02:EZH2, +8:u04:YES1, +7:u05:PGR, +9:u06:VEGFA, +10:u07:ADORA1, +8:u08:DDB1, +8:u10:ezh2, +8:u12:yes1, +7:u13:pgr, +9:u14:vegfa, +8:u23:YES1, +8:u00:PEX5, +8:u01:EZH2, +8:u03:YES1, +7:u04:PGR, +9:u05:VEGFA, +10:u06:ADORA1, +7:u07:BLK, +7:u08:JUN, +8:u11:yes1, +7:u12:pgr, +9:u13:vegfa, +10:u14:adora1, +6:u21:PG, +7:u22:PGR, +7:u23:PGR, +8:u00:EZH2, +8:u02:YES1, +7:u03:PGR, +9:u04:VEGFA, +10:u05:ADORA1, +7:u06:BLK, +8:u07:DDB1, +11:u08:CYP19A1, +8:u10:yes1, +7:u11:pgr, +9:u12:vegfa, +10:u13:adora1, +7:u14:blk, +7:u22:VEG, +8:u23:VEGF, +8:u01:YES1, +7:u02:PGR, +9:u03:VEGFA, +10:u04:ADORA1, +7:u05:BLK, +8:u06:DDB1, +7:u07:JUN, +9:u08:CSF1R, +7:u10:pgr, +9:u11:vegfa, +10:u12:adora1, +7:u13:blk, +8:u14:ddb1, +8:u23:ADOR, +8:u00:YES1, +7:u01:PGR, +9:u02:VEGFA, +10:u03:ADORA1, +7:u04:BLK, +8:u05:DDB1, +7:u06:JUN, +11:u07:CYP19A1, +9:u08:EPCAM, +9:u10:vegfa, +10:u11:adora1, +7:u12:blk, +8:u13:ddb1, +7:u14:jun, +7:u22:BLK, +7:u23:BLK, +7:u00:PGR, +9:u01:VEGFA, +10:u02:ADORA1, +7:u03:BLK, +8:u04:DDB1, +7:u05:JUN, +11:u06:CYP19A1, +9:u07:CSF1R, +8:u08:OXTR, +10:u10:adora1, +7:u11:blk, +8:u12:ddb1, +7:u13:jun, +11:u14:cyp19a1, +7:u22:DDB, +8:u23:DDB1, +9:u00:VEGFA, +10:u01:ADORA1, +7:u02:BLK, +8:u03:DDB1, +7:u04:JUN, +11:u05:CYP19A1, +9:u06:CSF1R, +9:u07:EPCAM, +7:u10:blk, +8:u11:ddb1, +7:u12:jun, +11:u13:cyp19a1, +9:u14:csf1r, +7:u22:JUN, +7:u23:JUN, +10:u00:ADORA1, +7:u01:BLK, +8:u02:DDB1, +7:u03:JUN, +11:u04:CYP19A1, +9:u05:CSF1R, +9:u06:EPCAM, +8:u07:OXTR, +8:u10:ddb1, +7:u11:jun, +11:u12:cyp19a1, +9:u13:csf1r, +9:u14:epcam, +7:u00:BLK, +8:u01:DDB1, +7:u02:JUN, +11:u03:CYP19A1, +9:u04:CSF1R, +9:u05:EPCAM, +8:u06:OXTR, +7:u10:jun, +11:u11:cyp19a1, +9:u12:csf1r, +9:u13:epcam, +8:u14:oxtr, +7:u22:CSF, +8:u23:CSF1, +8:u00:DDB1, +7:u01:JUN, +11:u02:CYP19A1, +9:u03:CSF1R, +9:u04:EPCAM, +8:u05:OXTR, +9:u08:IKBKB, +11:u10:cyp19a1, +9:u11:csf1r, +9:u12:epcam, +8:u13:oxtr, +7:u22:EPC, +8:u23:EPCA, +7:u00:JUN, +11:u01:CYP19A1, +9:u02:CSF1R, +9:u03:EPCAM, +8:u04:OXTR, +9:u10:csf1r, +9:u11:epcam, +8:u12:oxtr, +6:u21:OX, +7:u22:OXT, +8:u23:OXTR, +11:u00:CYP19A1, +9:u01:CSF1R, +9:u02:EPCAM, +8:u03:OXTR, +9:u07:IKBKB, +8:u08:TSHR, +9:u10:epcam, +8:u11:oxtr, +9:u00:CSF1R, +9:u01:EPCAM, +8:u02:OXTR, +9:u06:IKBKB, +9:u08:SSTR2, +8:u10:oxtr, +9:u14:ikbkb, +9:u00:EPCAM, +8:u01:OXTR, +9:u05:IKBKB, +8:u07:TSHR, +8:u08:TUBB, +9:u13:ikbkb, +8:u00:OXTR, +9:u04:IKBKB, +8:u06:TSHR, +9:u07:SSTR2, +8:u08:SMN1, +9:u12:ikbkb, +8:u14:tshr, +6:u21:IK, +7:u22:IKB, +8:u23:IKBK, +9:u03:IKBKB, +8:u05:TSHR, +9:u06:SSTR2, +8:u07:TUBB, +9:u11:ikbkb, +8:u13:tshr, +9:u14:sstr2, +9:u02:IKBKB, +8:u04:TSHR, +9:u05:SSTR2, +8:u06:TUBB, +8:u07:SMN1, +9:u10:ikbkb, +8:u12:tshr, +9:u13:sstr2, +8:u14:tubb, +7:u22:TSH, +8:u23:TSHR, +9:u01:IKBKB, +8:u03:TSHR, +9:u04:SSTR2, +8:u05:TUBB, +8:u06:SMN1, +9:u08:ADRB2, +8:u11:tshr, +9:u12:sstr2, +8:u13:tubb, +8:u14:smn1, +8:u23:SSTR, +9:u00:IKBKB, +8:u02:TSHR, +9:u03:SSTR2, +8:u04:TUBB, +8:u05:SMN1, +8:u08:FLT1, +8:u10:tshr, +9:u11:sstr2, +8:u12:tubb, +8:u13:smn1, +7:u22:TUB, +8:u23:TUBB, +8:u01:TSHR, +9:u02:SSTR2, +8:u03:TUBB, +8:u04:SMN1, +9:u07:ADRB2, +9:u08:GNRHR, +9:u10:sstr2, +8:u11:tubb, +8:u12:smn1, +7:u22:SMN, +8:u23:SMN1, +8:u00:TSHR, +9:u01:SSTR2, +8:u02:TUBB, +8:u03:SMN1, +9:u06:ADRB2, +8:u07:FLT1, +7:u08:LYN, +8:u10:tubb, +8:u11:smn1, +9:u14:adrb2, +9:u00:SSTR2, +8:u01:TUBB, +8:u02:SMN1, +9:u05:ADRB2, +8:u06:FLT1, +9:u07:GNRHR, +8:u08:SMN2, +8:u10:smn1, +9:u13:adrb2, +8:u14:flt1, +8:u00:TUBB, +8:u01:SMN1, +9:u04:ADRB2, +8:u05:FLT1, +9:u06:GNRHR, +7:u07:LYN, +9:u12:adrb2, +8:u13:flt1, +9:u14:gnrhr, +8:u00:SMN1, +9:u03:ADRB2, +8:u04:FLT1, +9:u05:GNRHR, +7:u06:LYN, +8:u07:SMN2, +9:u08:HDAC3, +9:u11:adrb2, +8:u12:flt1, +9:u13:gnrhr, +7:u14:lyn, +8:u23:FLT1, +9:u02:ADRB2, +8:u03:FLT1, +9:u04:GNRHR, +7:u05:LYN, +8:u06:SMN2, +12:u08:HSP90AA1, +9:u10:adrb2, +8:u11:flt1, +9:u12:gnrhr, +7:u13:lyn, +8:u14:smn2, +7:u22:GNR, +8:u23:GNRH, +9:u01:ADRB2, +8:u02:FLT1, +9:u03:GNRHR, +7:u04:LYN, +8:u05:SMN2, +9:u07:HDAC3, +10:u08:ALOX12, +8:u10:flt1, +9:u11:gnrhr, +7:u12:lyn, +8:u13:smn2, +7:u22:LYN, +7:u23:LYN, +9:u00:ADRB2, +8:u01:FLT1, +9:u02:GNRHR, +7:u03:LYN, +8:u04:SMN2, +9:u06:HDAC3, +12:u07:HSP90AA1, +9:u08:PDPK1, +9:u10:gnrhr, +7:u11:lyn, +8:u12:smn2, +9:u14:hdac3, +8:u23:SMN2, +8:u00:FLT1, +9:u01:GNRHR, +7:u02:LYN, +8:u03:SMN2, +9:u05:HDAC3, +12:u06:HSP90AA1, +10:u07:ALOX12, +9:u08:RPL14, +7:u10:lyn, +8:u11:smn2, +9:u13:hdac3, +12:u14:hsp90aa1, +9:u00:GNRHR, +7:u01:LYN, +8:u02:SMN2, +9:u04:HDAC3, +12:u05:HSP90AA1, +10:u06:ALOX12, +9:u07:PDPK1, +10:u08:FAM83B, +8:u10:smn2, +9:u12:hdac3, +12:u13:hsp90aa1, +10:u14:alox12, +7:u00:LYN, +8:u01:SMN2, +9:u03:HDAC3, +12:u04:HSP90AA1, +10:u05:ALOX12, +9:u06:PDPK1, +9:u07:RPL14, +9:u11:hdac3, +12:u12:hsp90aa1, +10:u13:alox12, +9:u14:pdpk1, +6:u21:HS, +7:u22:HSP, +8:u23:HSP9, +8:u00:SMN2, +9:u02:HDAC3, +12:u03:HSP90AA1, +10:u04:ALOX12, +9:u05:PDPK1, +9:u06:RPL14, +10:u07:FAM83B, +10:u08:ZBTB7A, +9:u10:hdac3, +12:u11:hsp90aa1, +10:u12:alox12, +9:u13:pdpk1, +9:u14:rpl14, +7:u22:ALO, +8:u23:ALOX, +9:u01:HDAC3, +12:u02:HSP90AA1, +10:u03:ALOX12, +9:u04:PDPK1, +9:u05:RPL14, +10:u06:FAM83B, +9:u08:IGF1R, +12:u10:hsp90aa1, +10:u11:alox12, +9:u12:pdpk1, +9:u13:rpl14, +10:u14:fam83b, +7:u22:PDP, +8:u23:PDPK, +9:u00:HDAC3, +12:u01:HSP90AA1, +10:u02:ALOX12, +9:u03:PDPK1, +9:u04:RPL14, +10:u05:FAM83B, +10:u07:ZBTB7A, +10:u10:alox12, +9:u11:pdpk1, +9:u12:rpl14, +10:u13:fam83b, +12:u00:HSP90AA1, +10:u01:ALOX12, +9:u02:PDPK1, +9:u03:RPL14, +10:u04:FAM83B, +10:u06:ZBTB7A, +9:u07:IGF1R, +10:u08:PIK3CG, +9:u10:pdpk1, +9:u11:rpl14, +10:u12:fam83b, +10:u14:zbtb7a, +8:u23:FAM8, +10:u00:ALOX12, +9:u01:PDPK1, +9:u02:RPL14, +10:u03:FAM83B, +10:u05:ZBTB7A, +9:u06:IGF1R, +7:u08:IL2, +9:u10:rpl14, +10:u11:fam83b, +10:u13:zbtb7a, +9:u14:igf1r, +9:u00:PDPK1, +9:u01:RPL14, +10:u02:FAM83B, +10:u04:ZBTB7A, +9:u05:IGF1R, +10:u07:PIK3CG, +10:u10:fam83b, +10:u12:zbtb7a, +9:u13:igf1r, +9:u00:RPL14, +10:u01:FAM83B, +10:u03:ZBTB7A, +9:u04:IGF1R, +10:u06:PIK3CG, +7:u07:IL2, +10:u11:zbtb7a, +9:u12:igf1r, +10:u14:pik3cg, +7:u22:IGF, +8:u23:IGF1, +10:u00:FAM83B, +10:u02:ZBTB7A, +9:u03:IGF1R, +10:u05:PIK3CG, +7:u06:IL2, +8:u08:PAK4, +10:u10:zbtb7a, +9:u11:igf1r, +10:u13:pik3cg, +7:u14:il2, +10:u01:ZBTB7A, +9:u02:IGF1R, +10:u04:PIK3CG, +7:u05:IL2, +9:u08:ABCB1, +9:u10:igf1r, +10:u12:pik3cg, +7:u13:il2, +10:u00:ZBTB7A, +9:u01:IGF1R, +10:u03:PIK3CG, +7:u04:IL2, +8:u07:PAK4, +8:u08:RXRA, +10:u11:pik3cg, +7:u12:il2, +7:u22:IL2, +7:u23:IL2, +9:u00:IGF1R, +10:u02:PIK3CG, +7:u03:IL2, +8:u06:PAK4, +9:u07:ABCB1, +10:u10:pik3cg, +7:u11:il2, +8:u14:pak4, +10:u01:PIK3CG, +7:u02:IL2, +8:u05:PAK4, +9:u06:ABCB1, +8:u07:RXRA, +9:u08:RPS20, +7:u10:il2, +8:u13:pak4, +9:u14:abcb1, +10:u00:PIK3CG, +7:u01:IL2, +8:u04:PAK4, +9:u05:ABCB1, +8:u06:RXRA, +9:u08:RRM2B, +8:u12:pak4, +9:u13:abcb1, +8:u14:rxra, +8:u23:PAK4, +7:u00:IL2, +8:u03:PAK4, +9:u04:ABCB1, +8:u05:RXRA, +9:u07:RPS20, +8:u08:FNTA, +8:u11:pak4, +9:u12:abcb1, +8:u13:rxra, +8:u23:ABCB, +8:u02:PAK4, +9:u03:ABCB1, +8:u04:RXRA, +9:u06:RPS20, +9:u07:RRM2B, +9:u08:PARP1, +8:u10:pak4, +9:u11:abcb1, +8:u12:rxra, +9:u14:rps20, +6:u21:RX, +7:u22:RXR, +8:u23:RXRA, +8:u01:PAK4, +9:u02:ABCB1, +8:u03:RXRA, +9:u05:RPS20, +9:u06:RRM2B, +8:u07:FNTA, +7:u08:MME, +9:u10:abcb1, +8:u11:rxra, +9:u13:rps20, +9:u14:rrm2b, +8:u00:PAK4, +9:u01:ABCB1, +8:u02:RXRA, +9:u04:RPS20, +9:u05:RRM2B, +8:u06:FNTA, +9:u07:PARP1, +9:u08:TGIF1, +8:u10:rxra, +9:u12:rps20, +9:u13:rrm2b, +8:u14:fnta, +9:u00:ABCB1, +8:u01:RXRA, +9:u03:RPS20, +9:u04:RRM2B, +8:u05:FNTA, +9:u06:PARP1, +7:u07:MME, +8:u08:PTK6, +9:u11:rps20, +9:u12:rrm2b, +8:u13:fnta, +9:u14:parp1, +7:u22:RRM, +8:u23:RRM2, +8:u00:RXRA, +9:u02:RPS20, +9:u03:RRM2B, +8:u04:FNTA, +9:u05:PARP1, +7:u06:MME, +9:u07:TGIF1, +9:u08:UBE2N, +9:u10:rps20, +9:u11:rrm2b, +8:u12:fnta, +9:u13:parp1, +7:u14:mme, +7:u22:FNT, +8:u23:FNTA, +9:u01:RPS20, +9:u02:RRM2B, +8:u03:FNTA, +9:u04:PARP1, +7:u05:MME, +9:u06:TGIF1, +8:u07:PTK6, +9:u10:rrm2b, +8:u11:fnta, +9:u12:parp1, +7:u13:mme, +9:u14:tgif1, +9:u00:RPS20, +9:u01:RRM2B, +8:u02:FNTA, +9:u03:PARP1, +7:u04:MME, +9:u05:TGIF1, +8:u06:PTK6, +9:u07:UBE2N, +8:u08:FNTB, +8:u10:fnta, +9:u11:parp1, +7:u12:mme, +9:u13:tgif1, +8:u14:ptk6, +7:u23:MME, +9:u00:RRM2B, +8:u01:FNTA, +9:u02:PARP1, +7:u03:MME, +9:u04:TGIF1, +8:u05:PTK6, +9:u06:UBE2N, +9:u08:DNMT1, +9:u10:parp1, +7:u11:mme, +9:u12:tgif1, +8:u13:ptk6, +9:u14:ube2n, +7:u22:TGI, +8:u23:TGIF, +8:u00:FNTA, +9:u01:PARP1, +7:u02:MME, +9:u03:TGIF1, +8:u04:PTK6, +9:u05:UBE2N, +8:u07:FNTB, +7:u10:mme, +9:u11:tgif1, +8:u12:ptk6, +9:u13:ube2n, +7:u22:PTK, +8:u23:PTK6, +9:u00:PARP1, +7:u01:MME, +9:u02:TGIF1, +8:u03:PTK6, +9:u04:UBE2N, +8:u06:FNTB, +9:u07:DNMT1, +8:u08:DRD1, +9:u10:tgif1, +8:u11:ptk6, +9:u12:ube2n, +8:u14:fntb, +6:u21:UB, +7:u22:UBE, +8:u23:UBE2, +7:u00:MME, +9:u01:TGIF1, +8:u02:PTK6, +9:u03:UBE2N, +8:u05:FNTB, +9:u06:DNMT1, +8:u10:ptk6, +9:u11:ube2n, +8:u13:fntb, +9:u14:dnmt1, +9:u00:TGIF1, +8:u01:PTK6, +9:u02:UBE2N, +8:u04:FNTB, +9:u05:DNMT1, +8:u07:DRD1, +8:u08:RPS6, +9:u10:ube2n, +8:u12:fntb, +9:u13:dnmt1, +8:u23:FNTB, +8:u00:PTK6, +9:u01:UBE2N, +8:u03:FNTB, +9:u04:DNMT1, +8:u06:DRD1, +8:u11:fntb, +9:u12:dnmt1, +8:u14:drd1, +7:u22:DNM, +8:u23:DNMT, +9:u00:UBE2N, +8:u02:FNTB, +9:u03:DNMT1, +8:u05:DRD1, +8:u07:RPS6, +9:u08:PRKCQ, +8:u10:fntb, +9:u11:dnmt1, +8:u13:drd1, +8:u01:FNTB, +9:u02:DNMT1, +8:u04:DRD1, +8:u06:RPS6, +9:u08:PPARG, +9:u10:dnmt1, +8:u12:drd1, +8:u14:rps6, +7:u22:DRD, +8:u23:DRD1, +8:u00:FNTB, +9:u01:DNMT1, +8:u03:DRD1, +8:u05:RPS6, +9:u07:PRKCQ, +8:u11:drd1, +8:u13:rps6, +9:u00:DNMT1, +8:u02:DRD1, +8:u04:RPS6, +9:u06:PRKCQ, +9:u07:PPARG, +10:u08:TBXA2R, +8:u10:drd1, +8:u12:rps6, +9:u14:prkcq, +8:u23:RPS6, +8:u01:DRD1, +8:u03:RPS6, +9:u05:PRKCQ, +9:u06:PPARG, +8:u11:rps6, +9:u13:prkcq, +9:u14:pparg, +8:u00:DRD1, +8:u02:RPS6, +9:u04:PRKCQ, +9:u05:PPARG, +10:u07:TBXA2R, +9:u08:RPS26, +8:u10:rps6, +9:u12:prkcq, +9:u13:pparg, +8:u01:RPS6, +9:u03:PRKCQ, +9:u04:PPARG, +10:u06:TBXA2R, +9:u11:prkcq, +9:u12:pparg, +10:u14:tbxa2r, +8:u00:RPS6, +9:u02:PRKCQ, +9:u03:PPARG, +10:u05:TBXA2R, +9:u07:RPS26, +9:u08:TGFB1, +9:u10:prkcq, +9:u11:pparg, +10:u13:tbxa2r, +9:u01:PRKCQ, +9:u02:PPARG, +10:u04:TBXA2R, +9:u06:RPS26, +9:u08:GSK3B, +9:u10:pparg, +10:u12:tbxa2r, +9:u14:rps26, +8:u23:TBXA, +9:u00:PRKCQ, +9:u01:PPARG, +10:u03:TBXA2R, +9:u05:RPS26, +9:u07:TGFB1, +7:u08:HCK, +10:u11:tbxa2r, +9:u13:rps26, +9:u00:PPARG, +10:u02:TBXA2R, +9:u04:RPS26, +9:u06:TGFB1, +9:u07:GSK3B, +9:u08:FGFR1, +10:u10:tbxa2r, +9:u12:rps26, +9:u14:tgfb1, +10:u01:TBXA2R, +9:u03:RPS26, +9:u05:TGFB1, +9:u06:GSK3B, +7:u07:HCK, +8:u08:JAK3, +9:u11:rps26, +9:u13:tgfb1, +9:u14:gsk3b, +10:u00:TBXA2R, +9:u02:RPS26, +9:u04:TGFB1, +9:u05:GSK3B, +7:u06:HCK, +9:u07:FGFR1, +10:u08:RPS27A, +9:u10:rps26, +9:u12:tgfb1, +9:u13:gsk3b, +7:u14:hck, +9:u01:RPS26, +9:u03:TGFB1, +9:u04:GSK3B, +7:u05:HCK, +9:u06:FGFR1, +8:u07:JAK3, +9:u11:tgfb1, +9:u12:gsk3b, +7:u13:hck, +9:u14:fgfr1, +7:u22:GSK, +8:u23:GSK3, +9:u00:RPS26, +9:u02:TGFB1, +9:u03:GSK3B, +7:u04:HCK, +9:u05:FGFR1, +8:u06:JAK3, +10:u07:RPS27A, +9:u10:tgfb1, +9:u11:gsk3b, +7:u12:hck, +9:u13:fgfr1, +8:u14:jak3, +7:u22:HCK, +7:u23:HCK, +9:u01:TGFB1, +9:u02:GSK3B, +7:u03:HCK, +9:u04:FGFR1, +8:u05:JAK3, +10:u06:RPS27A, +8:u08:CDK9, +9:u10:gsk3b, +7:u11:hck, +9:u12:fgfr1, +8:u13:jak3, +10:u14:rps27a, +9:u00:TGFB1, +9:u01:GSK3B, +7:u02:HCK, +9:u03:FGFR1, +8:u04:JAK3, +10:u05:RPS27A, +8:u08:MMP7, +7:u10:hck, +9:u11:fgfr1, +8:u12:jak3, +10:u13:rps27a, +8:u23:JAK3, +9:u00:GSK3B, +7:u01:HCK, +9:u02:FGFR1, +8:u03:JAK3, +10:u04:RPS27A, +8:u07:CDK9, +8:u08:RPS3, +9:u10:fgfr1, +8:u11:jak3, +10:u12:rps27a, +7:u00:HCK, +9:u01:FGFR1, +8:u02:JAK3, +10:u03:RPS27A, +8:u06:CDK9, +8:u07:MMP7, +8:u08:CDK6, +8:u10:jak3, +10:u11:rps27a, +8:u14:cdk9, +9:u00:FGFR1, +8:u01:JAK3, +10:u02:RPS27A, +8:u05:CDK9, +8:u06:MMP7, +8:u07:RPS3, +11:u08:ADORA2A, +10:u10:rps27a, +8:u13:cdk9, +8:u14:mmp7, +8:u00:JAK3, +10:u01:RPS27A, +8:u04:CDK9, +8:u05:MMP7, +8:u06:RPS3, +8:u07:CDK6, +9:u08:HDAC2, +8:u12:cdk9, +8:u13:mmp7, +8:u14:rps3, +8:u23:CDK9, +10:u00:RPS27A, +8:u03:CDK9, +8:u04:MMP7, +8:u05:RPS3, +8:u06:CDK6, +11:u07:ADORA2A, +8:u11:cdk9, +8:u12:mmp7, +8:u13:rps3, +8:u14:cdk6, +8:u23:MMP7, +8:u02:CDK9, +8:u03:MMP7, +8:u04:RPS3, +8:u05:CDK6, +11:u06:ADORA2A, +9:u07:HDAC2, +8:u10:cdk9, +8:u11:mmp7, +8:u12:rps3, +8:u13:cdk6, +11:u14:adora2a, +8:u23:RPS3, +8:u01:CDK9, +8:u02:MMP7, +8:u03:RPS3, +8:u04:CDK6, +11:u05:ADORA2A, +9:u06:HDAC2, +8:u08:PLK1, +8:u10:mmp7, +8:u11:rps3, +8:u12:cdk6, +11:u13:adora2a, +9:u14:hdac2, +8:u23:CDK6, +8:u00:CDK9, +8:u01:MMP7, +8:u02:RPS3, +8:u03:CDK6, +11:u04:ADORA2A, +9:u05:HDAC2, +8:u10:rps3, +8:u11:cdk6, +11:u12:adora2a, +9:u13:hdac2, +8:u00:MMP7, +8:u01:RPS3, +8:u02:CDK6, +11:u03:ADORA2A, +9:u04:HDAC2, +8:u07:PLK1, +8:u10:cdk6, +11:u11:adora2a, +9:u12:hdac2, +8:u00:RPS3, +8:u01:CDK6, +11:u02:ADORA2A, +9:u03:HDAC2, +8:u06:PLK1, +9:u08:PRKCZ, +11:u10:adora2a, +9:u11:hdac2, +8:u14:plk1, +8:u00:CDK6, +11:u01:ADORA2A, +9:u02:HDAC2, +8:u05:PLK1, +10:u08:PTGER4, +9:u10:hdac2, +8:u13:plk1, +11:u00:ADORA2A, +9:u01:HDAC2, +8:u04:PLK1, +9:u07:PRKCZ, +8:u12:plk1, +8:u23:PLK1, +9:u00:HDAC2, +8:u03:PLK1, +9:u06:PRKCZ, +10:u07:PTGER4, +10:u08:PIK3CD, +8:u11:plk1, +9:u14:prkcz, +8:u02:PLK1, +9:u05:PRKCZ, +10:u06:PTGER4, +8:u10:plk1, +9:u13:prkcz, +10:u14:ptger4, +8:u01:PLK1, +9:u04:PRKCZ, +10:u05:PTGER4, +10:u07:PIK3CD, +11:u08:CSNK2A1, +9:u12:prkcz, +10:u13:ptger4, +8:u00:PLK1, +9:u03:PRKCZ, +10:u04:PTGER4, +10:u06:PIK3CD, +9:u11:prkcz, +10:u12:ptger4, +10:u14:pik3cd, +8:u23:PTGE, +9:u02:PRKCZ, +10:u03:PTGER4, +10:u05:PIK3CD, +11:u07:CSNK2A1, +11:u08:RPS6KB1, +9:u10:prkcz, +10:u11:ptger4, +10:u13:pik3cd, +9:u01:PRKCZ, +10:u02:PTGER4, +10:u04:PIK3CD, +11:u06:CSNK2A1, +9:u08:PARP2, +10:u10:ptger4, +10:u12:pik3cd, +11:u14:csnk2a1, +9:u00:PRKCZ, +10:u01:PTGER4, +10:u03:PIK3CD, +11:u05:CSNK2A1, +11:u07:RPS6KB1, +10:u08:PTGER2, +10:u11:pik3cd, +11:u13:csnk2a1, +10:u00:PTGER4, +10:u02:PIK3CD, +11:u04:CSNK2A1, +11:u06:RPS6KB1, +9:u07:PARP2, +10:u10:pik3cd, +11:u12:csnk2a1, +11:u14:rps6kb1, +10:u01:PIK3CD, +11:u03:CSNK2A1, +11:u05:RPS6KB1, +9:u06:PARP2, +10:u07:PTGER2, +11:u11:csnk2a1, +11:u13:rps6kb1, +9:u14:parp2, +10:u00:PIK3CD, +11:u02:CSNK2A1, +11:u04:RPS6KB1, +9:u05:PARP2, +10:u06:PTGER2, +11:u10:csnk2a1, +11:u12:rps6kb1, +9:u13:parp2, +10:u14:ptger2, +11:u01:CSNK2A1, +11:u03:RPS6KB1, +9:u04:PARP2, +10:u05:PTGER2, +9:u08:PRKDC, +11:u11:rps6kb1, +9:u12:parp2, +10:u13:ptger2, +11:u00:CSNK2A1, +11:u02:RPS6KB1, +9:u03:PARP2, +10:u04:PTGER2, +11:u10:rps6kb1, +9:u11:parp2, +10:u12:ptger2, +11:u01:RPS6KB1, +9:u02:PARP2, +10:u03:PTGER2, +9:u07:PRKDC, +8:u08:JAK1, +9:u10:parp2, +10:u11:ptger2, +11:u00:RPS6KB1, +9:u01:PARP2, +10:u02:PTGER2, +9:u06:PRKDC, +9:u08:PTGS2, +10:u10:ptger2, +9:u14:prkdc, +9:u00:PARP2, +10:u01:PTGER2, +9:u05:PRKDC, +8:u07:JAK1, +9:u08:TNNC1, +9:u13:prkdc, +10:u00:PTGER2, +9:u04:PRKDC, +8:u06:JAK1, +9:u07:PTGS2, +9:u08:EPAS1, +9:u12:prkdc, +8:u14:jak1, +9:u03:PRKDC, +8:u05:JAK1, +9:u06:PTGS2, +9:u07:TNNC1, +9:u11:prkdc, +8:u13:jak1, +9:u14:ptgs2, +9:u02:PRKDC, +8:u04:JAK1, +9:u05:PTGS2, +9:u06:TNNC1, +9:u07:EPAS1, +9:u10:prkdc, +8:u12:jak1, +9:u13:ptgs2, +9:u14:tnnc1, +8:u23:JAK1, +9:u01:PRKDC, +8:u03:JAK1, +9:u04:PTGS2, +9:u05:TNNC1, +9:u06:EPAS1, +8:u08:CDK5, +8:u11:jak1, +9:u12:ptgs2, +9:u13:tnnc1, +9:u14:epas1, +8:u23:PTGS, +9:u00:PRKDC, +8:u02:JAK1, +9:u03:PTGS2, +9:u04:TNNC1, +9:u05:EPAS1, +8:u08:RARA, +8:u10:jak1, +9:u11:ptgs2, +9:u12:tnnc1, +9:u13:epas1, +7:u22:TNN, +8:u23:TNNC, +8:u01:JAK1, +9:u02:PTGS2, +9:u03:TNNC1, +9:u04:EPAS1, +8:u07:CDK5, +9:u08:CCND1, +9:u10:ptgs2, +9:u11:tnnc1, +9:u12:epas1, +7:u22:EPA, +8:u23:EPAS, +8:u00:JAK1, +9:u01:PTGS2, +9:u02:TNNC1, +9:u03:EPAS1, +8:u06:CDK5, +8:u07:RARA, +9:u10:tnnc1, +9:u11:epas1, +8:u14:cdk5, +9:u00:PTGS2, +9:u01:TNNC1, +9:u02:EPAS1, +8:u05:CDK5, +8:u06:RARA, +9:u07:CCND1, +10:u08:TUBA1B, +9:u10:epas1, +8:u13:cdk5, +8:u14:rara, +9:u00:TNNC1, +9:u01:EPAS1, +8:u04:CDK5, +8:u05:RARA, +9:u06:CCND1, +8:u12:cdk5, +8:u13:rara, +9:u14:ccnd1, +8:u23:CDK5, +9:u00:EPAS1, +8:u03:CDK5, +8:u04:RARA, +9:u05:CCND1, +10:u07:TUBA1B, +8:u11:cdk5, +8:u12:rara, +9:u13:ccnd1, +8:u23:RARA, +8:u02:CDK5, +8:u03:RARA, +9:u04:CCND1, +10:u06:TUBA1B, +8:u10:cdk5, +8:u11:rara, +9:u12:ccnd1, +10:u14:tuba1b, +7:u22:CCN, +8:u23:CCND, +8:u01:CDK5, +8:u02:RARA, +9:u03:CCND1, +10:u05:TUBA1B, +8:u10:rara, +9:u11:ccnd1, +10:u13:tuba1b, +8:u00:CDK5, +8:u01:RARA, +9:u02:CCND1, +10:u04:TUBA1B, +9:u10:ccnd1, +10:u12:tuba1b, +8:u23:TUBA, +8:u00:RARA, +9:u01:CCND1, +10:u03:TUBA1B, +11:u08:zigzag;, +14:u08:contiguous, +10:u11:tuba1b, +9:u00:CCND1, +10:u02:TUBA1B, +9:u08:line;, +14:u07:contiguous, +10:u10:tuba1b, +10:u01:TUBA1B, +11:u07:zigzag;, +14:u06:contiguous, +10:u00:TUBA1B, +11:u06:zigzag;, +9:u07:line;, +14:u05:contiguous, +10:u08:arrow;, +11:u14:zigzag;, +8:uI2:;,;,, +11:u05:zigzag;, +9:u06:line;, +14:u04:contiguous, +10:u07:arrow;, +13:u08:Cytoscape, +11:u13:zigzag;, +9:u14:line;, +8:uI1:;,;,, +9:uI2:;,;-,, +11:u04:zigzag;, +9:u05:line;, +14:u03:contiguous, +10:u06:arrow;, +13:u07:Cytoscape, +11:u12:zigzag;, +9:u13:line;, +14:u14:contiguous, +7:u22:zig, +8:u23:zigz, +8:uI0:;,;,, +9:uI1:;,;-,, +9:uI2:;-,;,, +11:u03:zigzag;, +9:u04:line;, +14:u02:contiguous, +10:u05:arrow;, +13:u06:Cytoscape, +11:u11:zigzag;, +9:u12:line;, +14:u13:contiguous, +9:uI0:;,;-,, +9:uI1:;-,;,, +11:u02:zigzag;, +9:u03:line;, +14:u01:contiguous, +10:u04:arrow;, +13:u05:Cytoscape, +11:u10:zigzag;, +9:u11:line;, +14:u12:contiguous, +9:uI0:;-,;,, +11:u01:zigzag;, +9:u02:line;, +14:u00:contiguous, +10:u03:arrow;, +13:u04:Cytoscape, +9:u10:line;, +14:u11:contiguous, +11:u00:zigzag;, +9:u01:line;, +10:u02:arrow;, +13:u03:Cytoscape, +14:u10:contiguous, +9:u00:line;, +10:u01:arrow;, +13:u02:Cytoscape, +10:u00:arrow;, +13:u01:Cytoscape, +13:u00:Cytoscape, +10:u08:Purity, +10:u07:Purity, +10:u06:Purity, +10:u05:Purity, +10:u04:Purity, +10:u03:Purity, +13:u08:portfolio, +10:u02:Purity, +13:u07:portfolio, +8:u08:2023, +8:u08:Last, +10:u01:Purity, +13:u06:portfolio, +8:u07:2023, +14:u08:author(s):, +10:u00:Purity, +13:u05:portfolio, +8:u06:2023, +14:u07:author(s):, +8:u07:Last, +13:u04:portfolio, +8:u05:2023, +14:u06:author(s):, +8:u06:Last, +13:u03:portfolio, +8:u04:2023, +14:u05:author(s):, +8:u05:Last, +13:u02:portfolio, +8:u03:2023, +14:u04:author(s):, +8:u04:Last, +13:u01:portfolio, +8:u02:2023, +14:u03:author(s):, +8:u03:Last, +13:u00:portfolio, +8:u01:2023, +14:u02:author(s):, +8:u02:Last, +8:u00:2023, +14:u01:author(s):, +13:u08:Confirmed, +8:u01:Last, +14:u00:author(s):, +13:u07:Confirmed, +8:u00:Last, +13:u06:Confirmed, +13:u05:Confirmed, +13:u04:Confirmed, +8:uI2:()/,, +13:u03:Confirmed, +8:uI1:()/,, +13:u02:Confirmed, +8:uI0:()/,, +13:u01:Confirmed, +13:u00:Confirmed, +8:u08:Give, +12:uI2:(..)(..), +8:u07:Give, +12:uI1:(..)(..), +8:u06:Give, +7:u23:AND, +12:uI0:(..)(..), +13:uI2:,(..,,),,, +8:u05:Give, +13:uI1:,(..,,),,, +8:u04:Give, +7:u08:web, +13:uI0:,(..,,),,, +8:u03:Give, +7:u07:web, +8:u02:Give, +7:u06:web, +12:uI2:(..','),, +8:u01:Give, +7:u05:web, +12:uI1:(..','),, +8:u00:Give, +7:u04:web, +15:u08:Environment, +12:uI0:(..','),, +7:u03:web, +15:u07:Environment, +7:u02:web, +15:u06:Environment, +10:u08:code/., +7:u01:web, +15:u05:Environment, +59:u08:www.genomicsengland.co.uk/research/academic/join-gecip., +7:u00:web, +15:u04:Environment, +10:u07:code/., +15:u03:Environment, +16:uI2:(://..///.)., +10:u06:code/., +59:u07:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u02:Environment, +40:u08:(https://zenodo.org/record/8329054)., +10:u14:code/., +16:uI1:(://..///.)., +8:uI2:////, +10:u05:code/., +59:u06:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u08:VerifyBamID, +15:u01:Environment, +40:u07:(https://zenodo.org/record/8329054)., +22:u08:packages/softwware, +10:u13:code/., +59:u14:www.genomicsengland.co.uk/research/academic/join-gecip., +16:uI0:(://..///.)., +8:uI1:////, +9:uI2:/.://, +10:u04:code/., +59:u05:www.genomicsengland.co.uk/research/academic/join-gecip., +9:u08:Ccube, +15:u00:Environment, +40:u06:(https://zenodo.org/record/8329054)., +22:u07:packages/softwware, +10:u08:v1.1.3, +10:u12:code/., +59:u13:www.genomicsengland.co.uk/research/academic/join-gecip., +8:uI0:////, +9:uI1:/.://, +12:uI2:...///-., +10:u03:code/., +59:u04:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u07:VerifyBamID, +9:u08:Isaac, +40:u05:(https://zenodo.org/record/8329054)., +22:u06:packages/softwware, +10:u07:v1.1.3, +6:u08:v1, +10:u11:code/., +59:u12:www.genomicsengland.co.uk/research/academic/join-gecip., +9:uI0:/.://, +12:uI1:...///-., +13:uI2:(://.//)., +10:u02:code/., +59:u03:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u06:VerifyBamID, +9:u07:Ccube, +11:u08:Strelka, +40:u04:(https://zenodo.org/record/8329054)., +22:u05:packages/softwware, +10:u06:v1.1.3, +6:u07:v1, +11:u08:aligner, +10:u10:code/., +59:u11:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u14:verifybamid, +12:uI0:...///-., +13:uI1:(://.//)., +10:u01:code/., +59:u02:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u05:VerifyBamID, +9:u06:Ccube, +9:u07:Isaac, +12:u08:bcftools, +40:u03:(https://zenodo.org/record/8329054)., +22:u04:packages/softwware, +10:u05:v1.1.3, +6:u06:v1, +11:u07:aligner, +10:u08:v2.4.7, +59:u10:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u13:verifybamid, +9:u14:ccube, +13:uI0:(://.//)., +12:uI2:..://.//, +10:u00:code/., +59:u01:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u04:VerifyBamID, +9:u05:Ccube, +9:u06:Isaac, +11:u07:Strelka, +22:u08:alleleCount-FixVAF, +40:u02:(https://zenodo.org/record/8329054)., +22:u03:packages/softwware, +10:u04:v1.1.3, +6:u05:v1, +11:u06:aligner, +10:u07:v2.4.7, +8:u08:v1.9, +15:u12:verifybamid, +9:u13:ccube, +9:u14:isaac, +8:u23:Veri, +12:uI1:..://.//, +59:u00:www.genomicsengland.co.uk/research/academic/join-gecip., +15:u03:VerifyBamID, +9:u04:Ccube, +9:u05:Isaac, +11:u06:Strelka, +12:u07:bcftools, +40:u01:(https://zenodo.org/record/8329054)., +22:u02:packages/softwware, +10:u03:v1.1.3, +6:u04:v1, +11:u05:aligner, +10:u06:v2.4.7, +8:u07:v1.9, +10:u08:v4.1.0, +15:u11:verifybamid, +9:u12:ccube, +9:u13:isaac, +11:u14:strelka, +6:u21:Cc, +7:u22:Ccu, +8:u23:Ccub, +12:uI0:..://.//, +13:uI2:...://.//, +15:u02:VerifyBamID, +9:u03:Ccube, +9:u04:Isaac, +11:u05:Strelka, +12:u06:bcftools, +22:u07:alleleCount-FixVAF, +8:u08:CADD, +40:u00:(https://zenodo.org/record/8329054)., +22:u01:packages/softwware, +10:u02:v1.1.3, +6:u03:v1, +11:u04:aligner, +10:u05:v2.4.7, +8:u06:v1.9, +10:u07:v4.1.0, +8:u08:v101, +15:u10:verifybamid, +9:u11:ccube, +9:u12:isaac, +11:u13:strelka, +12:u14:bcftools, +8:u23:Isaa, +13:uI1:...://.//, +15:u01:VerifyBamID, +9:u02:Ccube, +9:u03:Isaac, +11:u04:Strelka, +12:u05:bcftools, +22:u06:alleleCount-FixVAF, +10:u08:OncoKb, +22:u00:packages/softwware, +10:u01:v1.1.3, +6:u02:v1, +11:u03:aligner, +10:u04:v2.4.7, +8:u05:v1.9, +10:u06:v4.1.0, +8:u07:v101, +8:u08:v1.6, +9:u10:ccube, +9:u11:isaac, +11:u12:strelka, +12:u13:bcftools, +22:u14:allelecount-fixvaf, +13:uI0:...://.//, +15:u00:VerifyBamID, +9:u01:Ccube, +9:u02:Isaac, +11:u03:Strelka, +12:u04:bcftools, +22:u05:alleleCount-FixVAF, +8:u07:CADD, +15:u08:trackViewer, +10:u00:v1.1.3, +6:u01:v1, +11:u02:aligner, +10:u03:v2.4.7, +8:u04:v1.9, +10:u05:v4.1.0, +8:u06:v101, +8:u07:v1.6, +9:u08:v3.11, +9:u10:isaac, +11:u11:strelka, +12:u12:bcftools, +22:u13:allelecount-fixvaf, +7:u14:vep, +7:u22:bcf, +8:u23:bcft, +14:uI2:-..://.//-, +9:u00:Ccube, +9:u01:Isaac, +11:u02:Strelka, +12:u03:bcftools, +22:u04:alleleCount-FixVAF, +8:u06:CADD, +10:u07:OncoKb, +6:u00:v1, +11:u01:aligner, +10:u02:v2.4.7, +8:u03:v1.9, +10:u04:v4.1.0, +8:u05:v101, +8:u06:v1.6, +9:u07:v3.11, +11:u08:v1.38.2, +11:u10:strelka, +12:u11:bcftools, +22:u12:allelecount-fixvaf, +7:u13:vep, +8:u14:cadd, +14:uI1:-..://.//-, +11:uI2:://.//-, +9:u00:Isaac, +11:u01:Strelka, +12:u02:bcftools, +22:u03:alleleCount-FixVAF, +8:u05:CADD, +10:u06:OncoKb, +15:u07:trackViewer, +12:u08:HRDetect, +11:u00:aligner, +10:u01:v2.4.7, +8:u02:v1.9, +10:u03:v4.1.0, +8:u04:v101, +8:u05:v1.6, +9:u06:v3.11, +11:u07:v1.38.2, +12:u10:bcftools, +22:u11:allelecount-fixvaf, +7:u12:vep, +8:u13:cadd, +7:u22:VEP, +7:u23:VEP, +14:uI0:-..://.//-, +11:uI1:://.//-, +13:uI2:.://.//-/, +11:u00:Strelka, +12:u01:bcftools, +22:u02:alleleCount-FixVAF, +8:u04:CADD, +10:u05:OncoKb, +15:u06:trackViewer, +10:u00:v2.4.7, +8:u01:v1.9, +10:u02:v4.1.0, +8:u03:v101, +8:u04:v1.6, +9:u05:v3.11, +11:u06:v1.38.2, +22:u10:allelecount-fixvaf, +7:u11:vep, +8:u12:cadd, +15:u14:trackviewer, +7:u22:CAD, +8:u23:CADD, +11:uI0:://.//-, +13:uI1:.://.//-/, +12:uI2:.://../-, +12:u00:bcftools, +22:u01:alleleCount-FixVAF, +8:u03:CADD, +10:u04:OncoKb, +15:u05:trackViewer, +12:u07:HRDetect, +8:u00:v1.9, +10:u01:v4.1.0, +8:u02:v101, +8:u03:v1.6, +9:u04:v3.11, +11:u05:v1.38.2, +7:u10:vep, +8:u11:cadd, +15:u13:trackviewer, +10:u14:msings, +13:uI0:.://.//-/, +12:uI1:.://../-, +22:u00:alleleCount-FixVAF, +8:u02:CADD, +10:u03:OncoKb, +15:u04:trackViewer, +12:u06:HRDetect, +10:u00:v4.1.0, +8:u01:v101, +8:u02:v1.6, +9:u03:v3.11, +11:u04:v1.38.2, +8:u10:cadd, +15:u12:trackviewer, +10:u13:msings, +12:u14:hrdetect, +12:uI0:.://../-, +13:uI2:://./////, +8:u01:CADD, +10:u02:OncoKb, +15:u03:trackViewer, +12:u05:HRDetect, +14:u08:Battenberg, +8:u00:v101, +8:u01:v1.6, +9:u02:v3.11, +11:u03:v1.38.2, +15:u11:trackviewer, +10:u12:msings, +12:u13:hrdetect, +6:u21:mS, +7:u22:mSI, +8:u23:mSIN, +13:uI1:://./////, +8:u00:CADD, +10:u01:OncoKb, +15:u02:trackViewer, +12:u04:HRDetect, +9:u08:Delly, +8:u00:v1.6, +9:u01:v3.11, +11:u02:v1.38.2, +10:u08:v2.2.8, +15:u10:trackviewer, +10:u11:msings, +12:u12:hrdetect, +7:u22:HRD, +8:u23:HRDe, +13:uI0:://./////, +10:u00:OncoKb, +15:u01:trackViewer, +12:u03:HRDetect, +14:u07:Battenberg, +9:u08:Lumpy, +9:u00:v3.11, +11:u01:v1.38.2, +10:u07:v2.2.8, +11:u08:v0.7.9=, +10:u10:msings, +12:u11:hrdetect, +15:u00:trackViewer, +12:u02:HRDetect, +14:u06:Battenberg, +9:u07:Delly, +9:u08:Manta, +11:u00:v1.38.2, +10:u06:v2.2.8, +11:u07:v0.7.9=, +11:u08:v0.2.13, +12:u10:hrdetect, +14:u14:battenberg, +12:u01:HRDetect, +14:u05:Battenberg, +9:u06:Delly, +9:u07:Lumpy, +10:u05:v2.2.8, +11:u06:v0.7.9=, +11:u07:v0.2.13, +10:u08:v1.5.0, +14:u13:battenberg, +9:u14:delly, +13:uI2:..://./-/, +12:u00:HRDetect, +14:u04:Battenberg, +9:u05:Delly, +9:u06:Lumpy, +9:u07:Manta, +10:u08:BEDOPS, +10:u04:v2.2.8, +11:u05:v0.7.9=, +11:u06:v0.2.13, +10:u07:v1.5.0, +11:u08:v.4.4.0, +14:u12:battenberg, +9:u13:delly, +9:u14:lumpy, +13:uI1:..://./-/, +14:u03:Battenberg, +9:u04:Delly, +9:u05:Lumpy, +9:u06:Manta, +12:u08:bedtools, +10:u03:v2.2.8, +11:u04:v0.7.9=, +11:u05:v0.2.13, +10:u06:v1.5.0, +11:u07:v.4.4.0, +10:u08:v2.4.2, +14:u11:battenberg, +9:u12:delly, +9:u13:lumpy, +9:u14:manta, +8:u23:Dell, +13:uI0:..://./-/, +14:uI2:..://.//-/, +14:u02:Battenberg, +9:u03:Delly, +9:u04:Lumpy, +9:u05:Manta, +10:u07:BEDOPS, +10:u02:v2.2.8, +11:u03:v0.7.9=, +11:u04:v0.2.13, +10:u05:v1.5.0, +11:u06:v.4.4.0, +10:u07:v2.4.2, +10:u08:v2.3.0, +14:u10:battenberg, +9:u11:delly, +9:u12:lumpy, +9:u13:manta, +8:u14:gatk, +8:u23:Lump, +14:uI1:..://.//-/, +14:u01:Battenberg, +9:u02:Delly, +9:u03:Lumpy, +9:u04:Manta, +10:u06:BEDOPS, +12:u07:bedtools, +10:u01:v2.2.8, +11:u02:v0.7.9=, +11:u03:v0.2.13, +10:u04:v1.5.0, +11:u05:v.4.4.0, +10:u06:v2.4.2, +10:u07:v2.3.0, +11:u08:v0.99.2, +9:u10:delly, +9:u11:lumpy, +9:u12:manta, +8:u13:gatk, +10:u14:bedops, +8:u23:Mant, +14:uI0:..://.//-/, +14:u00:Battenberg, +9:u01:Delly, +9:u02:Lumpy, +9:u03:Manta, +10:u05:BEDOPS, +12:u06:bedtools, +14:u08:reviewers., +10:u00:v2.2.8, +11:u01:v0.7.9=, +11:u02:v0.2.13, +10:u03:v1.5.0, +11:u04:v.4.4.0, +10:u05:v2.4.2, +10:u06:v2.3.0, +11:u07:v0.99.2, +15:u08:manuscripts, +9:u10:lumpy, +9:u11:manta, +8:u12:gatk, +10:u13:bedops, +12:u14:bedtools, +8:u23:GATK, +9:u00:Delly, +9:u01:Lumpy, +9:u02:Manta, +10:u04:BEDOPS, +12:u05:bedtools, +11:u00:v0.7.9=, +11:u01:v0.2.13, +10:u02:v1.5.0, +11:u03:v.4.4.0, +10:u04:v2.4.2, +10:u05:v2.3.0, +11:u06:v0.99.2, +15:u07:manuscripts, +9:u10:manta, +8:u11:gatk, +10:u12:bedops, +12:u13:bedtools, +7:u22:BED, +8:u23:BEDO, +15:uI2:..://..///., +9:u00:Lumpy, +9:u01:Manta, +10:u03:BEDOPS, +12:u04:bedtools, +14:u07:reviewers., +11:u00:v0.2.13, +10:u01:v1.5.0, +11:u02:v.4.4.0, +10:u03:v2.4.2, +10:u04:v2.3.0, +11:u05:v0.99.2, +15:u06:manuscripts, +8:u10:gatk, +10:u11:bedops, +12:u12:bedtools, +8:u23:bedt, +15:uI1:..://..///., +9:u00:Manta, +10:u02:BEDOPS, +12:u03:bedtools, +14:u06:reviewers., +10:u00:v1.5.0, +11:u01:v.4.4.0, +10:u02:v2.4.2, +10:u03:v2.3.0, +11:u04:v0.99.2, +15:u05:manuscripts, +10:u10:bedops, +12:u11:bedtools, +14:u14:reviewers., +15:uI0:..://..///., +10:u01:BEDOPS, +12:u02:bedtools, +14:u05:reviewers., +14:u08:-Accession, +11:u00:v.4.4.0, +10:u01:v2.4.2, +10:u02:v2.3.0, +11:u03:v0.99.2, +15:u04:manuscripts, +12:u10:bedtools, +14:u13:reviewers., +11:uI2:.(..).., +10:u00:BEDOPS, +12:u01:bedtools, +14:u04:reviewers., +10:u00:v2.4.2, +10:u01:v2.3.0, +11:u02:v0.99.2, +15:u03:manuscripts, +10:u08:codes,, +14:u12:reviewers., +11:uI1:.(..).., +12:u00:bedtools, +14:u03:reviewers., +14:u07:-Accession, +10:u00:v2.3.0, +11:u01:v0.99.2, +15:u02:manuscripts, +10:u07:codes,, +14:u11:reviewers., +11:uI0:.(..).., +14:u02:reviewers., +14:u06:-Accession, +11:u00:v0.99.2, +15:u01:manuscripts, +10:u06:codes,, +14:u10:reviewers., +14:u14:-accession, +14:u01:reviewers., +14:u05:-Accession, +15:u00:manuscripts, +10:u05:codes,, +14:u13:-accession, +14:u00:reviewers., +14:u04:-Accession, +15:u08:Partnership, +10:u04:codes,, +14:u12:-accession, +8:u14:-for, +7:u22:-Ac, +8:u23:-Acc, +14:u03:-Accession, +10:u03:codes,, +11:u08:(GeCIP), +14:u11:-accession, +8:u13:-for, +14:u02:-Accession, +15:u07:Partnership, +10:u02:codes,, +11:u07:(GeCIP), +14:u10:-accession, +8:u12:-for, +8:u23:-For, +14:u01:-Accession, +15:u06:Partnership, +10:u01:codes,, +11:u06:(GeCIP), +8:u11:-for, +15:u14:partnership, +14:u00:-Accession, +15:u05:Partnership, +10:u00:codes,, +11:u05:(GeCIP), +8:u10:-for, +15:u13:partnership, +19:uI2:()'(://...//-)., +15:u04:Partnership, +11:u04:(GeCIP), +15:u12:partnership, +19:uI1:()'(://...//-)., +15:u03:Partnership, +11:u03:(GeCIP), +15:u11:partnership, +19:uI0:()'(://...//-)., +15:u02:Partnership, +11:u02:(GeCIP), +15:u10:partnership, +14:uI2:.://...//., +15:u01:Partnership, +11:u01:(GeCIP), +14:uI1:.://...//., +14:uI2:://./////., +15:u00:Partnership, +37:u08:cancer.sanger.ac.uk/actionability, +11:u00:(GeCIP), +14:uI0:.://...//., +14:uI1:://./////., +17:uI2:(://.../-/).,, +23:u08:https://cansar.ai/., +14:uI0:://./////., +17:uI1:(://.../-/).,, +14:uI2:://.../-/., +37:u07:cancer.sanger.ac.uk/actionability, +17:uI0:(://.../-/).,, +14:uI1:://.../-/., +11:uI2://///.-, +37:u06:cancer.sanger.ac.uk/actionability, +23:u07:https://cansar.ai/., +37:u14:cancer.sanger.ac.uk/actionability, +14:uI0:://.../-/., +11:uI1://///.-, +13:uI2://///.://, +37:u05:cancer.sanger.ac.uk/actionability, +23:u06:https://cansar.ai/., +37:u13:cancer.sanger.ac.uk/actionability, +23:u14:https://cansar.ai/., +11:uI0://///.-, +13:uI1://///.://, +17:uI2:.../://../#,., +37:u04:cancer.sanger.ac.uk/actionability, +23:u05:https://cansar.ai/., +37:u12:cancer.sanger.ac.uk/actionability, +23:u13:https://cansar.ai/., +13:uI0://///.://, +17:uI1:.../://../#,., +23:uI2:://./.://...//---/., +37:u03:cancer.sanger.ac.uk/actionability, +23:u04:https://cansar.ai/., +37:u11:cancer.sanger.ac.uk/actionability, +23:u12:https://cansar.ai/., +17:uI0:.../://../#,., +23:uI1:://./.://...//---/., +23:uI2:(://...//),(://../), +37:u02:cancer.sanger.ac.uk/actionability, +23:u03:https://cansar.ai/., +10:u08:sexual, +37:u10:cancer.sanger.ac.uk/actionability, +23:u11:https://cansar.ai/., +23:uI0:://./.://...//---/., +23:uI1:(://...//),(://../), +37:u01:cancer.sanger.ac.uk/actionability, +23:u02:https://cansar.ai/., +10:u07:sexual, +23:u10:https://cansar.ai/., +23:uI0:(://...//),(://../), +37:u00:cancer.sanger.ac.uk/actionability, +23:u01:https://cansar.ai/., +10:u06:sexual, +10:uI2:.,(/),, +23:u00:https://cansar.ai/., +10:u05:sexual, +10:uI1:.,(/),, +10:u04:sexual, +10:uI0:.,(/),, +13:u08:groupings, +10:u03:sexual, +12:u08:socially, +12:u08:Reported, +10:u02:sexual, +12:u07:socially, +13:u07:groupings, +10:u01:sexual, +12:u06:socially, +9:u08:race,, +13:u06:groupings, +12:u07:Reported, +10:u00:sexual, +12:u05:socially, +9:u07:race,, +13:u14:groupings, +13:u05:groupings, +12:u06:Reported, +12:u04:socially, +9:u06:race,, +13:u13:groupings, +13:u04:groupings, +12:u05:Reported, +12:u03:socially, +9:u05:race,, +13:u12:groupings, +13:u03:groupings, +12:u04:Reported, +12:u02:socially, +9:u04:race,, +13:u11:groupings, +13:u02:groupings, +12:u03:Reported, +12:u01:socially, +9:u03:race,, +13:u10:groupings, +13:u01:groupings, +12:u02:Reported, +16:u08:Environment., +12:u00:socially, +9:u02:race,, +13:u00:groupings, +12:u01:Reported, +9:u01:race,, +12:u00:Reported, +16:u07:Environment., +9:u00:race,, +13:u08:oversight, +16:u06:Environment., +13:u07:oversight, +16:u05:Environment., +13:u06:oversight, +16:u04:Environment., +18:u08:Field-specific, +13:u05:oversight, +16:u03:Environment., +13:u04:oversight, +16:u02:Environment., +18:u07:Field-specific, +13:u03:oversight, +7:uI2:,//, +16:u01:Environment., +18:u06:Field-specific, +13:u02:oversight, +18:u14:field-specific, +7:uI1:,//, +16:u00:Environment., +18:u05:Field-specific, +15:u08:Ecological,, +13:u01:oversight, +18:u13:field-specific, +7:uI0:,//, +18:u04:Field-specific, +13:u00:oversight, +18:u12:field-specific, +18:u03:Field-specific, +15:u07:Ecological,, +18:u11:field-specific, +18:u02:Field-specific, +15:u06:Ecological,, +18:u10:field-specific, +15:u14:ecological,, +18:u01:Field-specific, +15:u05:Ecological,, +15:u13:ecological,, +18:u00:Field-specific, +15:u04:Ecological,, +15:u12:ecological,, +12:uI2:,.//---., +15:u03:Ecological,, +15:u11:ecological,, +12:uI1:,.//---., +15:u02:Ecological,, +15:u10:ecological,, +12:uI0:,.//---., +15:u01:Ecological,, +15:u00:Ecological,, +14:u08:exclusions, +14:u07:exclusions, +14:u06:exclusions, +14:u05:exclusions, +14:u04:exclusions, +14:u03:exclusions, +17:uI2:(,,-,).,/,(.), +14:u02:exclusions, +17:uI1:(,,-,).,/,(.), +14:u01:exclusions, +17:uI0:(,,-,).,/,(.), +9:uI2:./(.), +15:u08:Replication, +14:u00:exclusions, +9:uI1:./(.), +9:uI0:./(.), +15:u07:Replication, +15:u06:Replication, +15:u05:Replication, +12:u08:Blinding, +15:u04:Replication, +15:u03:Replication, +12:u07:Blinding, +15:u02:Replication, +12:u06:Blinding, +12:u14:blinding, +15:u01:Replication, +12:u05:Blinding, +12:u13:blinding, +15:u00:Replication, +12:u04:Blinding, +12:u12:blinding, +7:u22:Bli, +8:u23:Blin, +12:u03:Blinding, +12:u11:blinding, +12:u02:Blinding, +12:u10:blinding, +12:u01:Blinding, +12:u08:Involved, +12:u00:Blinding, +12:u07:Involved, +17:u08:Palaeontology, +12:u06:Involved, +12:u05:Involved, +17:u07:Palaeontology, +12:u04:Involved, +17:u06:Palaeontology, +8:u08:Dual, +12:u03:Involved, +17:u14:palaeontology, +17:u05:Palaeontology, +10:u08:Plants, +12:u02:Involved, +17:u13:palaeontology, +17:u04:Palaeontology, +8:u07:Dual, +12:u01:Involved, +17:u12:palaeontology, +17:u03:Palaeontology, +8:u06:Dual, +10:u07:Plants, +12:u00:Involved, +17:u11:palaeontology, +8:u14:dual, +17:u02:Palaeontology, +8:u05:Dual, +10:u06:Plants, +12:u08:ChIP-seq, +17:u10:palaeontology, +8:u13:dual, +10:u14:plants, +17:u01:Palaeontology, +8:u04:Dual, +10:u05:Plants, +8:u12:dual, +10:u13:plants, +7:u22:Dua, +8:u23:Dual, +17:u00:Palaeontology, +8:u03:Dual, +10:u04:Plants, +12:u07:ChIP-seq, +13:u08:MRI-based, +8:u11:dual, +10:u12:plants, +8:u02:Dual, +10:u03:Plants, +12:u06:ChIP-seq, +16:u08:neuroimaging, +8:u10:dual, +10:u11:plants, +12:u14:chip-seq, +8:u01:Dual, +10:u02:Plants, +12:u05:ChIP-seq, +13:u07:MRI-based, +12:u08:Describe, +16:u07:neuroimaging, +10:u10:plants, +12:u13:chip-seq, +8:u00:Dual, +10:u01:Plants, +12:u04:ChIP-seq, +13:u06:MRI-based, +16:u06:neuroimaging, +12:u12:chip-seq, +13:u14:mri-based, +7:u22:ChI, +8:u23:ChIP, +10:u00:Plants, +12:u03:ChIP-seq, +13:u05:MRI-based, +12:u07:Describe, +16:u05:neuroimaging, +12:u08:editing,, +12:u11:chip-seq, +13:u13:mri-based, +12:u02:ChIP-seq, +13:u04:MRI-based, +12:u06:Describe, +16:u04:neuroimaging, +12:u07:editing,, +12:u10:chip-seq, +13:u12:mri-based, +8:u23:MRI-, +12:u01:ChIP-seq, +13:u03:MRI-based, +12:u05:Describe, +16:u03:neuroimaging, +12:u06:editing,, +13:u11:mri-based, +12:u00:ChIP-seq, +13:u02:MRI-based, +12:u04:Describe, +8:u08:Seed, +16:u02:neuroimaging, +12:u05:editing,, +12:u08:applied., +13:u10:mri-based, +10:uI2:,/-.,,, +13:u01:MRI-based, +12:u03:Describe, +16:u01:neuroimaging, +12:u04:editing,, +12:u07:applied., +10:uI1:,/-.,,, +13:u00:MRI-based, +12:u02:Describe, +8:u07:Seed, +16:u00:neuroimaging, +12:u03:editing,, +12:u06:applied., +10:uI0:,/-.,,, +12:u01:Describe, +8:u06:Seed, +18:u08:Authentication, +12:u02:editing,, +12:u05:applied., +12:u00:Describe, +8:u05:Seed, +12:u01:editing,, +12:u04:applied., +8:u04:Seed, +18:u07:Authentication, +12:u00:editing,, +12:u03:applied., +8:u23:Seed, +8:u03:Seed, +18:u06:Authentication, +14:u08:off-target, +12:u02:applied., +8:u02:Seed, +18:u05:Authentication, +12:u01:applied., +8:u01:Seed, +18:u04:Authentication, +14:u07:off-target, +12:u00:applied., +8:u00:Seed, +18:u03:Authentication, +14:u06:off-target, +14:u14:off-target, +12:uI2:,,(..-,,, +18:u02:Authentication, +14:u05:off-target, +14:u13:off-target, +12:uI1:,,(..-,,, +18:u01:Authentication, +14:u04:off-target, +14:u12:off-target, +12:uI0:,,(..-,,, +18:u00:Authentication, +14:u03:off-target, +14:u11:off-target, 17:u06:spore-forming, 12:u08:Authors:, 12:u08:Patrizia, @@ -535539,7 +552513,6 @@ 10:u01:Sergio, 29:u02:Sergio.baranzini@ucsf.edu, 7:u03:Ph:, -14:u08:alteration, 16:u03:415-502-6865, 16:u04:415-476-5229, 13:u07:sclerosis, @@ -535554,34 +552527,21 @@ 7:u10:ph:, 29:u00:Sergio.baranzini@ucsf.edu, 7:u01:Ph:, -14:u07:alteration, 16:u01:415-502-6865, 16:u02:415-476-5229, 13:u05:sclerosis, 7:u00:Ph:, -14:u06:alteration, 16:u00:415-502-6865, 16:u01:415-476-5229, 13:u04:sclerosis, -14:u14:alteration, -14:u05:alteration, 16:u00:415-476-5229, 13:u03:sclerosis, -14:u13:alteration, -14:u04:alteration, 13:u02:sclerosis, -14:u12:alteration, -14:u03:alteration, 17:u08:spore-forming, 13:u01:sclerosis, -14:u11:alteration, -14:u02:alteration, 14:u08:secreting,, 13:u00:sclerosis, -14:u10:alteration, -14:u01:alteration, 17:u07:spore-forming, -14:u00:alteration, 14:u07:secreting,, 14:u06:secreting,, 14:u14:secreting,, @@ -536140,7 +553100,6 @@ 17:u07:autoimmunity., 10:u10:il-10+, 11:u12:ifn+, -7:u22:IFN, 10:u23:IFN, 10:u01:IL-10+, 17:u06:autoimmunity., @@ -538709,17 +555668,14 @@ 14:u03:mesenteric, 14:u07:rectangle,, 16:u14:comparisons), -7:uI2:(.-, 14:u02:mesenteric, 14:u06:rectangle,, 16:u13:comparisons), -7:uI1:(.-, 9:uI2:).,-., 14:u01:mesenteric, 14:u05:rectangle,, 13:u08:controls., 16:u12:comparisons), -7:uI0:(.-, 9:uI1:).,-., 14:u00:mesenteric, 14:u04:rectangle,, @@ -538782,43 +555738,34 @@ 16:u01:comparisons., 16:u00:comparisons., 17:u08:reads/sample., -8:u08:Last, 17:u07:reads/sample., -8:u07:Last, 17:u06:reads/sample., 9:u08:Cases, -8:u06:Last, 17:u14:reads/sample., 17:u05:reads/sample., 12:u08:Controls, -8:u05:Last, 17:u13:reads/sample., 9:uI2:/.()., 17:u04:reads/sample., 9:u07:Cases, -8:u04:Last, 17:u12:reads/sample., 9:uI1:/.()., 17:u03:reads/sample., 9:u06:Cases, 12:u07:Controls, -8:u03:Last, 17:u11:reads/sample., 9:uI0:/.()., 17:u02:reads/sample., 9:u05:Cases, 12:u06:Controls, -8:u02:Last, 17:u10:reads/sample., 17:u01:reads/sample., 9:u04:Cases, 12:u05:Controls, -8:u01:Last, 17:u00:reads/sample., 9:u03:Cases, 12:u04:Controls, 9:u08:80.0%, -8:u00:Last, 9:u02:Cases, 12:u03:Controls, 9:u01:Cases, @@ -541152,42 +558099,28 @@ 19:u13:data-collection, 7:u01:866, 19:u04:Data-collection, -14:u08:Wavelength, 19:u12:data-collection, 7:u00:866, 19:u03:Data-collection, 10:u08:0.9756, 19:u11:data-collection, 19:u02:Data-collection, -14:u07:Wavelength, 19:u10:data-collection, 19:u01:Data-collection, -14:u06:Wavelength, 10:u07:0.9756, -14:u14:wavelength, 19:u00:Data-collection, -14:u05:Wavelength, 10:u06:0.9756, -14:u13:wavelength, 10:u14:0.9756, -14:u04:Wavelength, 10:u05:0.9756, -14:u12:wavelength, 10:u13:0.9756, -14:u03:Wavelength, 10:u04:0.9756, 13:u08:Unit-cell, -14:u11:wavelength, 10:u12:0.9756, -14:u02:Wavelength, 10:u03:0.9756, -14:u10:wavelength, 10:u11:0.9756, -14:u01:Wavelength, 10:u02:0.9756, 13:u07:Unit-cell, 10:u10:0.9756, -14:u00:Wavelength, 10:u01:0.9756, 13:u06:Unit-cell, 13:u14:unit-cell, @@ -541437,7 +558370,6 @@ 8:u23:96.3, 8:u03:96.3, 8:u07:28.2, -8:u08:Bond, 9:u04:cryst, 8:u11:96.3, 8:u02:96.3, @@ -541449,21 +558381,18 @@ 8:u01:96.3, 8:u05:28.2, 10:u06:R.m.s., -8:u07:Bond, 9:u02:cryst, 8:u13:28.2, 10:u14:r.m.s., 8:u00:96.3, 8:u04:28.2, 10:u05:R.m.s., -8:u06:Bond, 9:u01:cryst, 8:u12:28.2, 10:u13:r.m.s., 8:u23:28.2, 8:u03:28.2, 10:u04:R.m.s., -8:u05:Bond, 9:u00:cryst, 8:u11:28.2, 10:u12:r.m.s., @@ -541471,23 +558400,18 @@ 8:u23:R.m., 8:u02:28.2, 10:u03:R.m.s., -8:u04:Bond, 12:u08:Twinning, 8:u10:28.2, 10:u11:r.m.s., 8:u01:28.2, 10:u02:R.m.s., -8:u03:Bond, 10:u10:r.m.s., 8:u00:28.2, 10:u01:R.m.s., -8:u02:Bond, 12:u07:Twinning, 10:u00:R.m.s., -8:u01:Bond, 12:u06:Twinning, 12:u14:twinning, -8:u00:Bond, 12:u05:Twinning, 14:u08:nontwinned, 12:u13:twinning, @@ -542857,17 +559781,14 @@ 9:u02:2004), 10:u05:r.m.s., 12:u10:henrick,, -10:uI2:....,-, 8:u00:cule, 12:u01:Henrick,, 15:u08:practically, 9:u01:2004), 10:u04:r.m.s., -10:uI1:....,-, 12:u00:Henrick,, 9:u00:2004), 10:u03:r.m.s., -10:uI0:....,-, 13:uI2:....(.).,, 15:u07:practically, 14:u08:segments)., @@ -544773,61 +561694,46 @@ 14:uI0:,..,..().., 19:uI2:..,,.,,.,.()..., 9:u01:1828., -7:u08:872, 8:u05:271,, 19:uI1:..,,.,,.,.()..., 9:u00:1828., 8:u04:271,, 9:u14:khim., 19:uI0:..,,.,,.,.()..., -7:u07:872, 12:u08:Roudiak,, 8:u03:271,, 9:u13:khim., -7:u06:872, 10:u08:11263., 8:u02:271,, 9:u12:khim., -7:u14:872, 7:u22:Khi, 8:u23:Khim, -7:u05:872, 12:u07:Roudiak,, 14:u08:Schlenker,, 8:u01:271,, 9:u11:khim., -7:u13:872, -7:u04:872, 12:u06:Roudiak,, 10:u07:11263., 14:u08:Sheldrick,, 8:u00:271,, 9:u10:khim., -7:u12:872, 12:u14:roudiak,, -7:u22:872, -7:u23:872, -7:u03:872, 12:u05:Roudiak,, 10:u06:11263., 14:u07:Schlenker,, 14:u08:Studemann,, -7:u11:872, 12:u13:roudiak,, 10:u14:11263., 16:uI2:,..,..().,,-, -7:u02:872, 12:u04:Roudiak,, 10:u05:11263., 14:u06:Schlenker,, 14:u07:Sheldrick,, -7:u10:872, 12:u12:roudiak,, 10:u13:11263., 14:u14:schlenker,, 8:u23:Roud, 16:uI1:,..,..().,,-, -7:u01:872, 12:u03:Roudiak,, 10:u04:11263., 14:u05:Schlenker,, @@ -544840,7 +561746,6 @@ 14:u14:sheldrick,, 8:u23:1126, 16:uI0:,..,..().,,-, -7:u00:872, 12:u02:Roudiak,, 10:u03:11263., 14:u04:Schlenker,, @@ -546202,13 +563107,11 @@ 7:u06:(ω, 14:u08:dot-dashed, 7:u14:(ω, -7:uI2:,//, 7:u05:(ω, 13:u08:FRACTIONS, 14:u07:dot-dashed, 10:u08:SIGNAL, 7:u13:(ω, -7:uI1:,//, 7:u04:(ω, 14:u06:dot-dashed, 10:u07:SIGNAL, @@ -546216,24 +563119,20 @@ 7:u21:(ω, 7:u22:(ω, 7:u23:(ω, -7:uI0:,//, 7:u03:(ω, 13:u07:FRACTIONS, 14:u05:dot-dashed, 10:u06:SIGNAL, 7:u11:(ω, -9:uI2:()-.., 7:u02:(ω, 13:u06:FRACTIONS, 14:u04:dot-dashed, 10:u05:SIGNAL, 7:u10:(ω, -9:uI1:()-.., 7:u01:(ω, 13:u05:FRACTIONS, 14:u03:dot-dashed, 10:u04:SIGNAL, -9:uI0:()-.., 7:u00:(ω, 13:u04:FRACTIONS, 14:u02:dot-dashed, @@ -546998,7 +563897,6 @@ 6:u04:BW, 10:u05:masses, 7:u06:PDG, -11:u08:barrier, 16:u11:breit-wigner, 13:u12:ativistic, 11:uI0:-(),()-, @@ -547009,7 +563907,6 @@ 6:u03:BW, 10:u04:masses, 7:u05:PDG, -11:u07:barrier, 16:u10:breit-wigner, 13:u11:ativistic, 16:u01:Breit-Wigner, @@ -547019,7 +563916,6 @@ 6:u02:BW, 10:u03:masses, 7:u04:PDG, -11:u06:barrier, 13:u10:ativistic, 15:u14:centrifugal, 16:u00:Breit-Wigner, @@ -547029,7 +563925,6 @@ 6:u01:BW, 10:u02:masses, 7:u03:PDG, -11:u05:barrier, 8:u08:damp, 15:u13:centrifugal, 13:u00:ativistic, @@ -547037,25 +563932,20 @@ 6:u00:BW, 10:u01:masses, 7:u02:PDG, -11:u04:barrier, 8:u07:damp, 15:u12:centrifugal, 15:u03:centrifugal, 10:u00:masses, 7:u01:PDG, -11:u03:barrier, 8:u06:damp, 15:u11:centrifugal, 15:u02:centrifugal, 7:u00:PDG, -11:u02:barrier, 8:u05:damp, 15:u10:centrifugal, 15:u01:centrifugal, -11:u01:barrier, 8:u04:damp, 15:u00:centrifugal, -11:u00:barrier, 8:u03:damp, 8:u02:damp, 8:u01:damp, @@ -547207,12 +564097,9 @@ 16:u06:Non-resonant, 16:u05:Non-resonant, 16:u04:Non-resonant, -8:uI2:.:(), 16:u03:Non-resonant, -8:uI1:.:(), 16:u02:Non-resonant, 17:u08:contribution;, -8:uI0:.:(), 16:u01:Non-resonant, 16:u00:Non-resonant, 17:u07:contribution;, @@ -547708,7 +564595,6 @@ 10:u10:91152;, 8:u11:nos., 19:u12:fg02-94er40823,, -6:u21:FG, 7:u22:FG0, 8:u23:FG02, 12:uI0:.--,--,-, @@ -548103,7 +564989,6 @@ 13:u06:Histology, 15:u08:endoplasmic, 7:u12:hbv, -13:u14:histology, 7:u22:HBV, 7:u23:HBV, 9:uI2::,//., @@ -548111,21 +564996,18 @@ 13:u05:Histology, 13:u08:reticulum, 7:u11:hbv, -13:u13:histology, 9:uI1::,//., 7:u02:HBV, 13:u04:Histology, 15:u07:endoplasmic, 13:u07:reticulum, 7:u10:hbv, -13:u12:histology, 9:uI0::,//., 7:u01:HBV, 13:u03:Histology, 15:u06:endoplasmic, 13:u06:reticulum, 10:u08:(CHOP), -13:u11:histology, 15:u14:endoplasmic, 7:u00:HBV, 13:u02:Histology, @@ -548133,7 +565015,6 @@ 13:u05:reticulum, 10:u07:(CHOP), 14:u08:transgenic, -13:u10:histology, 15:u13:endoplasmic, 13:u01:Histology, 15:u04:endoplasmic, @@ -548295,7 +565176,6 @@ 12:u04:adenomas, 7:u06:HBs, 12:u12:adenomas, -8:u23:aden, 9:uI1:()[,], 12:u03:adenomas, 7:u05:HBs, @@ -548505,7 +565385,6 @@ 9:uI0:[].-/, 11:u01:C57BL/6, 15:u03:background,, -11:u08:tumours, 14:u02:Transgenic, 11:u00:C57BL/6, 15:u02:background,, @@ -548513,40 +565392,32 @@ 14:u01:Transgenic, 15:u01:background,, 12:u06:[21,22]., -11:u07:tumours, 14:u00:Transgenic, 12:u14:[21,22]., 15:u00:background,, 12:u05:[21,22]., -11:u06:tumours, 14:u08:stimulates, 12:u13:[21,22]., 11:u14:tumours, 12:u04:[21,22]., -11:u05:tumours, 12:u12:[21,22]., 11:u13:tumours, 12:u03:[21,22]., -11:u04:tumours, 14:u07:stimulates, 12:u11:[21,22]., 11:u12:tumours, 12:u02:[21,22]., -11:u03:tumours, 14:u06:stimulates, 12:u10:[21,22]., 11:u11:tumours, 14:u14:stimulates, 12:u01:[21,22]., -11:u02:tumours, 14:u05:stimulates, 11:u10:tumours, 14:u13:stimulates, 12:u00:[21,22]., -11:u01:tumours, 14:u04:stimulates, 14:u12:stimulates, -11:u00:tumours, 14:u03:stimulates, 17:u08:up-regulation, 14:u11:stimulates, @@ -549372,7 +566243,6 @@ 16:u08:Interesting,, 11:u13:hbvtg/c, 24:u02:immunohistochemistry, -11:u08:lobular, 17:u08:CHOP-positive, 11:u12:hbvtg/c, 8:u23:HBVT, @@ -549383,50 +566253,36 @@ 14:u14:positively, 24:u00:immunohistochemistry, 16:u06:Interesting,, -11:u07:lobular, 17:u06:CHOP-positive, 11:u10:hbvtg/c, 14:u13:positively, 16:u14:interesting,, 16:u05:Interesting,, -11:u06:lobular, 17:u05:CHOP-positive, 14:u12:positively, 16:u13:interesting,, -11:u14:lobular, 16:u04:Interesting,, -11:u05:lobular, 17:u08:centrilobular, 17:u04:CHOP-positive, 14:u11:positively, 16:u12:interesting,, -11:u13:lobular, 16:u03:Interesting,, -11:u04:lobular, 17:u03:CHOP-positive, 14:u10:positively, 16:u11:interesting,, -11:u12:lobular, -8:u23:lobu, 16:u02:Interesting,, -11:u03:lobular, 17:u07:centrilobular, 17:u02:CHOP-positive, 16:u10:interesting,, -11:u11:lobular, 16:u01:Interesting,, -11:u02:lobular, 17:u06:centrilobular, 17:u01:CHOP-positive, -11:u10:lobular, 17:u14:centrilobular, 16:u00:Interesting,, -11:u01:lobular, 17:u05:centrilobular, 17:u00:CHOP-positive, 17:u13:centrilobular, 8:u14:blot, -11:u00:lobular, 17:u04:centrilobular, 9:u08:(CHOP, 17:u12:centrilobular, @@ -549635,34 +566491,25 @@ 7:u06:S1), 14:u08:[9,10,36]., 7:u05:S1), -16:u08:cytotoxicity, 7:u04:S1), -16:u07:cytotoxicity, 14:u07:[9,10,36]., 7:u03:S1), -16:u06:cytotoxicity, 14:u06:[9,10,36]., 7:u02:S1), -16:u05:cytotoxicity, 14:u14:[9,10,36]., 14:u05:[9,10,36]., 7:u01:S1), -16:u04:cytotoxicity, 14:u13:[9,10,36]., 14:u04:[9,10,36]., 7:u00:S1), -16:u03:cytotoxicity, 14:u12:[9,10,36]., 7:u22:[9,, 8:u23:[9,1, 14:u03:[9,10,36]., -16:u02:cytotoxicity, 14:u11:[9,10,36]., 14:u02:[9,10,36]., -16:u01:cytotoxicity, 14:u10:[9,10,36]., 14:u01:[9,10,36]., -16:u00:cytotoxicity, 9:u08:serum, 14:u00:[9,10,36]., 9:u07:serum, @@ -549858,7 +566705,6 @@ 9:u05:14.97, 8:u06:5.44, 13:u07:NM_007498, -14:u08:Activating, 13:u10:nm_019738, 9:u11:nupr1, 9:u13:14.97, @@ -549880,7 +566726,6 @@ 8:u04:5.44, 13:u05:NM_007498, 8:u06:Atf3, -14:u07:Activating, 9:u11:14.97, 8:u12:5.44, 13:u13:nm_007498, @@ -549891,25 +566736,21 @@ 8:u03:5.44, 13:u04:NM_007498, 8:u05:Atf3, -14:u06:Activating, 8:u07:9.53, 13:u08:NM_007837, 9:u10:14.97, 8:u11:5.44, 13:u12:nm_007498, 8:u13:atf3, -14:u14:activating, 9:u01:14.97, 8:u02:5.44, 13:u03:NM_007498, 8:u04:Atf3, -14:u05:Activating, 8:u06:9.53, 9:u08:Ddit3, 8:u10:5.44, 13:u11:nm_007498, 8:u12:atf3, -14:u13:activating, 8:u14:9.53, 7:u22:Atf, 8:u23:Atf3, @@ -549917,41 +566758,34 @@ 8:u01:5.44, 13:u02:NM_007498, 8:u03:Atf3, -14:u04:Activating, 8:u05:9.53, 13:u07:NM_007837, 14:u08:DNA-damage, 13:u10:nm_007498, 8:u11:atf3, -14:u12:activating, 8:u13:9.53, 8:u00:5.44, 13:u01:NM_007498, 8:u02:Atf3, -14:u03:Activating, 8:u04:9.53, 13:u06:NM_007837, 9:u07:Ddit3, 8:u08:6.39, 13:u08:inducible, 8:u10:atf3, -14:u11:activating, 8:u12:9.53, 13:u14:nm_007837, 8:u23:9.53, 13:u00:NM_007498, 8:u01:Atf3, -14:u02:Activating, 8:u03:9.53, 13:u05:NM_007837, 9:u06:Ddit3, 14:u07:DNA-damage, 13:u07:inducible, -14:u10:activating, 8:u11:9.53, 13:u13:nm_007837, 8:u00:Atf3, -14:u01:Activating, 8:u02:9.53, 13:u04:NM_007837, 9:u05:Ddit3, @@ -549962,7 +566796,6 @@ 8:u10:9.53, 13:u12:nm_007837, 14:u14:dna-damage, -14:u00:Activating, 8:u01:9.53, 13:u03:NM_007837, 9:u04:Ddit3, @@ -550561,7 +567394,6 @@ 12:u07:oncogene, 9:u11:21.67, 13:u13:nm_010591, -7:u14:jun, 11:u00:Gadd45g, 9:u02:21.67, 13:u04:NM_010591, @@ -550570,7 +567402,6 @@ 12:u06:oncogene, 9:u10:21.67, 13:u12:nm_010591, -7:u13:jun, 9:u01:21.67, 13:u03:NM_010591, 7:u04:Jun, @@ -550578,7 +567409,6 @@ 9:u08:Gsta2, 12:u05:oncogene, 13:u11:nm_010591, -7:u12:jun, 7:u23:Jun, 9:u00:21.67, 13:u02:NM_010591, @@ -550587,7 +567417,6 @@ 13:u07:NM_008182, 12:u04:oncogene, 13:u10:nm_010591, -7:u11:jun, 8:u14:2.30, 13:u01:NM_010591, 7:u02:Jun, @@ -550597,7 +567426,6 @@ 8:u08:3.20, 12:u03:oncogene, 18:u08:S-transferase,, -7:u10:jun, 8:u13:2.30, 13:u14:nm_008182, 13:u00:NM_010591, @@ -550910,24 +567738,20 @@ 11:u01:Krt1-18, 41:u05:doi:10.1371/journal.pone.0090608.t001, 41:u08:doi:10.1371/journal.pone.0090608.g002, -17:u08:magnification, 41:u13:doi:10.1371/journal.pone.0090608.t001, 11:u00:Krt1-18, 41:u04:doi:10.1371/journal.pone.0090608.t001, -17:u07:magnification, 41:u12:doi:10.1371/journal.pone.0090608.t001, 12:u14:embedded, 9:uI2:.//.-, 41:u03:doi:10.1371/journal.pone.0090608.t001, 41:u07:doi:10.1371/journal.pone.0090608.g002, -17:u06:magnification, 41:u11:doi:10.1371/journal.pone.0090608.t001, 12:u13:embedded, 9:uI1:.//.-, 19:uI2:-,-,---/()-().-, 41:u02:doi:10.1371/journal.pone.0090608.t001, 41:u06:doi:10.1371/journal.pone.0090608.g002, -17:u05:magnification, 41:u10:doi:10.1371/journal.pone.0090608.t001, 12:u12:embedded, 41:u14:doi:10.1371/journal.pone.0090608.g002, @@ -550937,27 +567761,22 @@ 15:uI2:,.-,.*-.#-., 41:u01:doi:10.1371/journal.pone.0090608.t001, 41:u05:doi:10.1371/journal.pone.0090608.g002, -17:u04:magnification, 12:u11:embedded, 41:u13:doi:10.1371/journal.pone.0090608.g002, 19:uI0:-,-,---/()-().-, 15:uI1:,.-,.*-.#-., 41:u00:doi:10.1371/journal.pone.0090608.t001, 41:u04:doi:10.1371/journal.pone.0090608.g002, -17:u03:magnification, 12:u10:embedded, 41:u12:doi:10.1371/journal.pone.0090608.g002, 15:uI0:,.-,.*-.#-., 41:u03:doi:10.1371/journal.pone.0090608.g002, -17:u02:magnification, 8:u08:UPR., 41:u11:doi:10.1371/journal.pone.0090608.g002, 41:u02:doi:10.1371/journal.pone.0090608.g002, -17:u01:magnification, 8:u07:UPR., 41:u10:doi:10.1371/journal.pone.0090608.g002, 41:u01:doi:10.1371/journal.pone.0090608.g002, -17:u00:magnification, 8:u06:UPR., 41:u00:doi:10.1371/journal.pone.0090608.g002, 9:u08:fatty, @@ -550996,25 +567815,11 @@ 11:u10:(nash),, 9:u00:fatty, 11:u01:(NASH),, -10:u08:tumour, 11:u00:(NASH),, -10:u07:tumour, -10:u06:tumour, -10:u14:tumour, -10:u05:tumour, -10:u13:tumour, -10:u04:tumour, -10:u12:tumour, -10:u03:tumour, 13:u08:feed-back, -10:u11:tumour, -10:u02:tumour, 14:u08:mechanism:, -10:u10:tumour, -10:u01:tumour, 13:u07:feed-back, 14:u07:mechanism:, -10:u00:tumour, 13:u06:feed-back, 14:u06:mechanism:, 13:u14:feed-back, @@ -551980,7 +568785,6 @@ 12:u06:Salguero, 8:u10:192., 21:u12:ikkbeta/nf-kappab, -6:u21:IK, 7:u22:IKK, 8:u23:IKKb, 8:u01:192., @@ -552477,7 +569281,6 @@ 11:u02:Frénod, 12:u10:emmanuel, 10:u13:projet, -7:u23:AND, 10:uI0:-,,,-,, 11:u00:MATHODS, 10:u04:Projet, @@ -552987,10 +569790,7 @@ 7:u10:ζ,, 7:u01:ζ,, 7:u00:ζ,, -7:uI2:)(,, -7:uI1:)(,, 9:uI2:)(,)-, -7:uI0:)(,, 9:uI1:)(,)-, 10:uI2:,(.)--, 9:uI0:)(,)-, @@ -556567,36 +573367,27 @@ 18:u03:modifications., 18:u11:modifications., 18:u02:modifications., -15:u08:Environment, 18:u10:modifications., 8:u14:ivee, 18:u01:modifications., 10:u08:(IVEE), 8:u13:ivee, 18:u00:modifications., -15:u07:Environment, 10:u07:(IVEE), 8:u12:ivee, 7:u22:IVE, 8:u23:IVEE, -15:u06:Environment, 10:u06:(IVEE), 8:u11:ivee, -15:u05:Environment, 10:u05:(IVEE), 8:u10:ivee, -15:u04:Environment, 10:u04:(IVEE), -15:u03:Environment, 10:u03:(IVEE), -15:u02:Environment, 10:u02:(IVEE), 16:u08:workstations, -15:u01:Environment, 17:u08:demonstration, 10:u01:(IVEE), 16:u07:workstations, -15:u00:Environment, 10:u00:(IVEE), 16:u06:workstations, 17:u07:demonstration, @@ -557139,27 +573930,22 @@ 10:u00:3-More, 9:u06:boxes, 7:u08:met, -9:u14:check, 9:u05:boxes, 7:u07:met, 11:u08:sliders, -9:u13:check, 15:u08:4-Attaching, 9:u04:boxes, 7:u06:met, 11:u07:sliders, -9:u12:check, 9:u03:boxes, 7:u05:met, 11:u06:sliders, 9:u08:Notes, -9:u11:check, 15:u07:4-Attaching, 9:u02:boxes, 7:u04:met, 11:u05:sliders, 9:u07:Notes, -9:u10:check, 15:u06:4-Attaching, 9:u01:boxes, 7:u03:met, @@ -557984,36 +574770,27 @@ 15:u02:subsystems., 15:u01:subsystems., 15:u00:subsystems., -12:u08:applied., 14:u08:activated,, -12:u07:applied., -12:u06:applied., 14:u07:activated,, 12:u14:applied., -12:u05:applied., 14:u06:activated,, 12:u13:applied., 14:u14:activated,, -12:u04:applied., 14:u05:activated,, 10:u08:state., 12:u12:applied., 14:u13:activated,, -12:u03:applied., 14:u04:activated,, 12:u11:applied., 14:u12:activated,, -12:u02:applied., 14:u03:activated,, 10:u07:state., 12:u10:applied., 14:u11:activated,, -12:u01:applied., 14:u02:activated,, 10:u06:state., 14:u10:activated,, 10:u14:state., -12:u00:applied., 14:u01:activated,, 10:u05:state., 10:u13:state., @@ -558349,21 +575126,16 @@ 6:u08:LN, 6:u07:LN, 6:u06:LN, -6:u14:ln, 6:u05:LN, -6:u13:ln, 21:uI2:,();;:::;;,;;:::;, 6:u04:LN, -6:u12:ln, 6:u21:LN, 6:u22:LN, 6:u23:LN, 21:uI1:,();;:::;;,;;:::;, 6:u03:LN, -6:u11:ln, 21:uI0:,();;:::;;,;;:::;, 6:u02:LN, -6:u10:ln, 6:u01:LN, 12:uI2:;;:::;.,, 6:u00:LN, @@ -561993,7 +578765,6 @@ 14:u04:Operations, 10:u07:Proofs, 9:u13:univ., -8:u23:Miss, 21:uI0:]..,..,.,....",,", 11:u03:Mission, 9:u04:Univ., @@ -563149,64 +579920,46 @@ 12:u02:'silent', 12:u01:'silent', 12:u00:'silent', -10:u08:harbor, 11:u08:'focal', -10:u07:harbor, 11:u07:'focal', 14:u08:instigates, -10:u06:harbor, 11:u06:'focal', 14:u07:instigates, 14:u08:repression, 10:u14:harbor, -10:u05:harbor, 11:u05:'focal', 14:u06:instigates, 14:u07:repression, 10:u13:harbor, -10:u04:harbor, 11:u04:'focal', 14:u05:instigates, 14:u06:repression, 10:u12:harbor, -10:u03:harbor, 11:u03:'focal', 14:u04:instigates, 14:u05:repression, 10:u11:harbor, -10:u02:harbor, 11:u02:'focal', 14:u03:instigates, 14:u04:repression, 10:u10:harbor, -10:u01:harbor, 11:u01:'focal', 14:u02:instigates, 14:u03:repression, -10:u00:harbor, 11:u00:'focal', 14:u01:instigates, 14:u02:repression, 14:u00:instigates, 14:u01:repression, -16:u08:whole-genome, 14:u00:repression, -16:u07:whole-genome, -16:u06:whole-genome, -16:u05:whole-genome, 7:u08:to,, -16:u04:whole-genome, 7:u07:to,, -16:u03:whole-genome, 7:u06:to,, -16:u02:whole-genome, 7:u05:to,, 14:u14:methylomes, 8:u08:CpGs, -16:u01:whole-genome, 7:u04:to,, 14:u13:methylomes, -16:u00:whole-genome, 7:u03:to,, 14:u12:methylomes, 8:u07:CpGs, @@ -563425,7 +580178,6 @@ 17:u14:hypervariable, 23:u02:clinicopathological, 17:u05:hypervariable, -11:u08:tumors,, 16:u00:(p=6.8e-07)., 15:u01:(p=1.9e-06,, 12:u02:feature., @@ -563440,31 +580192,26 @@ 23:u00:clinicopathological, 17:u03:hypervariable, 12:u06:access)., -11:u07:tumors,, 12:u00:feature., 17:u11:hypervariable, 12:u14:access)., 17:u02:hypervariable, 12:u05:access)., -11:u06:tumors,, 7:u08:PMD, 17:u10:hypervariable, 12:u13:access)., 11:u14:tumors,, 17:u01:hypervariable, 12:u04:access)., -11:u05:tumors,, 12:u12:access)., 11:u13:tumors,, 17:u00:hypervariable, 12:u03:access)., -11:u04:tumors,, 7:u07:PMD, 9:u08:(2%),, 12:u11:access)., 11:u12:tumors,, 12:u02:access)., -11:u03:tumors,, 7:u06:PMD, 9:u07:(2%),, 9:u08:70.2%, @@ -563473,7 +580220,6 @@ 7:u14:pmd, 11:uI2:(.).''., 12:u01:access)., -11:u02:tumors,, 7:u05:PMD, 9:u06:(2%),, 9:u07:70.2%, @@ -563481,7 +580227,6 @@ 7:u13:pmd, 11:uI1:(.).''., 12:u00:access)., -11:u01:tumors,, 7:u04:PMD, 10:u08:skewed, 9:u05:(2%),, @@ -563489,7 +580234,6 @@ 7:u12:pmd, 7:u23:PMD, 11:uI0:(.).''., -11:u00:tumors,, 7:u03:PMD, 8:u08:25%), 9:u04:(2%),, @@ -563664,29 +580408,24 @@ 18:u05:translocations, 20:u07:(substitutions);, 18:u13:translocations, -11:u14:genomes, 10:uI0:(.-,),, 18:u04:translocations, 20:u06:(substitutions);, 18:u12:translocations, -11:u13:genomes, 20:u14:(substitutions);, 18:u03:translocations, 20:u05:(substitutions);, 18:u11:translocations, -11:u12:genomes, 20:u13:(substitutions);, 21:uI2:();.(),.-(),.-(),, 18:u02:translocations, 20:u04:(substitutions);, 18:u10:translocations, -11:u11:genomes, 20:u12:(substitutions);, 21:uI1:();.(),.-(),.-(),, 10:uI2:,..).,, 18:u01:translocations, 20:u03:(substitutions);, -11:u10:genomes, 20:u11:(substitutions);, 21:uI0:();.(),.-(),.-(),, 10:uI1:,..).,, @@ -563809,7 +580548,6 @@ 10:u07:rectum, 14:u08:urothelial, 11:u06:(LUAD),, -16:u08:glioblastoma, 10:u06:rectum, 14:u07:urothelial, 9:u08:(BL),, @@ -563821,7 +580559,6 @@ 10:u08:(GBM),, 11:u13:(luad),, 11:u04:(LUAD),, -16:u07:glioblastoma, 10:u04:rectum, 14:u05:urothelial, 9:u06:(BL),, @@ -563830,56 +580567,44 @@ 7:u22:(LU, 8:u23:(LUA, 11:u03:(LUAD),, -16:u06:glioblastoma, 10:u03:rectum, 14:u04:urothelial, 9:u05:(BL),, 10:u06:(GBM),, 11:u11:(luad),, -16:u14:glioblastoma, 11:u02:(LUAD),, -16:u05:glioblastoma, 10:u02:rectum, 14:u03:urothelial, 9:u04:(BL),, 10:u05:(GBM),, 11:u10:(luad),, -16:u13:glioblastoma, 10:uI2:(),-.,, 11:u01:(LUAD),, -16:u04:glioblastoma, 10:u01:rectum, 14:u02:urothelial, 9:u03:(BL),, 10:u04:(GBM),, -16:u12:glioblastoma, 10:uI1:(),-.,, 11:u00:(LUAD),, -16:u03:glioblastoma, 15:u08:(p=4.5e-12,, 10:u00:rectum, 14:u01:urothelial, 9:u02:(BL),, 10:u03:(GBM),, 16:u08:CGI-promoter, -16:u11:glioblastoma, 10:uI0:(),-.,, -16:u02:glioblastoma, 14:u00:urothelial, 9:u01:(BL),, 10:u02:(GBM),, 16:u07:CGI-promoter, 12:u08:t-test),, -16:u10:glioblastoma, 14:u14:repression, -16:u01:glioblastoma, 15:u07:(p=4.5e-12,, 9:u00:(BL),, 10:u01:(GBM),, 16:u06:CGI-promoter, 12:u07:t-test),, 14:u13:repression, -16:u00:glioblastoma, 15:u06:(p=4.5e-12,, 10:u00:(GBM),, 16:u05:CGI-promoter, @@ -564271,13 +580996,11 @@ 11:u07:tumors., 7:u02:CGI, 13:u07:Possibly,, -14:u08:multiforme, 27:u14:adenocarcinoma/squamous, 27:u05:adenocarcinoma/squamous, 11:u06:tumors., 7:u01:CGI, 13:u06:Possibly,, -14:u07:multiforme, 27:u13:adenocarcinoma/squamous, 11:u14:tumors., 8:uI2:/(/), @@ -564285,40 +581008,33 @@ 11:u05:tumors., 7:u00:CGI, 13:u05:Possibly,, -14:u06:multiforme, 27:u12:adenocarcinoma/squamous, 11:u13:tumors., 8:uI1:/(/), 27:u03:adenocarcinoma/squamous, 11:u04:tumors., 13:u04:Possibly,, -14:u05:multiforme, 27:u11:adenocarcinoma/squamous, 11:u12:tumors., 8:uI0:/(/), 27:u02:adenocarcinoma/squamous, 11:u03:tumors., 13:u03:Possibly,, -14:u04:multiforme, 27:u10:adenocarcinoma/squamous, 11:u11:tumors., 27:u01:adenocarcinoma/squamous, 11:u02:tumors., 13:u08:profiles., 13:u02:Possibly,, -14:u03:multiforme, 11:u10:tumors., 27:u00:adenocarcinoma/squamous, 11:u01:tumors., 13:u01:Possibly,, -14:u02:multiforme, 11:u00:tumors., 13:u07:profiles., 13:u00:Possibly,, -14:u01:multiforme, 13:u06:profiles., 20:u08:tissue-of-origin, -14:u00:multiforme, 13:u14:profiles., 13:u05:profiles., 13:u13:profiles., @@ -564598,8 +581314,6 @@ 14:u00:Clustering, 12:u06:overlaps, 12:u14:overlaps, -7:u22:Tum, -8:u23:Tumo, 12:u05:overlaps, 12:u13:overlaps, 12:u04:overlaps, @@ -564691,20 +581405,15 @@ 8:u00:>30%, 15:u00:methylated), 15:u08:Community's, -11:u08:Somatic, -11:u07:Somatic, 15:u07:Community's, 19:u08:077012/Z/05/Z)., -11:u06:Somatic, 11:u08:242006;, 15:u06:Community's, 11:u08:OSBREAC, -11:u05:Somatic, 11:u07:242006;, 15:u14:community's, 15:u05:Community's, 19:u07:077012/Z/05/Z)., -11:u04:Somatic, 11:u06:242006;, 15:u08:consortium,, 15:u13:community's, @@ -564713,7 +581422,6 @@ 19:u06:077012/Z/05/Z)., 11:u07:OSBREAC, 13:u08:Icelandic, -11:u03:Somatic, 11:u05:242006;, 15:u07:consortium,, 15:u12:community's, @@ -564724,7 +581432,6 @@ 19:u05:077012/Z/05/Z)., 11:u06:OSBREAC, 8:u08:ECMC, -11:u02:Somatic, 11:u04:242006;, 15:u06:consortium,, 15:u11:community's, @@ -564738,7 +581445,6 @@ 11:u05:OSBREAC, 13:u07:Icelandic, 15:u08:Hospitals),, -11:u01:Somatic, 11:u03:242006;, 15:u05:consortium,, 11:u08:(King's, @@ -564754,7 +581460,6 @@ 11:u04:OSBREAC, 13:u06:Icelandic, 8:u07:ECMC, -11:u00:Somatic, 11:u02:242006;, 15:u04:consortium,, 11:u07:(King's, @@ -565556,68 +582261,47 @@ 15:u05:Nik-Zainal,, 15:u07:Morganella,, 13:uI1:(,..),()., -10:uI2:.-,..-, -14:u08:mutational, 15:u04:Nik-Zainal,, 15:u06:Morganella,, 9:u08:Smid,, 13:uI0:(,..),()., -10:uI1:.-,..-, 15:u03:Nik-Zainal,, 15:u05:Morganella,, 9:u07:Smid,, -14:u08:signatures, -10:uI0:.-,..-, -14:u07:mutational, 15:u02:Nik-Zainal,, 15:u04:Morganella,, 9:u06:Smid,, -14:u07:signatures, 11:u08:Guelen,, -14:u06:mutational, 15:u01:Nik-Zainal,, 15:u03:Morganella,, 9:u05:Smid,, -14:u06:signatures, 11:u07:Guelen,, 10:u08:lamina, 14:u14:mutational, -14:u05:mutational, 15:u00:Nik-Zainal,, 15:u02:Morganella,, 9:u04:Smid,, -14:u05:signatures, 11:u06:Guelen,, 10:u07:lamina, 14:u13:mutational, -14:u04:mutational, 15:u01:Morganella,, 9:u03:Smid,, -14:u04:signatures, 11:u05:Guelen,, 10:u06:lamina, 14:u12:mutational, -14:u03:mutational, 15:u00:Morganella,, 9:u02:Smid,, -14:u03:signatures, 11:u04:Guelen,, 10:u05:lamina, 14:u11:mutational, -14:u02:mutational, 9:u01:Smid,, -14:u02:signatures, 11:u03:Guelen,, 10:u04:lamina, 14:u10:mutational, -14:u01:mutational, 9:u00:Smid,, -14:u01:signatures, 11:u02:Guelen,, 10:u03:lamina, -14:u00:mutational, 11:u08:Genome., -14:u00:signatures, 11:u01:Guelen,, 10:u02:lamina, 11:u08:Sexton,, @@ -565742,7 +582426,6 @@ 11:u07:Conway,, 14:u08:subclasses, 13:u12:8681-8686, -15:u14:metastasis., 8:u23:8681, 10:uI0:.,...,, 11:u00:Folding, @@ -565753,7 +582436,6 @@ 11:u06:Conway,, 14:u07:subclasses, 13:u11:8681-8686, -15:u13:metastasis., 13:u02:8681-8686, 15:u04:Metastasis., 11:u01:Toyota,, @@ -565762,7 +582444,6 @@ 14:u06:subclasses, 13:u08:Roessler,, 13:u10:8681-8686, -15:u12:metastasis., 13:u01:8681-8686, 15:u03:Metastasis., 11:u00:Toyota,, @@ -565770,7 +582451,6 @@ 11:u04:Conway,, 14:u05:subclasses, 13:u07:Roessler,, -15:u11:metastasis., 13:u00:8681-8686, 15:u02:Metastasis., 9:u01:Fang,, @@ -565778,7 +582458,6 @@ 14:u04:subclasses, 13:u06:Roessler,, 13:u08:Kretzmer,, -15:u10:metastasis., 15:u01:Metastasis., 12:u08:genetics, 9:u00:Fang,, @@ -565802,41 +582481,34 @@ 14:u06:methylated, 7:u07:47,, 14:u08:Noushmehr,, -12:u06:genetics, 14:u00:subclasses, 13:u02:Roessler,, 13:u04:Kretzmer,, 7:u06:47,, 14:u07:Noushmehr,, -12:u05:genetics, 13:u01:Roessler,, 13:u03:Kretzmer,, 7:u05:47,, 14:u06:Noushmehr,, -12:u04:genetics, 13:u00:Roessler,, 13:u02:Kretzmer,, 7:u04:47,, 14:u05:Noushmehr,, 13:u08:3108-3114, -12:u03:genetics, 13:u01:Kretzmer,, 7:u03:47,, 14:u04:Noushmehr,, 13:u07:3108-3114, 22:u08:Schuster-Böckler,, -12:u02:genetics, 13:u00:Kretzmer,, 7:u02:47,, 14:u03:Noushmehr,, 13:u06:3108-3114, 22:u07:Schuster-Böckler,, -12:u01:genetics, 7:u01:47,, 14:u02:Noushmehr,, 13:u05:3108-3114, 22:u06:Schuster-Böckler,, -12:u00:genetics, 7:u00:47,, 14:u01:Noushmehr,, 13:u04:3108-3114, @@ -565993,7 +582665,6 @@ 8:u02:543,, 12:u05:Raphael,, 9:u07:Ally,, -19:u14:adenocarcinoma., 19:u05:Adenocarcinoma., 14:u07:Carcinoma., 14:u08:Methylomes, @@ -566002,7 +582673,6 @@ 12:u04:Raphael,, 9:u06:Ally,, 11:u08:Habibi,, -19:u13:adenocarcinoma., 11:uI2:.,-.()., 19:u04:Adenocarcinoma., 14:u06:Carcinoma., @@ -566010,9 +582680,7 @@ 12:u03:Raphael,, 9:u05:Ally,, 11:u07:Habibi,, -19:u12:adenocarcinoma., 14:u14:carcinoma., -8:u23:Aden, 11:uI1:.,-.()., 19:u03:Adenocarcinoma., 14:u05:Carcinoma., @@ -566021,7 +582689,6 @@ 9:u04:Ally,, 11:u06:Habibi,, 7:u08:Le,, -19:u11:adenocarcinoma., 14:u13:carcinoma., 11:uI0:.,-.()., 19:u02:Adenocarcinoma., @@ -566031,7 +582698,6 @@ 9:u03:Ally,, 11:u05:Habibi,, 7:u07:Le,, -19:u10:adenocarcinoma., 14:u12:carcinoma., 8:u23:Carc, 19:u01:Adenocarcinoma., @@ -566083,76 +582749,58 @@ 16:uI0:.,.,,.,,.,.., 17:uI2:.,..,,..,..'', 15:u05:single-base, -7:u08:ATM, 7:u00:Le,, 11:u02:Burger,, 17:u06:Cribari-Neto,, 15:u13:single-base, 17:uI1:.,..,,..,..'', -11:uI2:-.,-()., 15:u04:single-base, 9:u08:EXPH5, 11:u01:Burger,, 17:u05:Cribari-Neto,, 15:u12:single-base, 17:uI0:.,..,,..,..'', -11:uI1:-.,-()., 13:uI2:.-,.,..,-, 15:u03:single-base, -7:u07:ATM, 7:u08:RDX, 11:u00:Burger,, 17:u04:Cribari-Neto,, 15:u11:single-base, -11:uI0:-.,-()., 13:uI1:.-,.,..,-, 15:u02:single-base, -7:u06:ATM, 9:u07:EXPH5, 17:u03:Cribari-Neto,, 15:u10:single-base, -7:u14:atm, 13:uI0:.-,.,..,-, 15:u01:single-base, -7:u05:ATM, 9:u06:EXPH5, 7:u07:RDX, 17:u02:Cribari-Neto,, -7:u13:atm, 9:u14:exph5, 15:u00:single-base, -7:u04:ATM, 9:u05:EXPH5, 7:u06:RDX, 8:u08:NPAT, 17:u01:Cribari-Neto,, -7:u12:atm, 9:u13:exph5, 7:u14:rdx, -7:u22:ATM, -7:u23:ATM, -7:u03:ATM, 9:u04:EXPH5, 7:u05:RDX, 12:u08:C11orf65, 17:u00:Cribari-Neto,, -7:u11:atm, 9:u12:exph5, 7:u13:rdx, 7:u22:EXP, 8:u23:EXPH, -7:u02:ATM, 9:u03:EXPH5, 7:u04:RDX, 8:u07:NPAT, 9:u08:DDX10, -7:u10:atm, 9:u11:exph5, 7:u12:rdx, 6:u21:RD, 7:u22:RDX, 7:u23:RDX, -7:u01:ATM, 9:u02:EXPH5, 7:u03:RDX, 8:u06:NPAT, @@ -566160,7 +582808,6 @@ 9:u10:exph5, 7:u11:rdx, 8:u14:npat, -7:u00:ATM, 9:u01:EXPH5, 7:u02:RDX, 8:u05:NPAT, @@ -566201,7 +582848,6 @@ 12:u11:c11orf65, 9:u12:ddx10, 11:u14:zc3h12c, -7:u22:DDX, 8:u23:DDX1, 8:u01:NPAT, 12:u02:C11orf65, @@ -566241,7 +582887,6 @@ 10:u12:kdelc2, 12:u13:c11orf87, 7:u14:cgi, -6:u21:KD, 7:u22:KDE, 8:u23:KDEL, 11:u01:ZC3H12C, @@ -566288,7 +582933,6 @@ 9:u08:DOCK1, 9:u11:chr11, 9:u12:chr10, -7:u14:nps, 9:u02:chr11, 9:u03:chr10, 7:u05:NPS, @@ -566297,7 +582941,6 @@ 9:u08:PTPRE, 9:u10:chr11, 9:u11:chr10, -7:u13:nps, 11:u14:fam196a, 9:u01:chr11, 9:u02:chr10, @@ -566306,7 +582949,6 @@ 9:u06:MKI67, 9:u07:DOCK1, 9:u10:chr10, -7:u12:nps, 11:u13:fam196a, 9:u14:mki67, 7:u22:NPS, @@ -566318,7 +582960,6 @@ 9:u05:MKI67, 9:u06:DOCK1, 9:u07:PTPRE, -7:u11:nps, 11:u12:fam196a, 9:u13:mki67, 9:u14:dock1, @@ -566329,7 +582970,6 @@ 9:u05:DOCK1, 9:u06:PTPRE, 8:u08:MGMT, -7:u10:nps, 11:u11:fam196a, 9:u12:mki67, 9:u13:dock1, @@ -567410,7 +584050,6 @@ 8:u06:HMEC, 9:u07:IMR90, 8:u05:Tig3, -8:u08:CTCF, 15:u12:(z−score), 11:u13:laminb1, 8:u14:hmec, @@ -567421,7 +584060,6 @@ 8:u05:HMEC, 9:u06:IMR90, 8:u04:Tig3, -8:u07:CTCF, 15:u11:(z−score), 11:u12:laminb1, 8:u13:hmec, @@ -567432,7 +584070,6 @@ 8:u04:HMEC, 9:u05:IMR90, 8:u03:Tig3, -8:u06:CTCF, 15:u10:(z−score), 11:u11:laminb1, 8:u12:hmec, @@ -567444,7 +584081,6 @@ 8:u03:HMEC, 9:u04:IMR90, 8:u02:Tig3, -8:u05:CTCF, 11:u10:laminb1, 8:u11:hmec, 9:u12:imr90, @@ -567456,7 +584092,6 @@ 8:u02:HMEC, 9:u03:IMR90, 8:u01:Tig3, -8:u04:CTCF, 8:u10:hmec, 9:u11:imr90, 8:u13:mcf7, @@ -567464,18 +584099,14 @@ 8:u01:HMEC, 9:u02:IMR90, 8:u00:Tig3, -8:u03:CTCF, 9:u10:imr90, 8:u12:mcf7, 8:u23:MCF7, 8:u00:HMEC, 9:u01:IMR90, -8:u02:CTCF, 8:u11:mcf7, 9:u00:IMR90, -8:u01:CTCF, 8:u10:mcf7, -8:u00:CTCF, 52:uI2:••••••••••••••••, 52:uI1:••••••••••••••••, 52:uI0:••••••••••••••••, @@ -567719,8 +584350,6 @@ 9:u12:gnrh1, 8:u13:nefm, 12:u14:nkx2−6, -7:u22:GNR, -8:u23:GNRH, 9:u03:GNRH1, 8:u04:NEFM, 12:u05:NKX2−6, @@ -568155,7 +584784,6 @@ 7:u12:gbm, 8:u13:luad, 8:u14:lusc, -7:u22:GBM, 7:u23:GBM, 8:u01:BLCA, 7:u03:GBM, @@ -568416,26 +585044,22 @@ 11:u05:stomach, 13:u06:Burkitt's, 14:u08:follicular, -12:u08:squamous, 11:u13:stomach, 13:u14:burkitt's, 11:u04:stomach, 13:u05:Burkitt's, -12:u07:squamous, 11:u12:stomach, 13:u13:burkitt's, 8:uI2:'(.), 11:u03:stomach, 13:u04:Burkitt's, 14:u07:follicular, -12:u06:squamous, 11:u11:stomach, 13:u12:burkitt's, 8:uI1:'(.), 11:u02:stomach, 13:u03:Burkitt's, 14:u06:follicular, -12:u05:squamous, 11:u10:stomach, 13:u11:burkitt's, 14:u14:follicular, @@ -568443,23 +585067,18 @@ 11:u01:stomach, 13:u02:Burkitt's, 14:u05:follicular, -12:u04:squamous, 13:u10:burkitt's, 14:u13:follicular, 11:u00:stomach, 13:u01:Burkitt's, 14:u04:follicular, -12:u03:squamous, 14:u12:follicular, 13:u00:Burkitt's, 14:u03:follicular, -12:u02:squamous, 14:u11:follicular, 14:u02:follicular, -12:u01:squamous, 14:u10:follicular, 14:u01:follicular, -12:u00:squamous, 14:u00:follicular, 8:u14:skin, 8:u13:skin, @@ -568477,8 +585096,6 @@ 13:u04:esophagus, 12:u08:pancreas, 13:u12:esophagus, -7:u22:eso, -8:u23:esop, 13:u03:esophagus, 9:u07:ovary, 13:u11:esophagus, @@ -568486,32 +585103,21 @@ 9:u06:ovary, 12:u07:pancreas, 13:u10:esophagus, -9:u14:ovary, 13:u01:esophagus, 9:u05:ovary, 12:u06:pancreas, -9:u13:ovary, -12:u14:pancreas, 13:u00:esophagus, 9:u04:ovary, 12:u05:pancreas, -9:u12:ovary, -12:u13:pancreas, 9:u03:ovary, 12:u04:pancreas, 13:u08:intestine, -9:u11:ovary, -12:u12:pancreas, -8:u23:panc, 9:u02:ovary, 12:u03:pancreas, 10:u08:spleen, -9:u10:ovary, -12:u11:pancreas, 9:u01:ovary, 12:u02:pancreas, 13:u07:intestine, -12:u10:pancreas, 9:u00:ovary, 12:u01:pancreas, 13:u06:intestine, @@ -568562,19 +585168,14 @@ 13:u07:bisulfite, 16:u06:Whole-genome, 13:u06:bisulfite, -16:u14:whole-genome, 16:u05:Whole-genome, 13:u05:bisulfite, -16:u13:whole-genome, 16:u04:Whole-genome, 13:u04:bisulfite, -16:u12:whole-genome, 16:u03:Whole-genome, 13:u03:bisulfite, -16:u11:whole-genome, 16:u02:Whole-genome, 13:u02:bisulfite, -16:u10:whole-genome, 6:u22:ER, 6:u23:ER, 16:u01:Whole-genome, @@ -568682,69 +585283,22 @@ 9:u10:uhrf2, 9:u01:UHRF2, 9:u00:UHRF2, -8:u08:IDH2, -8:u07:IDH2, -8:u06:IDH2, -8:u14:idh2, -8:u05:IDH2, -8:u13:idh2, -8:u04:IDH2, -8:u12:idh2, -7:u22:IDH, -8:u23:IDH2, -8:u03:IDH2, 8:u08:TET3, -8:u11:idh2, -8:u02:IDH2, -8:u10:idh2, -8:u01:IDH2, 8:u07:TET3, -8:u00:IDH2, 8:u06:TET3, 8:u14:tet3, 8:u05:TET3, 8:u13:tet3, 8:u04:TET3, 8:u12:tet3, -7:u22:TET, 8:u23:TET3, 8:u03:TET3, 8:u11:tet3, 8:u02:TET3, 8:u10:tet3, 8:u01:TET3, -8:u08:IDH1, 8:u00:TET3, -8:u07:IDH1, -8:u06:IDH1, -8:u14:idh1, -8:u05:IDH1, -8:u13:idh1, -8:u04:IDH1, -8:u12:idh1, -8:u23:IDH1, -8:u03:IDH1, -8:u08:TET2, -8:u11:idh1, -8:u02:IDH1, -8:u10:idh1, -8:u01:IDH1, -8:u07:TET2, -8:u00:IDH1, -8:u06:TET2, -8:u14:tet2, -8:u05:TET2, -8:u13:tet2, -8:u04:TET2, -8:u12:tet2, -8:u23:TET2, -8:u03:TET2, -8:u11:tet2, -8:u02:TET2, 8:u08:TET1, -8:u10:tet2, -8:u01:TET2, -8:u00:TET2, 8:u07:TET1, 8:u06:TET1, 8:u14:tet1, @@ -568767,8 +585321,6 @@ 10:u13:dnmt3a, 10:u04:DNMT3A, 10:u12:dnmt3a, -7:u22:DNM, -8:u23:DNMT, 10:u03:DNMT3A, 10:u08:DNMT3L, 10:u11:dnmt3a, @@ -568784,26 +585336,12 @@ 10:u04:DNMT3L, 10:u12:dnmt3l, 10:u03:DNMT3L, -9:u08:DNMT1, 10:u11:dnmt3l, 10:u02:DNMT3L, 10:u10:dnmt3l, 10:u01:DNMT3L, -9:u07:DNMT1, 10:u00:DNMT3L, -9:u06:DNMT1, -9:u14:dnmt1, -9:u05:DNMT1, -9:u13:dnmt1, -9:u04:DNMT1, -9:u12:dnmt1, -9:u03:DNMT1, -9:u11:dnmt1, -9:u02:DNMT1, -9:u10:dnmt1, -9:u01:DNMT1, 10:u08:DNMT3B, -9:u00:DNMT1, 10:u07:DNMT3B, 10:u06:DNMT3B, 10:u14:dnmt3b, @@ -568939,7 +585477,6 @@ 9:u10:psoas, 11:u11:adrenal, 7:u12:fat, -14:u14:oesophagus, 7:u23:fat, 9:u01:psoas, 11:u02:adrenal, @@ -568948,7 +585485,6 @@ 11:u06:gastric, 11:u10:adrenal, 7:u11:fat, -14:u13:oesophagus, 11:u14:gastric, 9:u00:psoas, 11:u01:adrenal, @@ -568956,7 +585492,6 @@ 14:u04:oesophagus, 11:u05:gastric, 7:u10:fat, -14:u12:oesophagus, 11:u13:gastric, 6:u21:oe, 7:u22:oes, @@ -568965,12 +585500,10 @@ 7:u01:fat, 14:u03:oesophagus, 11:u04:gastric, -14:u11:oesophagus, 11:u12:gastric, 7:u00:fat, 14:u02:oesophagus, 11:u03:gastric, -14:u10:oesophagus, 11:u11:gastric, 14:u01:oesophagus, 11:u02:gastric, @@ -569138,47 +585671,20 @@ 6:u00:IK, 8:u08:FPKM, 8:u07:FPKM, -8:u08:EGFR, 8:u06:FPKM, 8:u14:fpkm, 8:u05:FPKM, -8:u07:EGFR, 8:u13:fpkm, 8:u04:FPKM, -8:u06:EGFR, 8:u12:fpkm, 7:u22:FPK, 8:u23:FPKM, 8:u03:FPKM, -8:u05:EGFR, 8:u11:fpkm, 8:u02:FPKM, -8:u04:EGFR, 8:u10:fpkm, -7:u22:EGF, -8:u23:EGFR, 8:u01:FPKM, -8:u03:EGFR, 8:u00:FPKM, -8:u02:EGFR, -8:u01:EGFR, -8:u00:EGFR, -8:u08:FAT1, -8:u07:FAT1, -8:u06:FAT1, -8:u14:fat1, -8:u05:FAT1, -8:u13:fat1, -8:u04:FAT1, -8:u12:fat1, -7:u22:FAT, -8:u23:FAT1, -8:u03:FAT1, -8:u11:fat1, -8:u02:FAT1, -8:u10:fat1, -8:u01:FAT1, -8:u00:FAT1, 8:u08:EBF1, 8:u07:EBF1, 8:u06:EBF1, @@ -569239,22 +585745,6 @@ 10:u00:−1.0, 10:u01:−0.5, 10:u00:−0.5, -10:u08:PDGFRA, -10:u07:PDGFRA, -10:u06:PDGFRA, -10:u14:pdgfra, -10:u05:PDGFRA, -10:u13:pdgfra, -10:u04:PDGFRA, -10:u12:pdgfra, -7:u22:PDG, -8:u23:PDGF, -10:u03:PDGFRA, -10:u11:pdgfra, -10:u02:PDGFRA, -10:u10:pdgfra, -10:u01:PDGFRA, -10:u00:PDGFRA, 9:u08:expr., 9:u07:expr., 9:u06:expr., @@ -569307,8 +585797,6 @@ 9:u10:klkb1, 10:u12:mtnr1a, 13:u13:f11−as1, -7:u22:MTN, -8:u23:MTNR, 7:u00:F11, 9:u01:KLKB1, 10:u03:MTNR1A, @@ -569395,7 +585883,6 @@ 8:u11:gsx2, 12:u12:rpl21p44, 13:u13:linc02283, -7:u22:RPL, 8:u23:RPL2, 9:u01:CHIC2, 8:u02:GSX2, @@ -569673,252 +586160,129 @@ 8:uI1:1352, 4060:uI0:••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••, 28:uI1:••••••••, -19:uI2:•••••, 8:uI0:1352, 28:uI0:••••••••, -19:uI1:•••••, 10:u08:BCORL1, -19:uI0:•••••, 10:u07:BCORL1, -9:u08:RBM10, 10:u06:BCORL1, -9:u08:MED12, 10:u14:bcorl1, 10:u05:BCORL1, -9:u07:RBM10, 10:u13:bcorl1, 10:u04:BCORL1, -9:u06:RBM10, -9:u07:MED12, -8:u08:BCOR, 10:u12:bcorl1, -9:u14:rbm10, -6:u21:BC, -7:u22:BCO, -8:u23:BCOR, 10:u03:BCORL1, -9:u05:RBM10, -9:u06:MED12, 8:u08:GPC3, 10:u11:bcorl1, -9:u13:rbm10, -9:u14:med12, 10:u02:BCORL1, -9:u04:RBM10, -9:u05:MED12, -8:u07:BCOR, 8:u08:IRF4, 10:u10:bcorl1, -9:u12:rbm10, -9:u13:med12, -8:u23:RBM1, 10:u01:BCORL1, -9:u03:RBM10, -9:u04:MED12, -8:u06:BCOR, 8:u07:GPC3, -9:u11:rbm10, -9:u12:med12, -8:u14:bcor, -8:u23:MED1, 10:u00:BCORL1, -9:u02:RBM10, -9:u03:MED12, -8:u05:BCOR, 8:u06:GPC3, 8:u07:IRF4, 9:u08:FOXO4, -9:u10:rbm10, -9:u11:med12, -8:u13:bcor, 8:u14:gpc3, -9:u01:RBM10, -9:u02:MED12, -8:u04:BCOR, 8:u05:GPC3, 8:u06:IRF4, 9:u08:IKZF1, -9:u10:med12, -8:u12:bcor, 8:u13:gpc3, 8:u14:irf4, -9:u00:RBM10, -9:u01:MED12, -8:u03:BCOR, 8:u04:GPC3, 8:u05:IRF4, 9:u07:FOXO4, -8:u08:FAT4, -9:u08:STAG2, -8:u11:bcor, 8:u12:gpc3, 8:u13:irf4, 7:u22:GPC, 8:u23:GPC3, -9:u00:MED12, -8:u02:BCOR, 8:u03:GPC3, 8:u04:IRF4, 9:u06:FOXO4, 9:u07:IKZF1, 9:u08:RPL10, -9:u07:STAG2, -8:u10:bcor, 8:u11:gpc3, 8:u12:irf4, 9:u14:foxo4, 7:u22:IRF, 8:u23:IRF4, -8:u01:BCOR, 8:u02:GPC3, 8:u03:IRF4, 9:u05:FOXO4, 9:u06:IKZF1, -8:u07:FAT4, -9:u06:STAG2, 8:u10:gpc3, 8:u11:irf4, 9:u13:foxo4, 9:u14:ikzf1, -8:u00:BCOR, 8:u01:GPC3, 8:u02:IRF4, 9:u04:FOXO4, 9:u05:IKZF1, -8:u06:FAT4, 9:u07:RPL10, -9:u08:PREX2, -9:u05:STAG2, 8:u10:irf4, 9:u12:foxo4, 9:u13:ikzf1, -8:u14:fat4, -8:u23:FOXO, 8:u00:GPC3, 8:u01:IRF4, 9:u03:FOXO4, 9:u04:IKZF1, -8:u05:FAT4, 9:u06:RPL10, -9:u04:STAG2, 9:u11:foxo4, 9:u12:ikzf1, -8:u13:fat4, 9:u14:rpl10, 7:u22:IKZ, 8:u23:IKZF, 8:u00:IRF4, 9:u02:FOXO4, 9:u03:IKZF1, -8:u04:FAT4, 9:u05:RPL10, -9:u07:PREX2, 8:u08:ELF4, -9:u03:STAG2, 9:u10:foxo4, 9:u11:ikzf1, -8:u12:fat4, 9:u13:rpl10, -8:u23:FAT4, 9:u01:FOXO4, 9:u02:IKZF1, -8:u03:FAT4, 9:u04:RPL10, -9:u06:PREX2, -9:u08:BCL9L, -9:u02:STAG2, 9:u10:ikzf1, -8:u11:fat4, 9:u12:rpl10, -9:u14:prex2, -8:u23:RPL1, 9:u00:FOXO4, 9:u01:IKZF1, -8:u02:FAT4, 9:u03:RPL10, -9:u05:PREX2, 8:u07:ELF4, -8:u08:ATRX, -9:u01:STAG2, -8:u10:fat4, 9:u11:rpl10, -9:u13:prex2, 9:u00:IKZF1, -8:u01:FAT4, 9:u02:RPL10, -9:u04:PREX2, 8:u06:ELF4, -9:u07:BCL9L, 8:u08:PHF6, -9:u00:STAG2, 9:u10:rpl10, -9:u12:prex2, 8:u14:elf4, -8:u23:PREX, -8:u00:FAT4, 9:u01:RPL10, -9:u03:PREX2, 8:u05:ELF4, -9:u06:BCL9L, -8:u07:ATRX, -9:u11:prex2, 8:u13:elf4, -9:u14:bcl9l, 9:u00:RPL10, -9:u02:PREX2, 8:u04:ELF4, -9:u05:BCL9L, -8:u06:ATRX, 8:u07:PHF6, -9:u10:prex2, 8:u12:elf4, -9:u13:bcl9l, -8:u14:atrx, 8:u23:ELF4, -9:u01:PREX2, 8:u03:ELF4, -9:u04:BCL9L, -8:u05:ATRX, 8:u06:PHF6, 8:u11:elf4, -9:u12:bcl9l, -8:u13:atrx, 8:u14:phf6, -7:u22:BCL, -8:u23:BCL9, -9:u00:PREX2, 8:u02:ELF4, -9:u03:BCL9L, -8:u04:ATRX, 8:u05:PHF6, 8:u10:elf4, -9:u11:bcl9l, -8:u12:atrx, 8:u13:phf6, -7:u22:ATR, -8:u23:ATRX, 8:u01:ELF4, -9:u02:BCL9L, -8:u03:ATRX, 8:u04:PHF6, -9:u10:bcl9l, -8:u11:atrx, 8:u12:phf6, 7:u22:PHF, 8:u23:PHF6, 8:u00:ELF4, -9:u01:BCL9L, -8:u02:ATRX, 8:u03:PHF6, 9:u08:meth., -8:u10:atrx, 8:u11:phf6, -9:u00:BCL9L, -8:u01:ATRX, 8:u02:PHF6, 9:u07:meth., 8:u10:phf6, -8:u00:ATRX, 8:u01:PHF6, 9:u06:meth., 8:u00:PHF6, @@ -570029,8 +586393,6 @@ 9:u12:ube4a, 9:u13:atp5l, 16:u14:loc100131626, -6:u21:UB, -7:u22:UBE, 8:u23:UBE4, 8:u02:CD3E, 9:u03:UBE4A, @@ -572770,7 +589132,6 @@ 9:u07:test,, 14:u00:difficult,, 8:u06:tine, -13:u08:patient's, 12:u00:delaying, 9:u06:test,, 12:u08:arteries, @@ -572783,57 +589144,44 @@ 8:u13:tine, 9:uI1:.-,,-, 8:u04:tine, -13:u07:patient's, 9:u04:test,, 12:u06:arteries, 8:u12:tine, 8:u23:tine, 9:uI0:.-,,-, 8:u03:tine, -13:u06:patient's, 11:u07:awfully, 9:u03:test,, 12:u05:arteries, 8:u11:tine, -13:u14:patient's, 8:u02:tine, -13:u05:patient's, 11:u06:awfully, 9:u02:test,, 12:u04:arteries, 8:u10:tine, -13:u13:patient's, 11:u14:awfully, 8:u01:tine, -13:u04:patient's, 11:u05:awfully, 9:u01:test,, 12:u03:arteries, -13:u12:patient's, 11:u13:awfully, 8:u00:tine, -13:u03:patient's, 11:u04:awfully, 10:u08:hanced, 9:u00:test,, 12:u02:arteries, -13:u11:patient's, 11:u12:awfully, 7:u22:awf, 8:u23:awfu, -13:u02:patient's, 11:u03:awfully, 12:u01:arteries, -13:u10:patient's, 11:u11:awfully, 7:u14:nor, -13:u01:patient's, 11:u02:awfully, 10:u07:hanced, 12:u00:arteries, 11:u10:awfully, 7:u13:nor, -13:u00:patient's, 11:u01:awfully, 10:u06:hanced, 12:u08:outcome., @@ -573672,43 +590020,34 @@ 14:u02:Successful, 10:u05:Holley, 16:u07:Anantharaman, -10:u08:Kidney, 20:u11:transplantation., 8:u23:Dial, 14:u01:Successful, 10:u04:Holley, 16:u06:Anantharaman, -10:u07:Kidney, 10:u08:Palmer, 20:u10:transplantation., 14:u00:Successful, 10:u03:Holley, 16:u05:Anantharaman, -10:u06:Kidney, 10:u07:Palmer, 10:u02:Holley, 16:u04:Anantharaman, -10:u05:Kidney, 10:u06:Palmer, 10:u01:Holley, 16:u03:Anantharaman, -10:u04:Kidney, 10:u05:Palmer, 10:u00:Holley, 16:u02:Anantharaman, -10:u03:Kidney, 10:u04:Palmer, 14:u08:[Pregnancy, 16:u01:Anantharaman, -10:u02:Kidney, 10:u03:Palmer, 11:u08:Moranne, 16:u00:Anantharaman, -10:u01:Kidney, 10:u02:Palmer, 11:u07:Moranne, 14:u07:[Pregnancy, -10:u00:Kidney, 10:u01:Palmer, 11:u06:Moranne, 9:u08:Malik, @@ -573757,28 +590096,23 @@ 9:u02:Malik, 11:u07:Giatras, 14:u12:physicians, -10:u14:kidney, 14:u00:[Pregnancy, 14:u03:Physicians, 13:u07:dialysis:, 9:u01:Malik, 11:u06:Giatras, 14:u11:physicians, -10:u13:kidney, 14:u02:Physicians, 13:u06:dialysis:, 24:u07:1998;13(12):3266-72., 9:u00:Malik, 11:u05:Giatras, 14:u10:physicians, -10:u12:kidney, 13:u14:dialysis:, -8:u23:Kidn, 14:u01:Physicians, 13:u05:dialysis:, 24:u06:1998;13(12):3266-72., 11:u04:Giatras, -10:u11:kidney, 13:u13:dialysis:, 24:u14:1998;13(12):3266-72., 14:u00:Physicians, @@ -573786,7 +590120,6 @@ 24:u05:1998;13(12):3266-72., 11:u03:Giatras, 11:u08:Vidaeff, -10:u10:kidney, 13:u12:dialysis:, 24:u13:1998;13(12):3266-72., 13:u03:dialysis:, @@ -574289,7 +590622,6 @@ 6:u11:pe, 6:u12:pg, 10:u14:pi-tp:, -6:u21:PG, 6:u22:PG, 6:u23:PG, 7:u00:PAP, @@ -574703,33 +591035,19 @@ 15:u00:deprivation, 12:u10:confined, 15:u08:trafficking, -13:u08:phosphate, 15:u07:trafficking, 15:u06:trafficking, -13:u07:phosphate, 15:u14:trafficking, 15:u05:trafficking, -13:u06:phosphate, 15:u13:trafficking, -13:u14:phosphate, 15:u04:trafficking, -13:u05:phosphate, 15:u12:trafficking, -13:u13:phosphate, 15:u03:trafficking, -13:u04:phosphate, 15:u11:trafficking, -13:u12:phosphate, 15:u02:trafficking, -13:u03:phosphate, 15:u10:trafficking, -13:u11:phosphate, 15:u01:trafficking, -13:u02:phosphate, -13:u10:phosphate, 15:u00:trafficking, -13:u01:phosphate, -13:u00:phosphate, 13:uI2:(..-;[]),, 13:uI1:(..-;[]),, 13:uI0:(..-;[]),, @@ -575452,13 +591770,8 @@ 9:u00:Golgi, 9:u01:COPII, 13:u01:machinery, -10:u14:plants, 9:u00:COPII, 13:u00:machinery, -10:u13:plants, -10:u12:plants, -10:u11:plants, -10:u10:plants, 12:u08:tissues,, 12:u07:tissues,, 14:u08:globulins., @@ -578366,7 +594679,6 @@ 12:uI2:[].,.,.., 18:u00:preferentially, 20:u06:2003;44:1185-91., -17:u08:decarboxylase, 16:u00:translocated, 19:u01:1991;266:89-97., 12:u02:Reichert, @@ -578382,48 +594694,36 @@ 20:u13:2003;44:1185-91., 12:uI0:[].,.,.., 20:u04:2003;44:1185-91., -17:u07:decarboxylase, 12:u00:Reichert, 9:u01:-role, 11:u02:Rontein, 20:u12:2003;44:1185-91., 20:u03:2003;44:1185-91., -17:u06:decarboxylase, 9:u00:-role, 11:u01:Rontein, 9:u08:Kunst, 20:u11:2003;44:1185-91., -17:u14:decarboxylase, 20:u02:2003;44:1185-91., -17:u05:decarboxylase, 11:u00:Rontein, 9:u07:Kunst, 18:u08:2003;42:51-80., 20:u10:2003;44:1185-91., -17:u13:decarboxylase, 20:u01:2003;44:1185-91., -17:u04:decarboxylase, 13:u08:acylation, 9:u06:Kunst, 18:u07:2003;42:51-80., 13:u08:Kjellberg, -17:u12:decarboxylase, 20:u00:2003;44:1185-91., -17:u03:decarboxylase, 16:u08:1485:100-10., 9:u05:Kunst, 18:u06:2003;42:51-80., 13:u07:Kjellberg, -17:u11:decarboxylase, 11:uI2:[].,..., -17:u02:decarboxylase, 13:u07:acylation, 9:u04:Kunst, 18:u05:2003;42:51-80., 13:u06:Kjellberg, -17:u10:decarboxylase, 11:uI1:[].,..., -17:u01:decarboxylase, 13:u06:acylation, 16:u07:1485:100-10., 9:u03:Kunst, @@ -578432,7 +594732,6 @@ 12:u08:Bessoule, 13:u14:acylation, 11:uI0:[].,..., -17:u00:decarboxylase, 13:u05:acylation, 16:u06:1485:100-10., 9:u02:Kunst, @@ -584228,24 +600527,15 @@ 12:u10:includes, 11:uI1:−..,., 15:u00:Subtraction, -8:u08:2.5%, 11:uI0:−..,., -8:u07:2.5%, 13:uI2:*−/-−, -8:u06:2.5%, 13:uI1:*−/-−, -8:u05:2.5%, 13:uI0:*−/-−, 11:uI2:.,(/),., -8:u04:2.5%, 11:uI1:.,(/),., -8:u03:2.5%, 11:uI0:.,(/),., -8:u02:2.5%, 9:uI2:.-−, -8:u01:2.5%, 9:uI1:.-−, -8:u00:2.5%, 9:uI0:.-−, 11:u08:sizable, 19:uI2:−−,−−,,, @@ -593025,33 +609315,24 @@ 88:u11:http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz, 18:uI0:://..../////.., 88:u02:http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz, -11:u08:lineage, 88:u10:http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz, 88:u01:http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz, 11:u08:gorilla, -11:u07:lineage, 88:u00:http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz, -11:u06:lineage, 11:u07:gorilla, -11:u05:lineage, 11:u06:gorilla, -11:u04:lineage, 11:u14:gorilla, 11:u05:gorilla, 70:u08:(http://hgdownload.cse.ucsc.edu/goldenPath/hg38/multiz20way/maf/),, -11:u03:lineage, 11:u13:gorilla, 11:u04:gorilla, -11:u02:lineage, 11:u12:gorilla, 11:u03:gorilla, 70:u07:(http://hgdownload.cse.ucsc.edu/goldenPath/hg38/multiz20way/maf/),, -11:u01:lineage, 11:u11:gorilla, 11:u02:gorilla, 70:u06:(http://hgdownload.cse.ucsc.edu/goldenPath/hg38/multiz20way/maf/),, 11:u08:ENSMBL,, -11:u00:lineage, 11:u10:gorilla, 70:u14:(http://hgdownload.cse.ucsc.edu/goldenpath/hg38/multiz20way/maf/),, 11:u01:gorilla, @@ -593602,7 +609883,6 @@ 10:u08:0.3092, 13:u12:1,000,000, 10:u14:(ewing, -8:u23:1,00, 13:u03:1,000,000, 10:u05:(Ewing, 8:u06:1.2e, @@ -594265,14 +610545,9 @@ 14:u02:positions., 16:u00:chromosomes., 14:u01:positions., -14:u14:signatures, 14:u00:positions., -14:u13:signatures, -14:u12:signatures, 10:uI2:""."-", -14:u11:signatures, 10:uI1:""."-", -14:u10:signatures, 10:uI0:""."-", 11:u08:GOWINDA, 11:u07:GOWINDA, @@ -594606,26 +610881,20 @@ 41:u00:dhoWEFpP8F3KoR8vJg0%3D&reserved=0, 13:uI2::,();,();, 7:u08:=10, -11:u08:Genomes, 13:uI1::,();,();, -11:u07:Genomes, 13:uI0::,();,();, 11:uI2:....-.-, 7:u07:=10, -11:u06:Genomes, 11:uI1:....-.-, 7:u06:=10, -11:u05:Genomes, 12:u08:(Genomes, 7:u14:=10, 11:uI0:....-.-, 7:u05:=10, 12:u08:polarise, -11:u04:Genomes, 12:u07:(Genomes, 7:u13:=10, 7:u04:=10, -11:u03:Genomes, 12:u06:(Genomes, 7:u12:=10, 6:u21:=1, @@ -594633,18 +610902,15 @@ 7:u23:=10, 7:u03:=10, 12:u07:polarise, -11:u02:Genomes, 12:u05:(Genomes, 7:u11:=10, 7:u02:=10, 12:u06:polarise, -11:u01:Genomes, 12:u04:(Genomes, 7:u10:=10, 12:u14:polarise, 7:u01:=10, 12:u05:polarise, -11:u00:Genomes, 12:u03:(Genomes, 12:u13:polarise, 7:u00:=10, @@ -594848,18 +611114,9 @@ 12:u10:values)., 12:u01:values)., 12:u00:values)., -9:u08:EPAS1, -9:u07:EPAS1, -9:u06:EPAS1, -9:u05:EPAS1, -9:u04:EPAS1, -9:u03:EPAS1, 11:uI2:(,,).-,, -9:u02:EPAS1, 11:uI1:(,,).-,, -9:u01:EPAS1, 11:uI0:(,,).-,, -9:u00:EPAS1, 10:u08:AB,CD., 10:u07:AB,CD., 10:u06:AB,CD., @@ -595232,11 +611489,6 @@ 13:u02:branches,, 13:u01:branches,, 13:u00:branches,, -11:u14:lineage, -11:u13:lineage, -11:u12:lineage, -11:u11:lineage, -11:u10:lineage, 17:u08:fineSTRUCTURE, 9:u08:Lange, 11:u08:(Lawson, @@ -596006,7 +612258,6 @@ 10:u04:Cagan,, 11:u05:Casals,, 17:u07:Charlesworth,, -10:u08:Cheng,, 15:u01:clustering., 9:u02:Frank, 12:u03:Delete-m, @@ -596039,7 +612290,6 @@ 11:u03:Casals,, 17:u05:Charlesworth,, 13:u06:Mutations, -10:u07:Cheng,, 9:u00:Frank, 12:u01:Delete-m, 11:u03:Ferran,, @@ -596052,7 +612302,6 @@ 11:u02:Casals,, 17:u04:Charlesworth,, 13:u05:Mutations, -10:u06:Cheng,, 11:u07:sweeps., 12:u00:Delete-m, 11:u02:Ferran,, @@ -596064,7 +612313,6 @@ 11:u01:Casals,, 17:u03:Charlesworth,, 13:u04:Mutations, -10:u05:Cheng,, 11:u06:sweeps., 11:u01:Ferran,, 17:u11:charlesworth,, @@ -596074,7 +612322,6 @@ 11:u00:Casals,, 17:u02:Charlesworth,, 13:u03:Mutations, -10:u04:Cheng,, 11:u05:sweeps., 11:u00:Ferran,, 17:u10:charlesworth,, @@ -596082,24 +612329,20 @@ 11:u13:sweeps., 17:u01:Charlesworth,, 13:u02:Mutations, -10:u03:Cheng,, 11:u04:sweeps., 10:u11:cheng,, 11:u12:sweeps., 12:uI2:,,,.,,.,, 17:u00:Charlesworth,, 13:u01:Mutations, -10:u02:Cheng,, 11:u03:sweeps., 10:u10:cheng,, 11:u11:sweeps., 12:uI1:,,,.,,.,, 13:u00:Mutations, -10:u01:Cheng,, 11:u02:sweeps., 11:u10:sweeps., 12:uI0:,,,.,,.,, -10:u00:Cheng,, 11:u01:sweeps., 11:u00:sweeps., 14:u08:437(7055),, @@ -597738,7 +613981,6 @@ 12:u00:Nonhoff,, 19:u06:Prado-Martinez,, 19:u07:Lorente-Galdos,, -14:u08:Pritchard,, 12:u01:Ataxin-2, 12:u02:P-Bodies, 10:u07:Belen,, @@ -597757,7 +613999,6 @@ 18:uI2:-,,,.,,.,,,,.,, 19:u04:Prado-Martinez,, 19:u05:Lorente-Galdos,, -14:u07:Pritchard,, 10:u08:20(4),, 12:u00:P-Bodies, 10:u05:Belen,, @@ -597769,7 +614010,6 @@ 16:uI2:-,,...-,.()., 19:u03:Prado-Martinez,, 19:u04:Lorente-Galdos,, -14:u06:Pritchard,, 15:u07:Adaptation:, 10:u04:Belen,, 8:u07:Hard, @@ -597782,7 +614022,6 @@ 16:uI1:-,,...-,.()., 19:u02:Prado-Martinez,, 19:u03:Lorente-Galdos,, -14:u05:Pritchard,, 15:u06:Adaptation:, 10:u07:20(4),, 10:u03:Belen,, @@ -597796,7 +614035,6 @@ 16:uI0:-,,...-,.()., 19:u01:Prado-Martinez,, 19:u02:Lorente-Galdos,, -14:u04:Pritchard,, 15:u05:Adaptation:, 10:u06:20(4),, 10:u02:Belen,, @@ -597811,7 +614049,6 @@ 9:uI2::,,.,, 19:u00:Prado-Martinez,, 19:u01:Lorente-Galdos,, -14:u03:Pritchard,, 15:u04:Adaptation:, 10:u05:20(4),, 10:u01:Belen,, @@ -597825,7 +614062,6 @@ 11:u14:racimo,, 9:uI1::,,.,, 19:u00:Lorente-Galdos,, -14:u02:Pritchard,, 15:u03:Adaptation:, 10:u04:20(4),, 10:u00:Belen,, @@ -597839,7 +614075,6 @@ 11:u13:racimo,, 8:u23:20(4, 9:uI0::,,.,, -14:u01:Pritchard,, 15:u02:Adaptation:, 10:u03:20(4),, 13:u08:admixture, @@ -597851,7 +614086,6 @@ 10:u11:20(4),, 11:u12:racimo,, 8:u23:Raci, -14:u00:Pritchard,, 15:u01:Adaptation:, 10:u02:20(4),, 8:u01:Hard, @@ -600275,33 +616509,24 @@ 13:u04:all-cause, 13:u11:stiffness, 13:u03:all-cause, -15:u08:alterations, 13:u10:stiffness, 13:u02:all-cause, -15:u07:alterations, 13:u08:overload,, 13:u01:all-cause, -15:u06:alterations, 13:u07:overload,, 21:u08:microinflammation, 13:u00:all-cause, -15:u05:alterations, 13:u06:overload,, 21:u07:microinflammation, -15:u04:alterations, 13:u05:overload,, 21:u06:microinflammation, -15:u03:alterations, 13:u04:overload,, 21:u05:microinflammation, -15:u02:alterations, 13:u03:overload,, 21:u04:microinflammation, -15:u01:alterations, 13:u02:overload,, 21:u03:microinflammation, 10:u14:artery, -15:u00:alterations, 13:u01:overload,, 21:u02:microinflammation, 10:u13:artery, @@ -600625,7 +616850,6 @@ 13:u03:(systolic, 11:u05:gm/dL),, 8:u07:>200, -10:u08:kidney, 8:u04:>110, 10:u07:pg/mL,, 9:u10:edema, @@ -600651,7 +616875,6 @@ 13:u01:(systolic, 11:u03:gm/dL),, 8:u05:>200, -10:u07:kidney, 8:u02:>110, 10:u05:pg/mL,, 11:u11:gm/dl),, @@ -600660,7 +616883,6 @@ 13:u00:(systolic, 11:u02:gm/dL),, 8:u04:>200, -10:u06:kidney, 8:u01:>110, 10:u04:pg/mL,, 11:u10:gm/dl),, @@ -600669,32 +616891,26 @@ 8:u23:>200, 11:u01:gm/dL),, 8:u03:>200, -10:u05:kidney, 9:u08:ents., 8:u00:>110, 10:u03:pg/mL,, 8:u11:>200, 11:u00:gm/dL),, 8:u02:>200, -10:u04:kidney, 10:u02:pg/mL,, 8:u10:>200, 7:u22:kid, 8:u23:kidn, 8:u01:>200, -10:u03:kidney, 9:u07:ents., 10:u01:pg/mL,, 8:u00:>200, -10:u02:kidney, 9:u06:ents., 10:u00:pg/mL,, 9:u14:ents., -10:u01:kidney, 9:u05:ents., 10:u08:B-mode, 9:u13:ents., -10:u00:kidney, 9:u04:ents., 10:u07:B-mode, 9:u12:ents., @@ -601677,7 +617893,6 @@ 14:u13:phosphorus, 16:u14:lipoprotein;, 9:uI1:-,-;,, -8:uI2:;,;,, 16:u05:lipoprotein;, 9:u07:D.-J., 8:u03:CRP,, @@ -601686,7 +617901,6 @@ 14:u12:phosphorus, 16:u13:lipoprotein;, 9:uI0:-,-;,, -8:uI1:;,;,, 16:u04:lipoprotein;, 9:u06:D.-J., 9:u08:9.0)., @@ -601696,7 +617910,6 @@ 14:u11:phosphorus, 16:u12:lipoprotein;, 9:u14:d.-j., -8:uI0:;,;,, 16:u03:lipoprotein;, 9:u05:D.-J., 8:u01:CRP,, @@ -603391,7 +619604,6 @@ 7:u12:ak;, 13:u13:sclerosis, 7:u14:40:, -6:u21:AK, 7:u22:AK;, 7:u23:AK;, 13:u01:ficiency., @@ -606596,7 +622808,6 @@ 8:u08:aire, 12:u11:d'après, 7:u12:xps, -6:u21:XP, 7:u22:XPS, 7:u23:XPS, 12:uI0:'','«.', @@ -609604,19 +625815,14 @@ 15:u07:attributed., 20:u00:student.gsu.edu., 15:u06:attributed., -12:u14:properly, 14:u08:eNeuro.org, 15:u05:attributed., -12:u13:properly, 15:u04:attributed., -12:u12:properly, 14:u07:eNeuro.org, 10:u08:mized,, 15:u03:attributed., -12:u11:properly, 14:u06:eNeuro.org, 15:u02:attributed., -12:u10:properly, 14:u14:eneuro.org, 10:uI2:/,()-., 14:u05:eNeuro.org, @@ -609658,7 +625864,6 @@ 8:u05:cage, 10:u06:rience, 10:u07:(GDX),, -10:u08:sexual, 9:u08:male., 8:u13:cage, 10:u14:rience, @@ -609673,7 +625878,6 @@ 8:u03:cage, 10:u04:rience, 10:u05:(GDX),, -10:u07:sexual, 9:u06:male., 8:u11:cage, 10:u12:rience, @@ -609682,7 +625886,6 @@ 8:u02:cage, 10:u03:rience, 10:u04:(GDX),, -10:u06:sexual, 8:u08:GDX,, 9:u05:male., 8:u10:cage, @@ -609694,7 +625897,6 @@ 8:u01:cage, 10:u02:rience, 10:u03:(GDX),, -10:u05:sexual, 9:u04:male., 10:u10:rience, 10:u11:(gdx),, @@ -609702,26 +625904,22 @@ 8:u00:cage, 10:u01:rience, 10:u02:(GDX),, -10:u04:sexual, 8:u07:GDX,, 9:u03:male., 10:u10:(gdx),, 10:u12:sexual, 10:u00:rience, 10:u01:(GDX),, -10:u03:sexual, 8:u06:GDX,, 9:u02:male., 10:u11:sexual, 8:u14:gdx,, 10:u00:(GDX),, -10:u02:sexual, 8:u05:GDX,, 9:u01:male., 12:u08:driven-,, 10:u10:sexual, 8:u13:gdx,, -10:u01:sexual, 8:u04:GDX,, 8:u08:2/1;, 9:u00:male., @@ -609729,7 +625927,6 @@ 8:u12:gdx,, 7:u22:GDX, 8:u23:GDX,, -10:u00:sexual, 8:u03:GDX,, 12:u06:driven-,, 8:u11:gdx,, @@ -610508,7 +626705,6 @@ 11:u05:estrous, 11:u06:(Maggio, 10:u07:Bogani, -17:u08:hybridization, 15:u00:copulatory,, 11:u04:estrus., 12:u12:havioral, @@ -610528,7 +626724,6 @@ 11:u03:estrous, 11:u04:(Maggio, 10:u05:Bogani, -17:u07:hybridization, 11:u02:estrus., 12:u10:havioral, 11:u11:estrous, @@ -610540,54 +626735,43 @@ 11:u02:estrous, 11:u03:(Maggio, 10:u04:Bogani, -17:u06:hybridization, 8:u08:USV,, 11:u01:estrus., 11:u10:estrous, 11:u11:(maggio, 10:u12:bogani, -17:u14:hybridization, 8:u23:Boga, 10:uI0:(,;,;-, 12:u00:havioral, 11:u01:estrous, 11:u02:(Maggio, 10:u03:Bogani, -17:u05:hybridization, 11:u00:estrus., 7:u08:UM,, 11:u10:(maggio, 10:u11:bogani, -17:u13:hybridization, 11:u00:estrous, 11:u01:(Maggio, 10:u02:Bogani, -17:u04:hybridization, 8:u07:USV,, 8:u08:kawa, 7:u07:UM,, 17:u08:three-chamber, 10:u10:bogani, -17:u12:hybridization, 11:u00:(Maggio, 10:u01:Bogani, -17:u03:hybridization, 8:u06:USV,, 15:u08:dimensions:, 7:u06:UM,, 17:u07:three-chamber, -17:u11:hybridization, 8:u14:usv,, 10:u00:Bogani, -17:u02:hybridization, 8:u05:USV,, 8:u07:kawa, 7:u05:UM,, 17:u06:three-chamber, 8:u08:20.3, -17:u10:hybridization, 8:u13:usv,, -17:u01:hybridization, 8:u04:USV,, 8:u06:kawa, 15:u07:dimensions:, @@ -610600,7 +626784,6 @@ 7:u22:USV, 8:u23:USV,, 9:uI2:-(,;-, -17:u00:hybridization, 8:u03:USV,, 8:u05:kawa, 15:u06:dimensions:, @@ -611073,7 +627256,6 @@ 11:u03:Tritech, 9:u04:1957;, 21:u07:RRID:SCR_003070)., -7:u08:(cm, 11:u11:nin-16;, 11:u12:(meyer,, 8:u23:(Mey, @@ -611085,7 +627267,6 @@ 11:u02:Tritech, 9:u03:1957;, 21:u06:RRID:SCR_003070)., -7:u07:(cm, 9:u08:Urine, 11:u10:nin-16;, 11:u11:(meyer,, @@ -611099,7 +627280,6 @@ 11:u01:Tritech, 9:u02:1957;, 21:u05:RRID:SCR_003070)., -7:u06:(cm, 9:u07:Urine, 11:u10:(meyer,, 9:u13:agej,, @@ -611111,7 +627291,6 @@ 11:u00:Tritech, 9:u01:1957;, 21:u04:RRID:SCR_003070)., -7:u05:(cm, 9:u06:Urine, 9:u12:agej,, 10:u14:arena., @@ -611123,7 +627302,6 @@ 14:u08:Copulatory, 9:u00:1957;, 21:u03:RRID:SCR_003070)., -7:u04:(cm, 9:u05:Urine, 10:u08:1987)., 9:u11:agej,, @@ -611133,7 +627311,6 @@ 11:u06:"pools", 8:u07:ins,, 21:u02:RRID:SCR_003070)., -7:u03:(cm, 9:u04:Urine, 10:u07:1987)., 9:u10:agej,, @@ -611146,7 +627323,6 @@ 8:u06:ins,, 14:u07:Copulatory, 21:u01:RRID:SCR_003070)., -7:u02:(cm, 9:u03:Urine, 10:u06:1987)., 10:u11:arena., @@ -611159,7 +627335,6 @@ 8:u05:ins,, 14:u06:Copulatory, 21:u00:RRID:SCR_003070)., -7:u01:(cm, 9:u02:Urine, 10:u05:1987)., 10:u10:arena., @@ -611172,7 +627347,6 @@ 11:u03:"pools", 8:u04:ins,, 14:u05:Copulatory, -7:u00:(cm, 9:u01:Urine, 10:u04:1987)., 11:u11:"pools", @@ -611804,34 +627978,28 @@ 7:u05:1ϫ, 11:u07:(normal, 10:u10:30-min, -7:u14:(20, 10:u01:30-min, 11:u08:(1:200,, 8:u00:g/ml, 7:u04:1ϫ, 11:u06:(normal, 8:u08:2-h,, -7:u13:(20, 10:u00:30-min, 7:u03:1ϫ, 11:u05:(normal, 8:u07:2-h,, 9:u08:Roche, -7:u12:(20, -7:u23:(20, 11:u07:(1:200,, 9:u08:Tween, 7:u02:1ϫ, 11:u04:(normal, 8:u06:2-h,, 9:u07:Roche, -7:u11:(20, 11:u06:(1:200,, 7:u01:1ϫ, 11:u03:(normal, 8:u05:2-h,, 9:u06:Roche, -7:u10:(20, 11:u14:(1:200,, 11:u05:(1:200,, 9:u07:Tween, @@ -612016,24 +628184,18 @@ 11:u11:spheres, 11:u02:spheres, 9:u05:(Rood, -14:u08:off-target, 11:u10:spheres, 11:u01:spheres, 9:u04:(Rood, -14:u07:off-target, 11:u00:spheres, 9:u03:(Rood, -14:u06:off-target, 8:uI2:(;)-, 9:u02:(Rood, -14:u05:off-target, 8:uI1:(;)-, 9:u08:Nissl, 9:u01:(Rood, -14:u04:off-target, 8:uI0:(;)-, 9:u00:(Rood, -14:u03:off-target, 9:u07:Nissl, 14:u02:off-target, 9:u06:Nissl, @@ -615026,17 +631188,12 @@ 7:u00:LS,, 12:u01:Panzica,, 13:u03:Koolhaas,, -15:u14:alterations, 12:u00:Panzica,, 13:u02:Koolhaas,, -15:u13:alterations, 11:u08:gation,, 13:u01:Koolhaas,, -15:u12:alterations, 13:u00:Koolhaas,, -15:u11:alterations, 11:u07:gation,, -15:u10:alterations, 11:u06:gation,, 11:u14:gation,, 11:u05:gation,, @@ -616355,14 +632512,12 @@ 11:u08:Crawley, 7:u04:JL,, 13:u06:81:37-44., -10:u08:cycle., 10:u12:connor, 11:u14:psychol, 10:u03:Connor, 12:u06:Coquelin, 7:u03:JL,, 13:u05:81:37-44., -10:u07:cycle., 6:u08:JN, 10:u11:connor, 11:u13:psychol, @@ -616372,7 +632527,6 @@ 11:u07:Crawley, 7:u02:JL,, 13:u04:81:37-44., -10:u06:cycle., 6:u07:JN, 10:u10:connor, 11:u12:psychol, @@ -616383,7 +632537,6 @@ 19:u08:rodevelopmental, 7:u01:JL,, 13:u03:81:37-44., -10:u05:cycle., 6:u06:JN, 11:u11:psychol, 12:u12:coquelin, @@ -616395,7 +632548,6 @@ 11:u05:Crawley, 7:u00:JL,, 13:u02:81:37-44., -10:u04:cycle., 6:u05:JN, 11:u10:psychol, 12:u11:coquelin, @@ -616404,7 +632556,6 @@ 11:u04:Crawley, 19:u07:rodevelopmental, 13:u01:81:37-44., -10:u03:cycle., 6:u04:JN, 12:u10:coquelin, 11:u12:crawley, @@ -616413,21 +632564,18 @@ 11:u03:Crawley, 19:u06:rodevelopmental, 13:u00:81:37-44., -10:u02:cycle., 6:u03:JN, 11:u11:crawley, 19:u14:rodevelopmental, 12:u00:Coquelin, 11:u02:Crawley, 19:u05:rodevelopmental, -10:u01:cycle., 6:u02:JN, 11:u10:crawley, 19:u13:rodevelopmental, 11:u01:Crawley, 19:u04:rodevelopmental, 10:u08:Darwin, -10:u00:cycle., 6:u01:JN, 19:u12:rodevelopmental, 11:u14:dantzer, @@ -617179,7 +633327,6 @@ 16:u11:vasopressin,, 15:u12:inserm/john, 14:u14:timmermans, -7:u22:INS, 8:u23:INSE, 14:uI0:,(,,),-./:, 16:u02:Vasopressin,, @@ -617615,7 +633762,6 @@ 12:u01:Maruniak, 12:u04:Matochik, 14:u05:androgenic, -11:u08:Biochem, 7:u01:JA,, 15:u03:37:655-657., 12:u12:matochik, @@ -617633,7 +633779,6 @@ 12:u02:Matochik, 14:u03:androgenic, 9:u06:Meyer, -11:u07:Biochem, 11:u08:Sakurai, 15:u01:37:655-657., 12:u10:matochik, @@ -617642,7 +633787,6 @@ 12:u01:Matochik, 14:u02:androgenic, 9:u05:Meyer, -11:u06:Biochem, 15:u00:37:655-657., 14:u10:androgenic, 9:u13:meyer, @@ -617650,21 +633794,18 @@ 12:u00:Matochik, 14:u01:androgenic, 9:u04:Meyer, -11:u05:Biochem, 11:u07:Sakurai, 9:u12:meyer, 11:u13:biochem, 9:u14:mieda, 14:u00:androgenic, 9:u03:Meyer, -11:u04:Biochem, 11:u06:Sakurai, 9:u11:meyer, 11:u12:biochem, 9:u13:mieda, 11:u14:sakurai, 9:u02:Meyer, -11:u03:Biochem, 11:u05:Sakurai, 9:u10:meyer, 11:u11:biochem, @@ -617673,18 +633814,15 @@ 7:u22:Mie, 8:u23:Mied, 9:u01:Meyer, -11:u02:Biochem, 11:u04:Sakurai, 11:u10:biochem, 9:u11:mieda, 11:u12:sakurai, 8:u23:Saku, 9:u00:Meyer, -11:u01:Biochem, 11:u03:Sakurai, 9:u10:mieda, 11:u11:sakurai, -11:u00:Biochem, 11:u02:Sakurai, 17:u08:Moncho-Bogani, 9:u08:-384., @@ -618206,7 +634344,6 @@ 15:u00:39:237-248., 9:u03:-705., 7:u04:BD,, -8:u08:Site, 10:u11:12:698, 9:u14:2474., 9:uI2:().:-, @@ -618215,7 +634352,6 @@ 18:u08:521:2321-2358., 9:u02:-705., 7:u03:BD,, -8:u07:Site, 10:u10:12:698, 9:u13:2474., 9:uI1:().:-, @@ -618223,7 +634359,6 @@ 9:u04:2474., 9:u01:-705., 7:u02:BD,, -8:u06:Site, 9:u12:2474., 8:u23:2474, 9:uI0:().:-, @@ -618232,37 +634367,31 @@ 18:u07:521:2321-2358., 9:u00:-705., 7:u01:BD,, -8:u05:Site, 7:u08:FI,, 9:u11:2474., 9:u02:2474., 18:u06:521:2321-2358., 7:u00:BD,, -8:u04:Site, 7:u07:FI,, 9:u10:2474., 18:u14:521:2321-2358., 9:u01:2474., 18:u05:521:2321-2358., -8:u03:Site, 7:u06:FI,, 18:u13:521:2321-2358., 9:u00:2474., 18:u04:521:2321-2358., 11:u08:Schultz, -8:u02:Site, 7:u05:FI,, 18:u12:521:2321-2358., 7:u22:521, 8:u23:521:, 18:u03:521:2321-2358., 11:u08:autism:, -8:u01:Site, 7:u04:FI,, 18:u11:521:2321-2358., 18:u02:521:2321-2358., 11:u07:Schultz, -8:u00:Site, 7:u03:FI,, 18:u10:521:2321-2358., 18:u01:521:2321-2358., @@ -619746,7 +635875,6 @@ 14:uI0:-:@..(..)., 8:u01:fax:, 13:u03:Student's, -12:u08:sumption, 15:u03:t-statistic, 13:u11:student's, 8:u00:fax:, @@ -619754,42 +635882,29 @@ 15:u02:t-statistic, 13:u10:student's, 13:u01:Student's, -12:u07:sumption, 12:u08:unequal., 15:u01:t-statistic, 13:u00:Student's, -12:u06:sumption, 15:u00:t-statistic, -12:u14:sumption, -12:u05:sumption, 12:u07:unequal., 8:u08:Reed, -12:u13:sumption, -12:u04:sumption, 12:u06:unequal., -12:u12:sumption, 12:u14:unequal., -12:u03:sumption, 12:u05:unequal., 8:u07:Reed, -12:u11:sumption, 12:u13:unequal., -12:u02:sumption, 12:u04:unequal., 8:u06:Reed, 24:u08:trimming/Winsorizing, -12:u10:sumption, 12:u12:unequal., 8:u14:reed, 8:u23:uneq, -12:u01:sumption, 12:u03:unequal., 8:u05:Reed, 15:u08:0169-2607/$, 24:u07:trimming/Winsorizing, 12:u11:unequal., 8:u13:reed, -12:u00:sumption, 12:u02:unequal., 8:u04:Reed, 34:u08:doi:10.1016/j.cmpb.2004.09.002, @@ -620967,16 +637082,10 @@ 8:u11:andn, 8:u02:andn, 8:u10:andn, -7:u14:133, 8:u01:andn, -7:u13:133, 8:u00:andn, -7:u12:133, -7:u23:133, 9:u08:min/p, -7:u11:133, 9:u07:min/p, -7:u10:133, 9:u06:min/p, 9:u05:min/p, 8:u08:3.00, @@ -621152,7 +637261,6 @@ 8:u14:6.12, 8:u02:7.35, 8:u05:6.12, -7:u08:60,, 8:u10:7.35, 8:u13:6.12, 8:u01:7.35, @@ -621162,39 +637270,24 @@ 8:u23:6.12, 8:u00:7.35, 8:u03:6.12, -7:u07:60,, 8:u11:6.12, 8:u02:6.12, -7:u06:60,, 8:u07:7.50, 8:u10:6.12, -7:u14:60,, 8:u01:6.12, -7:u05:60,, 8:u06:7.50, -7:u13:60,, 8:u14:7.50, 8:u00:6.12, -7:u04:60,, 8:u05:7.50, -7:u12:60,, 8:u13:7.50, -7:u22:60,, -7:u23:60,, -7:u03:60,, 8:u04:7.50, -7:u11:60,, 8:u12:7.50, 8:u23:7.50, -7:u02:60,, 8:u03:7.50, 9:u08:7.35., -7:u10:60,, 8:u11:7.50, -7:u01:60,, 8:u02:7.50, 8:u10:7.50, -7:u00:60,, 8:u01:7.50, 9:u07:7.35., 8:u00:7.50, @@ -621936,15 +638029,12 @@ 10:u01:large., 8:u07:6.44, 9:u11:mally, -8:uI2:.,/., 9:u02:mally, 10:u00:large., 8:u06:6.44, 9:u10:mally, -8:uI1:.,/., 9:u01:mally, 8:u05:6.44, -8:uI0:.,/., 9:u00:mally, 8:u04:6.44, 8:u03:6.44, @@ -625261,31 +641351,26 @@ 7:u01:F/T, 7:u00:F/T, 9:u08:(0.7,, -10:u08:0.0213, 9:u08:30.8), 9:u07:(0.7,, 9:u07:30.8), 9:u06:(0.7,, -10:u07:0.0213, 10:u08:(0.69,, 9:u06:30.8), 9:u14:(0.7,, 9:u05:(0.7,, -10:u06:0.0213, 10:u08:0.0668, 9:u05:30.8), 9:u08:18.2), 9:u13:(0.7,, 10:u14:0.0213, 9:u04:(0.7,, -10:u05:0.0213, 10:u07:(0.69,, 9:u04:30.8), 9:u07:18.2), 9:u12:(0.7,, 10:u13:0.0213, 9:u03:(0.7,, -10:u04:0.0213, 10:u06:(0.69,, 10:u07:0.0668, 9:u03:30.8), @@ -625294,7 +641379,6 @@ 10:u12:0.0213, 10:u14:(0.69,, 9:u02:(0.7,, -10:u03:0.0213, 10:u05:(0.69,, 10:u06:0.0668, 9:u08:(6.0), @@ -625305,7 +641389,6 @@ 10:u13:(0.69,, 10:u14:0.0668, 9:u01:(0.7,, -10:u02:0.0213, 10:u04:(0.69,, 10:u05:0.0668, 9:u08:16.25, @@ -625315,7 +641398,6 @@ 10:u12:(0.69,, 10:u13:0.0668, 9:u00:(0.7,, -10:u01:0.0213, 10:u03:(0.69,, 10:u04:0.0668, 9:u07:(6.0), @@ -625323,7 +641405,6 @@ 9:u03:18.2), 10:u11:(0.69,, 10:u12:0.0668, -10:u00:0.0213, 10:u02:(0.69,, 10:u03:0.0668, 9:u06:(6.0), @@ -626273,7 +642354,6 @@ 12:u00:894-908., 10:u03:tician, 15:u06:regression,, -9:u08:neous, 8:u01:R.R., 8:u07:R.T., 10:u11:tician, @@ -626287,54 +642367,42 @@ 15:u13:regression,, 10:u01:tician, 15:u04:regression,, -9:u07:neous, 8:u05:R.T., 15:u12:regression,, 10:u00:tician, 15:u03:regression,, -9:u06:neous, 12:u07:butions,, 8:u04:R.T., 8:u08:D.K., 15:u11:regression,, -9:u14:neous, 15:u02:regression,, -9:u05:neous, 12:u06:butions,, 12:u08:343-358., 8:u03:R.T., 8:u07:D.K., 15:u10:regression,, -9:u13:neous, 12:u14:butions,, 15:u01:regression,, -9:u04:neous, 12:u05:butions,, 8:u02:R.T., 8:u06:D.K., -9:u12:neous, 12:u13:butions,, 15:u00:regression,, -9:u03:neous, 12:u04:butions,, 12:u07:343-358., 8:u01:R.T., 8:u05:D.K., -9:u11:neous, 12:u12:butions,, 14:uI2:[]..,..,:-, -9:u02:neous, 12:u03:butions,, 12:u06:343-358., 17:u08:Technometrics, 8:u00:R.T., 8:u04:D.K., -9:u10:neous, 12:u11:butions,, 12:u14:343-358., 14:uI1:[]..,..,:-, 11:uI2:',...(), -9:u01:neous, 12:u02:butions,, 12:u05:343-358., 8:u03:D.K., @@ -626342,7 +642410,6 @@ 12:u13:343-358., 14:uI0:[]..,..,:-, 11:uI1:',...(), -9:u00:neous, 12:u01:butions,, 12:u04:343-358., 17:u07:Technometrics, @@ -628843,7 +644910,6 @@ 19:u12:1976;34:509-15., 14:u14:mutations,, 8:u23:1976, -10:uI2:.,,,.,, 8:u00:ONE., 19:u03:1976;34:509-15., 14:u05:mutations,, @@ -628855,7 +644921,6 @@ 19:u11:1976;34:509-15., 14:u13:mutations,, 10:u14:hepat., -10:uI1:.,,,.,, 19:u02:1976;34:509-15., 14:u04:mutations,, 10:u05:Hepat., @@ -628865,7 +644930,6 @@ 19:u10:1976;34:509-15., 14:u12:mutations,, 10:u13:hepat., -10:uI0:.,,,.,, 19:u01:1976;34:509-15., 14:u03:mutations,, 10:u04:Hepat., @@ -628891,27 +644955,19 @@ 10:u00:Hepat., 18:u00:2000;7:258-67., 10:u06:Memory, -14:u07:Highlights, 10:u08:Visual, 10:u05:Memory, -14:u06:Highlights, 10:u07:Visual, 10:u04:Memory, -14:u05:Highlights, 10:u06:Visual, 10:u03:Memory, -14:u04:Highlights, 10:u05:Visual, 10:u02:Memory, -14:u03:Highlights, 10:u04:Visual, 10:u01:Memory, -14:u02:Highlights, 10:u03:Visual, 10:u00:Memory, -14:u01:Highlights, 10:u02:Visual, -14:u00:Highlights, 10:u01:Visual, 10:u08:Andrej, 10:u00:Visual, @@ -631516,7 +647572,6 @@ 18:u13:prosopagnosics, 18:u04:prosopagnosics, 18:u12:prosopagnosics, -8:u23:pros, 18:u03:prosopagnosics, 11:u07:watcher, 18:u11:prosopagnosics, @@ -634492,7 +650547,6 @@ 8:u23:tom-, 11:uI0:,(..,)-, 9:uI1:-,,--, -10:uI2:[].--., 10:u03:tom-up, 11:u06:tistics, 7:u07:tip, @@ -634500,7 +650554,6 @@ 10:u11:tom-up, 11:u14:tistics, 9:uI0:-,,--, -10:uI1:[].--., 10:u02:tom-up, 11:u05:tistics, 7:u06:tip, @@ -634509,7 +650562,6 @@ 10:u10:tom-up, 11:u13:tistics, 7:u14:tip, -10:uI0:[].--., 10:u01:tom-up, 11:u04:tistics, 7:u05:tip, @@ -634775,8 +650827,6 @@ 6:u05:e4, 12:u02:Details), 6:u13:e4, -7:u22:Cod, -8:u23:Code, 6:u04:e4, 12:u01:Details), 6:u12:e4, @@ -637599,15 +653649,12 @@ 10:u00:point:, 15:u04:acceptance., 9:u08:pions, -8:uI2:../., 11:u07:Charged, 15:u03:acceptance., 9:u07:pions, -8:uI1:../., 11:u06:Charged, 15:u02:acceptance., 9:u06:pions, -8:uI0:../., 11:u05:Charged, 15:u01:acceptance., 9:u05:pions, @@ -638153,27 +654200,21 @@ 10:u01:meson,, 10:u00:meson,, 9:u08:Yield, -10:u08:Purity, 9:u07:Yield, 9:u06:Yield, -10:u07:Purity, 11:u08:Purity%, 9:u05:Yield, -10:u06:Purity, 9:u04:Yield, -10:u05:Purity, 11:u07:Purity%, 15:u08:122.0±11.5, 7:u22:Yie, 8:u23:Yiel, 9:u03:Yield, -10:u04:Purity, 11:u06:Purity%, 11:u08:Kπππ, 13:u08:93.2±0.5, 11:u14:purity%, 9:u02:Yield, -10:u03:Purity, 11:u05:Purity%, 15:u07:122.0±11.5, 9:u08:Kππ, @@ -638181,7 +654222,6 @@ 15:u08:161.8±13.4, 11:u13:purity%, 9:u01:Yield, -10:u02:Purity, 11:u04:Purity%, 15:u06:122.0±11.5, 11:u07:Kπππ, @@ -638190,7 +654230,6 @@ 11:u12:purity%, 15:u14:122.0±11.5, 9:u00:Yield, -10:u01:Purity, 11:u03:Purity%, 15:u05:122.0±11.5, 11:u06:Kπππ, @@ -638201,7 +654240,6 @@ 15:u13:122.0±11.5, 11:u14:kπππ, 12:uI2:........, -10:u00:Purity, 11:u02:Purity%, 15:u04:122.0±11.5, 11:u05:Kπππ, @@ -643784,32 +659822,27 @@ 10:u08:ethics, 13:u12:recessive, 16:u13:autozygosity, -14:u14:frameshift, 13:u03:recessive, 16:u04:autozygosity, 10:u07:ethics, 13:u11:recessive, 16:u12:autozygosity, -14:u13:frameshift, 13:u02:recessive, 16:u03:autozygosity, 10:u06:ethics, 13:u08:München., 13:u10:recessive, 16:u11:autozygosity, -14:u12:frameshift, 13:u01:recessive, 16:u02:autozygosity, 10:u05:ethics, 13:u07:München., 16:u10:autozygosity, -14:u11:frameshift, 13:u00:recessive, 16:u01:autozygosity, 12:u08:tympania, 10:u04:ethics, 13:u06:München., -14:u10:frameshift, 16:u00:autozygosity, 10:u03:ethics, 13:u05:München., @@ -643959,7 +659992,6 @@ 10:u06:Beagle, 12:u10:retained, 11:u12:per-snp, -8:u23:per-, 11:uI0:.,-(.),, 11:uI1:---),,(, 9:uI2:,,),., @@ -644112,7 +660144,6 @@ 11:u02:calling, 13:u12:genotyped, 16:u13:multi-sample, -12:u14:bcftools, 11:u01:Variant, 13:u03:genotyped, 16:u04:multi-sample, @@ -644120,7 +660151,6 @@ 11:u01:calling, 13:u11:genotyped, 16:u12:multi-sample, -12:u13:bcftools, 11:u00:Variant, 13:u02:genotyped, 16:u03:multi-sample, @@ -644128,18 +660158,15 @@ 11:u00:calling, 13:u10:genotyped, 16:u11:multi-sample, -12:u12:bcftools, 7:u22:BCF, 8:u23:BCFt, 13:u01:genotyped, 16:u02:multi-sample, 12:u03:BCFtools, 16:u10:multi-sample, -12:u11:bcftools, 13:u00:genotyped, 16:u01:multi-sample, 12:u02:BCFtools, -12:u10:bcftools, 16:u00:multi-sample, 12:u01:BCFtools, 12:u00:BCFtools, @@ -644363,7 +660390,6 @@ 8:u03:exon, 27:u12:ctcagactcaccctcctgactc., 11:u13:volumes, -7:u22:CTC, 8:u23:CTCA, 27:u03:CTCAGACTCACCCTCCTGACTC., 11:u04:volumes, @@ -644379,7 +660405,6 @@ 27:u01:CTCAGACTCACCCTCCTGACTC., 11:u02:volumes, 11:u07:(~15kg), -14:u08:clinically, 8:u00:exon, 11:u10:volumes, 27:u00:CTCAGACTCACCCTCCTGACTC., @@ -644388,45 +660413,33 @@ 11:u14:(~15kg), 11:u00:volumes, 11:u05:(~15kg), -14:u07:clinically, 11:u13:(~15kg), 11:u04:(~15kg), -14:u06:clinically, 10:u08:heads,, 16:u08:craniofacial, 11:u12:(~15kg), -14:u14:clinically, 8:u23:(~15, 11:u03:(~15kg), -14:u05:clinically, 9:u08:skin,, 16:u07:craniofacial, 11:u11:(~15kg), -14:u13:clinically, 11:u02:(~15kg), -14:u04:clinically, 10:u07:heads,, 11:u08:evident, 16:u06:craniofacial, 11:u10:(~15kg), -14:u12:clinically, 11:u01:(~15kg), -14:u03:clinically, 10:u06:heads,, 9:u07:skin,, 16:u05:craniofacial, -14:u11:clinically, 10:u14:heads,, 11:u00:(~15kg), -14:u02:clinically, 10:u05:heads,, 9:u06:skin,, 11:u07:evident, 16:u04:craniofacial, -14:u10:clinically, 10:u13:heads,, 9:u14:skin,, -14:u01:clinically, 10:u04:heads,, 9:u05:skin,, 11:u06:evident, @@ -644434,7 +660447,6 @@ 10:u12:heads,, 9:u13:skin,, 11:u14:evident, -14:u00:clinically, 10:u03:heads,, 9:u04:skin,, 11:u05:evident, @@ -646269,7 +662281,6 @@ 8:u14:kata, 8:u23:1925, 8:uI0:.,:-, -13:uI2:.,,,,,,,,, 10:u03:19255., 8:u05:Kata, 14:u06:Positional, @@ -646277,7 +662288,6 @@ 10:u11:19255., 8:u13:kata, 14:u14:positional, -13:uI1:.,,,,,,,,, 10:u02:19255., 8:u04:Kata, 14:u05:Positional, @@ -646289,7 +662299,6 @@ 14:u13:positional, 21:u14:chondrodysplastic, 8:u23:Kata, -13:uI0:.,,,,,,,,, 10:u01:19255., 8:u03:Kata, 14:u04:Positional, @@ -647729,52 +663738,38 @@ 14:u07:Submission, 14:u06:Submission, 8:u07:Runs, -13:u08:Precision, 14:u05:Submission, 8:u06:Runs, 13:u08:F-measure, 14:u04:Submission, 8:u05:Runs, -13:u07:Precision, 14:u03:Submission, 8:u04:Runs, -13:u06:Precision, 13:u07:F-measure, -13:u14:precision, 8:u23:Runs, 14:u02:Submission, 8:u03:Runs, -13:u05:Precision, 13:u06:F-measure, -13:u13:precision, 13:u14:f-measure, 14:u01:Submission, 8:u02:Runs, -13:u04:Precision, 13:u05:F-measure, -13:u12:precision, 13:u13:f-measure, 14:u00:Submission, 8:u01:Runs, -13:u03:Precision, 13:u04:F-measure, -13:u11:precision, 13:u12:f-measure, 7:u22:F-m, 8:u23:F-me, 8:u00:Runs, -13:u02:Precision, 13:u03:F-measure, 13:u08:VALIDATED, -13:u10:precision, 13:u11:f-measure, 6:u14:qa, -13:u01:Precision, 13:u02:F-measure, 13:u07:VALIDATED, 13:u10:f-measure, 6:u13:qa, -13:u00:Precision, 13:u01:F-measure, 13:u06:VALIDATED, 6:u12:qa, @@ -648274,18 +664269,15 @@ 11:u00:Gildea,, 8:u02:Lin,, 11:u05:Anselmo, -10:uI2:.,,..., 8:u00:40th, 8:u07:AAAI, 8:u01:Lin,, 11:u04:Anselmo, -10:uI1:.,,..., 8:u06:AAAI, 8:u00:Lin,, 11:u03:Anselmo, 14:u08:Skeletons., 8:u14:aaai, -10:uI0:.,,..., 8:u05:AAAI, 15:u08:Validation., 11:u02:Anselmo, @@ -649840,17 +665832,14 @@ 11:u10:impedes, 11:u01:impedes, 14:u08:checklist,, -13:u14:reporting, 11:u00:impedes, 12:u07:(MIRING), 17:u08:immunogenomic, 14:u07:checklist,, 14:u08:(MIBBI)[7,, -13:u13:reporting, 12:u06:(MIRING), 14:u06:checklist,, 14:u07:(MIBBI)[7,, -13:u12:reporting, 12:u14:(miring), 12:u05:(MIRING), 17:u07:immunogenomic, @@ -649858,14 +665847,12 @@ 14:u05:checklist,, 14:u06:(MIBBI)[7,, 15:u08:developers,, -13:u11:reporting, 12:u13:(miring), 12:u04:(MIRING), 17:u06:immunogenomic, 14:u04:checklist,, 14:u05:(MIBBI)[7,, 15:u07:developers,, -13:u10:reporting, 12:u12:(miring), 17:u14:immunogenomic, 12:u03:(MIRING), @@ -650452,27 +666439,22 @@ 9:uI2:[,],(, 11:u07:KIR2DS3, 8:u03:CSBs, -8:u14:copy, 9:uI1:[,],(, 10:uI2:),(..,, 11:u06:KIR2DS3, 8:u02:CSBs, -8:u13:copy, 11:u14:kir2ds3, 9:uI0:[,],(, 10:uI1:),(..,, 11:u05:KIR2DS3, 8:u01:CSBs, -8:u12:copy, 11:u13:kir2ds3, 10:uI0:),(..,, 11:u04:KIR2DS3, 8:u00:CSBs, -8:u11:copy, 11:u12:kir2ds3, 8:u23:KIR2, 11:u03:KIR2DS3, -8:u10:copy, 11:u11:kir2ds3, 11:u02:KIR2DS3, 11:u10:kir2ds3, @@ -651842,31 +667824,25 @@ 12:u01:HLA00005, 15:u00:A_nuc.fasta, 12:u00:HLA00005, -14:u08:platforms., 9:u08:Valid, -14:u07:platforms., 11:u08:priming, 9:u07:Valid, 10:uI2:,(..,-, -14:u06:platforms., 9:u06:Valid, 9:u08:(SSP), 14:u14:platforms., 10:uI1:,(..,-, -14:u05:platforms., 11:u07:priming, 9:u05:Valid, 9:u07:(SSP), 14:u13:platforms., 10:uI0:,(..,-, -14:u04:platforms., 11:u06:priming, 9:u04:Valid, 9:u06:(SSP), 14:u12:platforms., 11:u14:priming, 11:uI2:-(),-(), -14:u03:platforms., 11:u05:priming, 19:u08:>0|0|74|0|1|1|0, 9:u03:Valid, @@ -651875,7 +667851,6 @@ 11:u13:priming, 10:u14:alone., 11:uI1:-(),-(), -14:u02:platforms., 11:u04:priming, 54:u08:GCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGC, 9:u02:Valid, @@ -651884,7 +667859,6 @@ 11:u12:priming, 10:u13:alone., 11:uI0:-(),-(), -14:u01:platforms., 11:u03:priming, 19:u07:>0|0|74|0|1|1|0, 54:u08:GGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGT, @@ -651892,7 +667866,6 @@ 9:u03:(SSP), 11:u11:priming, 10:u12:alone., -14:u00:platforms., 11:u02:priming, 19:u06:>0|0|74|0|1|1|0, 54:u07:GCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGC, @@ -651962,7 +667935,6 @@ 54:u12:gcggttcgacagcgacgccgcgagccagaggatggagccgcgggcgccgt, 54:u13:ggatagagcaggagggtccggagtattgggacggggagacacggaaagtg, 54:u14:aaggcccactcacagactcaccgagtggacctggggaccctgcgcggcta, -7:u22:GCG, 8:u23:GCGG, 19:u00:>0|0|74|0|1|1|0, 54:u01:GCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGC, @@ -652518,27 +668490,18 @@ 10:u14:header, 9:u03:FASTA, 13:u03:formatted, -14:u08:contiguous, 9:u11:fasta, 10:u13:header, 9:u02:FASTA, 13:u02:formatted, -14:u07:contiguous, 9:u10:fasta, 10:u12:header, 9:u01:FASTA, 13:u01:formatted, -14:u06:contiguous, 10:u11:header, 9:u00:FASTA, 13:u00:formatted, -14:u05:contiguous, 10:u10:header, -14:u04:contiguous, -14:u03:contiguous, -14:u02:contiguous, -14:u01:contiguous, -14:u00:contiguous, 10:u08:Ranges, 10:u07:Ranges, 10:u06:Ranges, @@ -653507,7 +669470,6 @@ 14:u05:raffinose,, 8:u10:gal3, 19:u14:concentration),, -8:uI2:,,(., 15:u00:fluorescent, 19:u05:concentration),, 14:u07:harbouring, @@ -653516,7 +669478,6 @@ 14:u04:raffinose,, 10:u08:JAY291, 19:u13:concentration),, -8:uI1:,,(., 19:u04:concentration),, 14:u06:harbouring, 12:u01:15,20,22, @@ -653524,7 +669485,6 @@ 10:u07:JAY291, 19:u12:concentration),, 14:u14:harbouring, -8:uI0:,,(., 19:u03:concentration),, 14:u05:harbouring, 13:u07:responded, @@ -654724,30 +670684,16 @@ 9:u03:admit, 19:u04:meta-parameter,, 16:u10:identifiable, -17:u08:consideration, 9:u02:admit, 19:u03:meta-parameter,, 9:u01:admit, 19:u02:meta-parameter,, -17:u07:consideration, 9:u00:admit, 19:u01:meta-parameter,, -17:u06:consideration, 19:u00:meta-parameter,, -17:u14:consideration, -17:u05:consideration, -17:u13:consideration, -17:u04:consideration, -17:u12:consideration, -17:u03:consideration, 25:u08:structurally-relevant, -17:u11:consideration, -17:u02:consideration, 9:u08:this., -17:u10:consideration, -17:u01:consideration, 25:u07:structurally-relevant, -17:u00:consideration, 25:u06:structurally-relevant, 9:u07:this., 25:u14:structurally-relevant, @@ -659127,7 +675073,6 @@ 9:u12:1,042, 9:u13:1,034, 9:u14:0.904, -8:u23:1,04, 9:u00:1,016, 10:u01:16≤,, 9:u02:1,009, @@ -660484,7 +676429,6 @@ 11:u03:decade., 11:u07:Nanchal, 11:u10:weekend, -10:uI2::..;:., 11:u01:weekend, 11:u04:Weekend, 16:u00:Khoshchehreh, @@ -660492,7 +676436,6 @@ 11:u06:Nanchal, 7:u22:Wee, 8:u23:Week, -10:uI1::..;:., 11:u00:weekend, 11:u03:Weekend, 13:u07:embolism:, @@ -660500,7 +676443,6 @@ 11:u01:decade., 11:u05:Nanchal, 12:u08:Metcalfe, -10:uI0::..;:., 12:uI2:.,,,,,,;, 11:u02:Weekend, 13:u06:embolism:, @@ -663589,39 +679531,30 @@ 8:u23:trit, 13:u03:tritional, 10:u00:seemed, -9:u08:race,, 13:u11:tritional, 13:u02:tritional, 12:u08:plements, -9:u07:race,, 13:u10:tritional, 13:u01:tritional, -9:u06:race,, 13:u00:tritional, 12:u07:plements, 16:u08:ommendations, -9:u05:race,, 12:u06:plements, -9:u04:race,, 12:u14:plements, 12:u05:plements, 16:u07:ommendations, -9:u03:race,, 12:u13:plements, 12:u04:plements, 16:u06:ommendations, -9:u02:race,, 12:u12:plements, 16:u14:ommendations, 12:u03:plements, 16:u05:ommendations, -9:u01:race,, 13:u08:conscious, 12:u11:plements, 16:u13:ommendations, 12:u02:plements, 16:u04:ommendations, -9:u00:race,, 13:u07:conscious, 12:u10:plements, 16:u12:ommendations, @@ -664797,7 +680730,6 @@ 20:u10:dorotheenstrasse, 9:u11:chris, 20:u12:invalidenstrasse, -8:u23:Inva, 10:uI1:,--..., 10:uI2:,-.-./, 12:u00:Deutsche, @@ -665483,7 +681415,6 @@ 67:u10:society/document_library/pdf_06/ec-open-access-pilot-ppt_en.pdf, 12:u11:-leading, 26:u12:infrastructures-2009-1, -8:u23:Infr, 67:u01:society/document_library/pdf_06/ec-open-access-pilot-ppt_en.pdf, 12:u02:-leading, 26:u03:Infrastructures-2009-1, @@ -665783,42 +681714,33 @@ 10:u01:submit, 10:u00:submit, 10:u08:Wealth, -8:u08:peer, -8:u07:peer, 10:u07:Wealth, -8:u06:peer, 10:u06:Wealth, 14:u08:Visibility, -8:u05:peer, 15:u08:collection., 10:u14:wealth, 10:u05:Wealth, -8:u04:peer, 15:u07:collection., 10:u13:wealth, 10:u04:Wealth, 14:u07:Visibility, -8:u03:peer, 15:u06:collection., 15:u08:collection,, 10:u12:wealth, 8:u23:Weal, 10:u03:Wealth, 14:u06:Visibility, -8:u02:peer, 15:u05:collection., 15:u07:collection,, 10:u11:wealth, 10:u02:Wealth, 14:u05:Visibility, 12:u08:Reliance, -8:u01:peer, 15:u04:collection., 15:u06:collection,, 10:u10:wealth, 10:u01:Wealth, 14:u04:Visibility, -8:u00:peer, 15:u03:collection., 15:u05:collection,, 10:u00:Wealth, @@ -666108,43 +682030,34 @@ 6:u11:-7, 6:u02:-7, 13:u08:basically, -7:u08:web, 6:u10:-7, 6:u01:-7, 15:u07:ultimately,, -7:u07:web, 6:u00:-7, 15:u06:ultimately,, 13:u07:basically, -7:u06:web, 15:u05:ultimately,, 13:u06:basically, -7:u05:web, 13:u14:basically, 15:u04:ultimately,, 13:u05:basically, -7:u04:web, 13:u13:basically, 15:u03:ultimately,, 13:u04:basically, -7:u03:web, 12:u08:metadata, 13:u12:basically, 15:u02:ultimately,, 13:u03:basically, -7:u02:web, 12:u07:metadata, 13:u11:basically, 15:u01:ultimately,, 13:u02:basically, 14:u08:legibility, -7:u01:web, 12:u06:metadata, 13:u10:basically, 15:u00:ultimately,, 13:u01:basically, 16:u08:Researchers', -7:u00:web, 12:u05:metadata, 13:u00:basically, 14:u07:legibility, @@ -666780,32 +682693,27 @@ 12:u07:enormous, 17:u10:specificities, 15:u11:conferences, -13:u14:ambiguous, 16:u00:bibliometric, 17:u01:specificities, 15:u02:conferences, 13:u05:ambiguous, 12:u06:enormous, 15:u10:conferences, -13:u13:ambiguous, 12:u14:enormous, 17:u00:specificities, 15:u01:conferences, 13:u04:ambiguous, 12:u05:enormous, -13:u12:ambiguous, 12:u13:enormous, 15:u00:conferences, 13:u03:ambiguous, 12:u04:enormous, 12:u08:handled,, -13:u11:ambiguous, 12:u12:enormous, 8:u23:enor, 13:u02:ambiguous, 12:u03:enormous, 15:u08:institution, -13:u10:ambiguous, 12:u11:enormous, 13:u01:ambiguous, 12:u02:enormous, @@ -669152,7 +685060,6 @@ 14:u03:EXPRESSION, 8:u04:WITH, 14:u13:obviously,, -7:u22:SPE, 8:u23:SPEC, 17:u03:SPECIFICATION, 14:u04:Obviously,, @@ -669254,17 +685161,6 @@ 9:u00:F,, 10:u00:ff,, 12:uI0:[],[]()., -6:u08:AA, -6:u07:AA, -6:u06:AA, -6:u05:AA, -6:u04:AA, -6:u22:AA, -6:u23:AA, -6:u03:AA, -6:u02:AA, -6:u01:AA, -6:u00:AA, 9:u08:datum, 9:u07:datum, 11:u08:locates, @@ -671948,7 +687844,6 @@ 16:u13:index_unssl., 8:u14:park, 12:uI1:.://.../, -9:uI2:..//., 16:u04:index_unssl., 8:u08:Shin, 14:u00:teenagers., @@ -671958,7 +687853,6 @@ 16:u12:index_unssl., 8:u13:park, 12:uI0:.://.../, -9:uI1:..//., 16:u03:index_unssl., 8:u03:jsp., 7:u04:YH,, @@ -671966,7 +687860,6 @@ 16:u11:index_unssl., 8:u12:park, 16:u14:implementing, -9:uI0:..//., 16:u02:index_unssl., 8:u07:Shin, 11:u08:menting, @@ -673733,23 +689626,14 @@ 12:u05:ar{log[n, 12:u04:ar{log[n, 12:u03:ar{log[n, -11:u08:100,000, 12:u02:ar{log[n, -11:u07:100,000, 12:u01:ar{log[n, -11:u06:100,000, 12:u00:ar{log[n, -11:u05:100,000, -11:u04:100,000, 15:u14:occurrence., -11:u03:100,000, 15:u13:occurrence., -11:u02:100,000, 15:u12:occurrence., -11:u01:100,000, 12:u08:3052.071, 15:u11:occurrence., -11:u00:100,000, 12:u07:3052.071, 15:u10:occurrence., 12:u06:3052.071, @@ -676840,28 +692724,19 @@ 15:u12:compressed., 15:u03:compressed., 10:u06:tablet, -14:u08:excipients, 11:u10:tablets, 15:u11:compressed., 15:u02:compressed., 10:u05:tablet, -14:u07:excipients, 15:u10:compressed., 15:u01:compressed., 10:u04:tablet, -14:u06:excipients, 15:u00:compressed., 10:u03:tablet, -14:u05:excipients, 10:u02:tablet, -14:u04:excipients, 10:u01:tablet, -14:u03:excipients, 10:u00:tablet, -14:u02:excipients, 8:u08:(148, -14:u01:excipients, -14:u00:excipients, 8:u07:(148, 8:u06:(148, 8:u14:(148, @@ -678442,7 +694317,6 @@ 15:u08:cheekplates, 7:u04:rgp, 10:u08:0.0314, -6:u21:rg, 7:u22:rgp, 7:u23:rgp, 7:u03:rgp, @@ -679253,8 +695127,6 @@ 12:u07:"surface, 16:u12:fda-approved, 15:u13:stabilizer., -7:u22:FDA, -8:u23:FDA-, 16:u03:FDA-approved, 15:u04:stabilizer., 19:u08:2015;285:62-67., @@ -680667,7 +696539,6 @@ 7:u13:law, 11:u06:Prandtl, 7:u12:law, -7:u22:law, 7:u23:law, 11:u05:Prandtl, 8:u08:grad, @@ -681088,8 +696959,6 @@ 9:u11:used:, 8:u00:Wall, 9:u10:used:, -6:u22:ln, -6:u23:ln, 6:u08:yU, 6:u07:yU, 6:u06:yU, @@ -683522,17 +699391,12 @@ 11:uI1:[],-[]., 11:uI0:[],-[]., 22:u08:microenvironmental, -11:u14:benefit, -11:u13:benefit, 22:u07:microenvironmental, 15:u08:stochastic;, -11:u12:benefit, 22:u06:microenvironmental, -11:u11:benefit, 22:u14:microenvironmental, 22:u05:microenvironmental, 15:u07:stochastic;, -11:u10:benefit, 22:u13:microenvironmental, 22:u04:microenvironmental, 15:u06:stochastic;, @@ -685119,7 +700983,6 @@ 9:uI2:.;-.,, 12:u00:[PubMed:, 8:u05:541,, -10:u08:Oncol., 13:u00:21376230], 9:u01:Paget, 12:u03:Discern., @@ -685135,90 +700998,70 @@ 12:u04:321-330., 9:u05:Quail, 10:u07:Ansell, -9:u08:Educ., 8:u12:541,, 8:u23:541,, 9:uI0:.;-.,, 10:uI1:,-.[:], 8:u03:541,, -10:u07:Oncol., 21:u08:microenvironment:, 12:u01:Discern., 12:u03:321-330., 9:u04:Quail, 10:u06:Ansell, -9:u07:Educ., 8:u08:Pitt, 8:u11:541,, 10:uI0:,-.[:], 11:uI2:,,-.[:], 8:u02:541,, -10:u06:Oncol., 12:u00:Discern., 12:u02:321-330., 9:u03:Quail, 10:u05:Ansell, -9:u06:Educ., 8:u07:Pitt, 12:u08:Removing, 8:u10:541,, -10:u14:oncol., 11:uI1:,,-.[:], 10:uI2:.;...., 8:u01:541,, -10:u05:Oncol., 21:u07:microenvironment:, 12:u01:321-330., 9:u02:Quail, 10:u04:Ansell, -9:u05:Educ., 8:u06:Pitt, 12:u07:Removing, -10:u13:oncol., 11:uI0:,,-.[:], 10:uI1:.;...., 8:u00:541,, -10:u04:Oncol., 21:u06:microenvironment:, 12:u00:321-330., 9:u01:Quail, 10:u03:Ansell, -9:u04:Educ., 8:u05:Pitt, 12:u06:Removing, 10:u08:Crespo, -10:u12:oncol., 21:u14:microenvironment:, 10:uI0:.;...., 10:uI2:.;;;;;, -10:u03:Oncol., 21:u05:microenvironment:, 9:u00:Quail, 10:u02:Ansell, -9:u03:Educ., 8:u04:Pitt, 12:u05:Removing, 10:u07:Crespo, -10:u11:oncol., 21:u13:microenvironment:, 10:uI1:.;;;;;, -10:u02:Oncol., 21:u04:microenvironment:, 10:u01:Ansell, -9:u02:Educ., 8:u03:Pitt, 12:u04:Removing, 10:u06:Crespo, 9:u08:Netea, -10:u10:oncol., 21:u12:microenvironment:, 10:uI0:.;;;;;, 12:uI2:.,,-.[:], -10:u01:Oncol., 21:u03:microenvironment:, 12:u08:aaf1098., 10:u00:Ansell, -9:u01:Educ., 8:u02:Pitt, 12:u03:Removing, 10:u05:Crespo, @@ -685227,9 +701070,7 @@ 21:u11:microenvironment:, 12:uI1:.,,-.[:], 8:uI2:.;;;, -10:u00:Oncol., 21:u02:microenvironment:, -9:u00:Educ., 8:u01:Pitt, 12:u02:Removing, 10:u04:Crespo, @@ -686582,48 +702423,40 @@ 12:u00:Alarcón, 10:u02:Hoehme, 9:u04:Bull., -12:u08:melanoma, 14:u03:carcinoma., 10:u01:Hoehme, 9:u03:Bull., -12:u07:melanoma, 13:u08:23800293], 14:u02:carcinoma., 12:u08:Tavernar, 10:u00:Hoehme, 9:u02:Bull., -12:u06:melanoma, 13:u07:23800293], 14:uI2:.;;;;;;;--, 14:u01:carcinoma., 9:u01:Bull., -12:u05:melanoma, 13:u06:23800293], 14:uI1:.;;;;;;;--, 11:uI2:....,,., 14:u00:carcinoma., 12:u07:Tavernar, 9:u00:Bull., -12:u04:melanoma, 13:u05:23800293], 14:uI0:.;;;;;;;--, 11:uI1:....,,., 12:u06:Tavernar, -12:u03:melanoma, 13:u04:23800293], 11:u08:Pennisi, 12:u14:tavernar, 11:uI0:....,,., 13:uI2:.;;-;;;;;, 12:u05:Tavernar, -12:u02:melanoma, 13:u03:23800293], 11:u07:Pennisi, 12:u13:tavernar, 13:uI1:.;;-;;;;;, 9:uI2:;;;.-, 12:u04:Tavernar, -12:u01:melanoma, 13:u02:23800293], 11:u06:Pennisi, 12:u12:tavernar, @@ -686632,7 +702465,6 @@ 13:uI0:.;;-;;;;;, 9:uI1:;;;.-, 12:u03:Tavernar, -12:u00:melanoma, 13:u01:23800293], 11:u05:Pennisi, 12:u11:tavernar, @@ -689126,7 +704958,6 @@ 11:u05:Workman, 8:u11:164., 8:u13:165., -11:u14:100,000, 11:uI1:..,-,-., 8:u00:163., 8:u02:164., @@ -689138,7 +704969,6 @@ 11:u04:Workman, 8:u10:164., 8:u12:165., -11:u13:100,000, 8:u23:165., 11:uI0:..,-,-., 13:uI2:,?,,-.[:], @@ -689149,7 +704979,6 @@ 10:u01:Gadkar, 11:u03:Workman, 8:u11:165., -11:u12:100,000, 13:u14:modulated, 13:uI1:,?,,-.[:], 13:uI2:.;;;;;;;-, @@ -689161,7 +704990,6 @@ 11:u02:Workman, 7:u08:77,, 8:u10:165., -11:u11:100,000, 13:u13:modulated, 13:uI0:,?,,-.[:], 13:uI1:.;;;;;;;-, @@ -689170,7 +704998,6 @@ 16:u06:radiotherapy, 11:u01:Workman, 7:u07:77,, -11:u10:100,000, 13:u12:modulated, 16:u14:radiotherapy, 13:uI0:.;;;;;;;-, @@ -690036,26 +705863,17 @@ 11:u12:viruses, 10:u13:(jacob, 10:u04:(Jacob, -14:u08:pancreatic, 11:u11:viruses, 10:u12:(jacob, 10:u03:(Jacob, 11:u10:viruses, 10:u11:(jacob, 10:u02:(Jacob, -14:u07:pancreatic, 10:u10:(jacob, 10:u01:(Jacob, -14:u06:pancreatic, 10:u00:(Jacob, -14:u05:pancreatic, -14:u04:pancreatic, -14:u03:pancreatic, -14:u02:pancreatic, 8:u08:APCs, -14:u01:pancreatic, 8:u07:APCs, -14:u00:pancreatic, 11:u08:(Marino, 8:u06:APCs, 8:u05:APCs, @@ -693107,7 +708925,6 @@ 7:u02:G-G, 10:u03:H~H-I-, 7:u12:h-h, -6:u21:H-, 7:u22:H-H, 7:u23:H-H, 7:u01:G-G, @@ -693550,21 +709367,16 @@ 12:u10:articles, 10:u00:Salton, 14:u08:exposition, -14:u14:contiguous, 7:uI2:,,", 14:u07:exposition, -14:u13:contiguous, 7:uI1:,,", 14:u06:exposition, -14:u12:contiguous, 14:u14:exposition, 7:uI0:,,", 14:u05:exposition, -14:u11:contiguous, 14:u13:exposition, 10:uI2:,"(.)., 14:u04:exposition, -14:u10:contiguous, 14:u12:exposition, 10:uI1:,"(.)., 14:u03:exposition, @@ -693779,33 +709591,24 @@ 13:u01:inflected, 14:u03:algorithm), 16:u06:incomparable, -13:u08:groupings, 9:uI0:)""-., 15:u00:irregularly, 13:u00:inflected, 14:u02:algorithm), 16:u05:incomparable, -13:u07:groupings, 10:u14:really, 14:u01:algorithm), 16:u04:incomparable, -13:u06:groupings, 10:u13:really, 14:u00:algorithm), 16:u03:incomparable, -13:u05:groupings, 10:u12:really, 16:u02:incomparable, -13:u04:groupings, 10:u11:really, 16:u01:incomparable, -13:u03:groupings, 10:u10:really, 16:u00:incomparable, -13:u02:groupings, 18:u08:token-sequence, -13:u01:groupings, -13:u00:groupings, 18:u07:token-sequence, 18:u06:token-sequence, 18:u14:token-sequence, @@ -701430,7 +717233,6 @@ 9:u05:Wave:, 14:u06:Scheduling, 16:u07:Convergecast, -13:u08:(Extended, 8:u02:8661, 13:u04:Hipercom2, 13:u08:802.15.4e, @@ -701452,7 +717254,6 @@ 9:u03:Wave:, 14:u04:Scheduling, 16:u05:Convergecast, -13:u07:(Extended, 8:u00:8661, 13:u02:Hipercom2, 13:u06:802.15.4e, @@ -701465,7 +717266,6 @@ 9:u02:Wave:, 14:u03:Scheduling, 16:u04:Convergecast, -13:u06:(Extended, 9:u07:Ridha, 9:u08:PARIS, 13:u01:Hipercom2, @@ -701475,12 +717275,10 @@ 10:u08:CENTRE, 9:u10:wave:, 16:u12:convergecast, -13:u14:(extended, 17:u00:Project-Teams, 9:u01:Wave:, 14:u02:Scheduling, 16:u03:Convergecast, -13:u05:(Extended, 9:u06:Ridha, 11:u08:Domaine, 13:u00:Hipercom2, @@ -701490,12 +717288,10 @@ 10:u07:CENTRE, 17:u08:-ROCQUENCOURT, 16:u11:convergecast, -13:u13:(extended, 9:u14:ridha, 9:u00:Wave:, 14:u01:Scheduling, 16:u02:Convergecast, -13:u04:(Extended, 9:u05:Ridha, 9:u07:PARIS, 13:u03:802.15.4e, @@ -701504,13 +717300,9 @@ 10:u06:CENTRE, 17:u07:-ROCQUENCOURT, 16:u10:convergecast, -13:u12:(extended, 9:u13:ridha, -7:u22:(Ex, -8:u23:(Ext, 14:u00:Scheduling, 16:u01:Convergecast, -13:u03:(Extended, 9:u04:Ridha, 9:u06:PARIS, 11:u07:Domaine, @@ -701519,12 +717311,10 @@ 9:u04:Soua,, 10:u05:CENTRE, 17:u06:-ROCQUENCOURT, -13:u11:(extended, 9:u12:ridha, 9:u14:paris, 8:u23:Ridh, 16:u00:Convergecast, -13:u02:(Extended, 9:u03:Ridha, 9:u05:PARIS, 11:u06:Domaine, @@ -701533,10 +717323,8 @@ 9:u03:Soua,, 10:u04:CENTRE, 17:u05:-ROCQUENCOURT, -13:u10:(extended, 9:u11:ridha, 9:u13:paris, -13:u01:(Extended, 9:u02:Ridha, 9:u04:PARIS, 11:u05:Domaine, @@ -701549,7 +717337,6 @@ 9:u12:paris, 8:u14:b.p., 8:u23:PARI, -13:u00:(Extended, 9:u01:Ridha, 9:u03:PARIS, 11:u04:Domaine, @@ -702324,7 +718111,6 @@ 15:u03:spectacular, 12:u04:Networks, 9:u12:lossy, -8:u23:Loss, 11:uI1:().---., 8:u08:LLNs, 15:u02:spectacular, @@ -702406,19 +718192,16 @@ 15:u10:challenges:, 13:u13:gathering, 10:u14:argued, -9:uI2:.,--., 15:u01:challenges:, 10:u05:argued, 13:u12:gathering, 10:u13:argued, 8:u23:gath, -9:uI1:.,--., 15:u00:challenges:, 10:u04:argued, 13:u07:resorting, 13:u11:gathering, 10:u12:argued, -9:uI0:.,--., 10:u03:argued, 13:u06:resorting, 13:u10:gathering, @@ -703259,15 +719042,6 @@ 14:u10:v2child(u), 14:u01:v2Child(u), 14:u00:v2Child(u), -12:u08:ensuring, -12:u07:ensuring, -12:u06:ensuring, -12:u05:ensuring, -12:u04:ensuring, -12:u03:ensuring, -12:u02:ensuring, -12:u01:ensuring, -12:u00:ensuring, 9:u08:slots, 9:u07:slots, 9:u06:slots, @@ -704074,17 +719848,10 @@ 9:u00:Hello, 10:u00:[18])., 6:u08:e), -6:u14:d), -6:u13:d), 6:u07:e), -6:u12:d), -6:u22:d), -6:u23:d), 6:u06:e), -6:u11:d), 6:u14:e), 6:u05:e), -6:u10:d), 6:u13:e), 6:u04:e), 6:u12:e), @@ -705966,19 +721733,16 @@ 10:u05:share., 10:u10:+white, 12:u11:[0.0182], -8:uI2:.-'-, 12:u00:[0.0049], 10:u01:+White, 12:u02:[0.0182], 10:u04:share., 12:u10:[0.0182], -8:uI1:.-'-, 10:u00:+White, 12:u01:[0.0182], 11:u07:Errors], 9:u08:tiate, 10:u03:share., -8:uI0:.-'-, 12:u00:[0.0182], 11:u06:Errors], 10:u02:share., @@ -711225,7 +726989,6 @@ 20:u05:Demonstrations),, 7:u07:Pew, 13:u07:Research., -13:u08:Landscape, 12:u10:manning,, 12:u11:bethard,, 20:u13:demonstrations),, @@ -711236,7 +726999,6 @@ 7:u06:Pew, 13:u07:Religious, 13:u06:Research., -13:u07:Landscape, 12:u10:bethard,, 20:u12:demonstrations),, 7:u14:pew, @@ -711249,7 +727011,6 @@ 13:u06:Religious, 25:u08:https://www.pewforum., 13:u05:Research., -13:u06:Landscape, 20:u11:demonstrations),, 7:u13:pew, 10:uI0:),.-.-, @@ -711260,7 +727021,6 @@ 13:u05:Religious, 34:u08:org/religious-landscape-study/, 13:u04:Research., -13:u05:Landscape, 20:u10:demonstrations),, 7:u12:pew, 7:u22:Pew, @@ -711272,7 +727032,6 @@ 25:u07:https://www.pewforum., 34:u08:religious-tradition/buddhist/., 13:u03:Research., -13:u04:Landscape, 7:u11:pew, 20:u00:Demonstrations),, 7:u02:Pew, @@ -711280,7 +727039,6 @@ 25:u06:https://www.pewforum., 34:u07:org/religious-landscape-study/, 13:u02:Research., -13:u03:Landscape, 7:u10:pew, 25:u14:https://www.pewforum., 7:u01:Pew, @@ -711290,7 +727048,6 @@ 34:u07:religious-tradition/buddhist/., 14:u08:Sutskever,, 13:u01:Research., -13:u02:Landscape, 25:u13:https://www.pewforum., 34:u14:org/religious-landscape-study/, 7:u00:Pew, @@ -711300,7 +727057,6 @@ 34:u06:religious-tradition/buddhist/., 13:u08:learners., 13:u00:Research., -13:u01:Landscape, 25:u12:https://www.pewforum., 34:u13:org/religious-landscape-study/, 34:u14:religious-tradition/buddhist/., @@ -711311,7 +727067,6 @@ 34:u05:religious-tradition/buddhist/., 14:u07:Sutskever,, 10:u08:Sheng,, -13:u00:Landscape, 25:u11:https://www.pewforum., 34:u12:org/religious-landscape-study/, 34:u13:religious-tradition/buddhist/., @@ -713100,7 +728855,6 @@ 14:u04:Bartenders, 17:u06:Photographers, 15:u02:attendants,, -11:u08:drivers, 11:u10:counter, 14:u12:bartenders, 17:u14:photographers, @@ -713109,7 +728863,6 @@ 17:u05:Photographers, 7:u07:Bus, 15:u01:attendants,, -11:u07:drivers, 14:u11:bartenders, 17:u13:photographers, 11:u00:Counter, @@ -713117,7 +728870,6 @@ 17:u04:Photographers, 7:u06:Bus, 15:u00:attendants,, -11:u06:drivers, 13:u08:analysts,, 14:u10:bartenders, 17:u12:photographers, @@ -713125,13 +728877,11 @@ 17:u03:Photographers, 7:u05:Bus, 9:u08:Cooks, -11:u05:drivers, 13:u07:analysts,, 17:u11:photographers, 14:u00:Bartenders, 17:u02:Photographers, 7:u04:Bus, -11:u04:drivers, 13:u06:analysts,, 17:u10:photographers, 8:u14:news, @@ -713139,25 +728889,21 @@ 17:u01:Photographers, 7:u03:Bus, 9:u07:Cooks, -11:u03:drivers, 13:u05:analysts,, 8:u13:news, 17:u00:Photographers, 7:u02:Bus, 9:u06:Cooks, -11:u02:drivers, 13:u04:analysts,, 8:u12:news, 9:u14:cooks, 7:u01:Bus, 9:u05:Cooks, -11:u01:drivers, 13:u03:analysts,, 8:u11:news, 9:u13:cooks, 7:u00:Bus, 9:u04:Cooks, -11:u00:drivers, 13:u02:analysts,, 8:u10:news, 9:u12:cooks, @@ -716364,7 +732110,6 @@ 14:u04:Khetarpal,, 14:u05:Tenenbaum., 13:u07:anaphoric, -11:u08:Gibson,, 15:u00:Innateness:, 10:u02:Books,, 14:u03:Stephanie,, @@ -716396,7 +732141,6 @@ 14:u03:Tenenbaum., 13:u05:anaphoric, 18:u06:33(2):287-300., -11:u07:Gibson,, 18:u08:25(3):407-454., 10:u00:Books,, 14:u01:Stephanie,, @@ -716412,7 +732156,6 @@ 14:u02:Tenenbaum., 13:u04:anaphoric, 18:u05:33(2):287-300., -11:u06:Gibson,, 14:u08:Goldwater,, 14:u00:Stephanie,, 11:u03:poverty, @@ -716427,7 +732170,6 @@ 14:u01:Tenenbaum., 13:u03:anaphoric, 18:u04:33(2):287-300., -11:u05:Gibson,, 18:u07:25(3):407-454., 11:u02:poverty, 10:u05:Edward, @@ -716442,7 +732184,6 @@ 14:u00:Tenenbaum., 13:u02:anaphoric, 18:u03:33(2):287-300., -11:u04:Gibson,, 18:u06:25(3):407-454., 14:u07:Goldwater,, 11:u01:poverty, @@ -716457,7 +732198,6 @@ 8:u23:Gibs, 13:u01:anaphoric, 18:u02:33(2):287-300., -11:u03:Gibson,, 18:u05:25(3):407-454., 14:u06:Goldwater,, 11:u00:poverty, @@ -716471,7 +732211,6 @@ 14:u14:goldwater,, 13:u00:anaphoric, 18:u01:33(2):287-300., -11:u02:Gibson,, 18:u04:25(3):407-454., 14:u05:Goldwater,, 17:u08:112(1):21-54., @@ -716484,7 +732223,6 @@ 14:u13:goldwater,, 8:u23:25(3, 18:u00:33(2):287-300., -11:u01:Gibson,, 18:u03:25(3):407-454., 14:u04:Goldwater,, 14:u08:Griffiths,, @@ -716494,7 +732232,6 @@ 9:u10:1994., 18:u11:25(3):407-454., 14:u12:goldwater,, -11:u00:Gibson,, 18:u02:25(3):407-454., 14:u03:Goldwater,, 17:u07:112(1):21-54., @@ -723196,29 +738933,20 @@ 11:u05:nuclei., 11:u13:nuclei., 11:u04:nuclei., -11:u08:orbital, 11:u12:nuclei., 11:u03:nuclei., -11:u07:orbital, 11:u11:nuclei., 11:u02:nuclei., -11:u06:orbital, 11:u10:nuclei., 11:u01:nuclei., 7:u08:K(T, -11:u05:orbital, 11:u00:nuclei., -11:u04:orbital, 7:u07:K(T, -11:u03:orbital, 7:u06:K(T, -11:u02:orbital, 7:u14:k(t, 7:u05:K(T, -11:u01:orbital, 7:u13:k(t, 7:u04:K(T, -11:u00:orbital, 7:u12:k(t, 6:u21:K(, 7:u22:K(T, @@ -723226,49 +738954,29 @@ 7:u03:K(T, 7:u11:k(t, 7:u02:K(T, -11:u08:parable, 7:u10:k(t, 14:u14:exp(−∆, 7:u01:K(T, 14:u13:exp(−∆, 7:u00:K(T, -11:u07:parable, 14:u12:exp(−∆, -11:u06:parable, 14:u11:exp(−∆, -11:u14:parable, -11:u05:parable, 14:u10:exp(−∆, -11:u13:parable, -11:u04:parable, -11:u12:parable, -11:u03:parable, 10:u08:rringa, -16:u08:paramagnetic, -11:u11:parable, -11:u02:parable, -16:u07:paramagnetic, -11:u10:parable, -11:u01:parable, 10:u07:rringa, 8:u08:(Eq., -16:u06:paramagnetic, 12:uI2:(,,.[].), -11:u00:parable, 10:u06:rringa, -16:u05:paramagnetic, 8:u08:(2)), 10:u14:rringa, 12:uI1:(,,.[].), 10:u05:rringa, 8:u07:(Eq., -16:u04:paramagnetic, 8:u07:(2)), 10:u13:rringa, 12:uI0:(,,.[].), 10:u04:rringa, 8:u06:(Eq., -16:u03:paramagnetic, 8:u06:(2)), 10:u12:rringa, 8:u14:(eq., @@ -723276,13 +738984,11 @@ 8:u23:rrin, 10:u03:rringa, 8:u05:(Eq., -16:u02:paramagnetic, 8:u05:(2)), 10:u11:rringa, 8:u13:(eq., 10:u02:rringa, 8:u04:(Eq., -16:u01:paramagnetic, 8:u04:(2)), 10:u10:rringa, 8:u12:(eq., @@ -723290,7 +738996,6 @@ 8:u23:(Eq., 10:u01:rringa, 8:u03:(Eq., -16:u00:paramagnetic, 8:u03:(2)), 8:u11:(eq., 10:u00:rringa, @@ -724520,7 +740225,6 @@ 10:u03:molded, 7:u04:SiO, 10:u11:molded, -8:u23:ref., 7:u00:-At, 10:u02:molded, 7:u07:-By, @@ -724651,28 +740355,22 @@ 7:u10:t=t, 7:u01:t=t, 7:u00:t=t, -12:u08:Scanning, 12:u08:Gwyddion, -12:u07:Scanning, 9:uI2:../,-, -12:u06:Scanning, 12:u07:Gwyddion, 14:u08:ifications, 12:u14:scanning, 9:uI1:../,-, -12:u05:Scanning, 12:u06:Gwyddion, 12:u13:scanning, 12:u14:gwyddion, 9:uI0:../,-, -12:u04:Scanning, 12:u05:Gwyddion, 14:u07:ifications, 20:u08:peak-to-valley),, 12:u12:scanning, 12:u13:gwyddion, 10:uI2:.[]()., -12:u03:Scanning, 12:u04:Gwyddion, 14:u06:ifications, 12:u11:scanning, @@ -724682,7 +740380,6 @@ 7:u22:Gwy, 8:u23:Gwyd, 10:uI1:.[]()., -12:u02:Scanning, 12:u03:Gwyddion, 14:u05:ifications, 20:u07:peak-to-valley),, @@ -724691,7 +740388,6 @@ 12:u11:gwyddion, 14:u13:ifications, 10:uI0:.[]()., -12:u01:Scanning, 12:u02:Gwyddion, 14:u04:ifications, 20:u06:peak-to-valley),, @@ -724699,7 +740395,6 @@ 12:u10:gwyddion, 14:u12:ifications, 20:u14:peak-to-valley),, -12:u00:Scanning, 12:u01:Gwyddion, 14:u03:ifications, 20:u05:peak-to-valley),, @@ -729612,19 +745307,14 @@ 9:u08:LIMIX, 9:u07:LIMIX, 9:u06:LIMIX, -15:u14:efficiency., 9:u05:LIMIX, -15:u13:efficiency., 9:u04:LIMIX, 16:u08:overfitting,, -15:u12:efficiency., 12:u08:speedups, 9:u03:LIMIX, 16:u07:overfitting,, -15:u11:efficiency., 9:u02:LIMIX, 16:u06:overfitting,, -15:u10:efficiency., 12:u07:speedups, 9:u01:LIMIX, 16:u05:overfitting,, @@ -729696,12 +745386,9 @@ 8:uI0:-[,], 17:u01:lipid-related, 17:u00:lipid-related, -11:uI2:).[],.., 12:u08:notypes,, 16:u08:single-locus, -11:uI1:).[],.., 16:u07:single-locus, -11:uI0:).[],.., 12:u07:notypes,, 16:u06:single-locus, 12:u06:notypes,, @@ -730074,20 +745761,11 @@ 13:uI1:([]),(,)., 9:u02:LMMs,, 10:u01:panel;, -9:u08:gene., 9:u10:lmms,, 13:uI0:([]),(,)., 9:u01:LMMs,, 10:u00:panel;, -9:u07:gene., 9:u00:LMMs,, -9:u06:gene., -9:u05:gene., -9:u04:gene., -9:u03:gene., -9:u02:gene., -9:u01:gene., -9:u00:gene., 11:uI2:(--,).-, 11:uI1:(--,).-, 11:uI0:(--,).-, @@ -730720,7 +746398,6 @@ 15:u00:phenotypes., 6:u02:MT, 10:u12:panama, -7:u22:PAN, 8:u23:PANA, 11:uI0:,[](-),, 10:u03:PANAMA, @@ -731816,47 +747493,33 @@ 14:u10:of+gene)c+, 11:u00:frac)on, 14:u01:of+gene)c+, -11:u08:grouped, 14:u00:of+gene)c+, 9:u07:(GxE), 9:u06:(GxE), -11:u07:grouped, 9:u14:(gxe), 9:u05:(GxE), -11:u06:grouped, 7:u08:GxE, 9:u13:(gxe), -11:u14:grouped, 9:u04:(GxE), -11:u05:grouped, 9:u12:(gxe), -11:u13:grouped, 7:u22:(Gx, 8:u23:(GxE, 9:u03:(GxE), -11:u04:grouped, 7:u07:GxE, 9:u11:(gxe), -11:u12:grouped, 9:u02:(GxE), -11:u03:grouped, 7:u06:GxE, 9:u10:(gxe), -11:u11:grouped, 7:u14:gxe, 9:u01:(GxE), -11:u02:grouped, 7:u05:GxE, -11:u10:grouped, 7:u13:gxe, 9:u00:(GxE), -11:u01:grouped, 7:u04:GxE, 7:u12:gxe, 6:u21:Gx, 7:u22:GxE, 7:u23:GxE, -11:u00:grouped, 7:u03:GxE, 7:u11:gxe, 7:u02:GxE, @@ -731870,17 +747533,14 @@ 8:u08:bar., 7:u14:(22, 9:uI1:(-).(, -9:uI2:.).,-, 7:u05:(22, 7:u13:(22, 9:uI0:(-).(, -9:uI1:.).,-, 7:u04:(22, 8:u07:bar., 15:u08:(iterations, 7:u12:(22, 7:u23:(22, -9:uI0:.).,-, 11:uI2:(.).:--, 7:u03:(22, 8:u06:bar., @@ -732037,7 +747697,6 @@ 17:u11:*abdolhossein, 11:u12:mirzaei, 8:u23:MIRZ, -10:uI2:..,,,,, 14:u00:Leishmania, 17:u01:Leishmaniasis, 17:u02:*Abdolhossein, @@ -732046,13 +747705,11 @@ 10:u02:DALIMI, 17:u10:*abdolhossein, 11:u11:mirzaei, -10:uI1:..,,,,, 17:u00:Leishmaniasis, 17:u01:*Abdolhossein, 11:u02:MIRZAEI, 10:u01:DALIMI, 11:u10:mirzaei, -10:uI0:..,,,,, 17:u00:*Abdolhossein, 11:u01:MIRZAEI, 10:u00:DALIMI, @@ -732304,7 +747961,6 @@ 10:u03:Dalimi, 7:u05:568, 11:u07:isceral, -12:u08:systemic, 21:u10:http://tums.ac.ir, 10:u11:dalimi, 7:u13:568, @@ -732314,7 +747970,6 @@ 11:u06:isceral, 12:u07:fectious, 10:u08:World., -12:u07:systemic, 10:u10:dalimi, 7:u12:568, 11:u14:isceral, @@ -732325,7 +747980,6 @@ 7:u03:568, 11:u05:isceral, 12:u06:fectious, -12:u06:systemic, 7:u11:568, 11:u13:isceral, 12:u14:fectious, @@ -732334,7 +747988,6 @@ 11:u04:isceral, 12:u05:fectious, 10:u07:World., -12:u05:systemic, 14:u08:protozoans, 7:u10:568, 11:u12:isceral, @@ -732344,7 +747997,6 @@ 11:u03:isceral, 12:u04:fectious, 10:u06:World., -12:u04:systemic, 14:u07:protozoans, 11:u11:isceral, 12:u12:fectious, @@ -732353,27 +748005,23 @@ 12:u03:fectious, 10:u05:World., 9:u08:bites, -12:u03:systemic, 14:u06:protozoans, 11:u10:isceral, 12:u11:fectious, 11:u01:isceral, 12:u02:fectious, 10:u04:World., -12:u02:systemic, 14:u05:protozoans, 12:u10:fectious, 11:u00:isceral, 12:u01:fectious, 10:u03:World., 9:u07:bites, -12:u01:systemic, 14:u04:protozoans, 13:u08:syndromes, 12:u00:fectious, 10:u02:World., 9:u06:bites, -12:u00:systemic, 14:u03:protozoans, 13:u07:syndromes, 9:u14:bites, @@ -732704,33 +748352,19 @@ 8:u03:sess, 8:u11:sess, 8:u02:sess, -12:u08:fication, 13:u08:amplifies, 8:u10:sess, 8:u01:sess, 13:u07:amplifies, 8:u00:sess, -12:u07:fication, 13:u06:amplifies, -12:u06:fication, 13:u05:amplifies, -12:u14:fication, -12:u05:fication, 13:u04:amplifies, -12:u13:fication, -12:u04:fication, 13:u03:amplifies, -12:u12:fication, -12:u03:fication, 13:u02:amplifies, -12:u11:fication, -12:u02:fication, 13:u01:amplifies, -12:u10:fication, -12:u01:fication, 13:u00:amplifies, 16:u08:(2014-2015),, -12:u00:fication, 16:u07:(2014-2015),, 9:u08:Iran., 16:u06:(2014-2015),, @@ -734172,21 +749806,18 @@ 21:u10:transilluminator., 13:u11:fragments, 12:u13:infantum, -10:uI2:(///)., 21:u01:transilluminator., 23:u04:(MCAN/IR/96/LON49)., 15:u07:semi-nested, 8:u08:spp., 13:u10:fragments, 12:u12:infantum, -10:uI1:(///)., 21:u00:transilluminator., 9:u07:mania, 23:u03:(MCAN/IR/96/LON49)., 15:u06:semi-nested, 8:u07:spp., 12:u11:infantum, -10:uI0:(///)., 9:u06:mania, 23:u02:(MCAN/IR/96/LON49)., 15:u05:semi-nested, @@ -735220,7 +750851,6 @@ 11:u05:lecular, 12:u04:focuses,, 11:u13:lecular, -7:u22:lei, 8:u23:leis, 11:u04:lecular, 12:u03:focuses,, @@ -735568,7 +751198,6 @@ 11:u10:desjeux, 11:u12:crobiol, 9:u14:alvar, -8:u23:crob, 11:u01:Desjeux, 11:u03:crobiol, 9:u05:Alvar, @@ -737108,13 +752737,10 @@ 20:u07:stratification.., 20:u06:stratification.., 20:u14:stratification.., -10:uI2:-(,,,), 20:u05:stratification.., 20:u13:stratification.., -10:uI1:-(,,,), 20:u04:stratification.., 20:u12:stratification.., -10:uI0:-(,,,), 20:u03:stratification.., 20:u11:stratification.., 20:u02:stratification.., @@ -741269,28 +756895,23 @@ 12:u06:discover, 10:u03:(OCFs), 6:u05:qe, -12:u14:discover, 13:uI0:()[]-[].-, 12:u05:discover, 10:u02:(OCFs), 6:u04:qe, -12:u13:discover, 8:uI2:.,;,, 12:u04:discover, 10:u01:(OCFs), 6:u03:qe, -12:u12:discover, 8:uI1:.,;,, 10:uI2:;(,,.,, 12:u03:discover, 10:u00:(OCFs), 6:u02:qe, -12:u11:discover, 8:uI0:.,;,, 10:uI1:;(,,.,, 12:u02:discover, 6:u01:qe, -12:u10:discover, 10:uI0:;(,,.,, 12:u01:discover, 6:u00:qe, @@ -743220,14 +758841,12 @@ 14:u04:placement;, 24:u05:oropharyngolaryngeal, 14:u05:morbidity,, -15:u08:open-label,, 14:u12:placement;, 24:u13:oropharyngolaryngeal, 14:u03:placement;, 24:u04:oropharyngolaryngeal, 16:u07:prospective,, 14:u04:morbidity,, -15:u07:open-label,, 14:u11:placement;, 24:u12:oropharyngolaryngeal, 8:u23:orop, @@ -743235,7 +758854,6 @@ 24:u03:oropharyngolaryngeal, 16:u06:prospective,, 14:u03:morbidity,, -15:u06:open-label,, 14:u10:placement;, 24:u11:oropharyngolaryngeal, 16:u14:prospective,, @@ -743243,37 +758861,31 @@ 24:u02:oropharyngolaryngeal, 22:u08:gastro-oesophageal, 14:u02:morbidity,, -15:u05:open-label,, 13:u08:placement, 24:u10:oropharyngolaryngeal, 9:uI2:,-,.,, 14:u00:placement;, 24:u01:oropharyngolaryngeal, 14:u01:morbidity,, -15:u04:open-label,, 13:u07:placement, 10:u08:reflux, 9:uI1:,-,.,, 24:u00:oropharyngolaryngeal, 22:u07:gastro-oesophageal, 14:u00:morbidity,, -15:u03:open-label,, 13:u06:placement, 10:u07:reflux, 9:uI0:,-,.,, 22:u06:gastro-oesophageal, -15:u02:open-label,, 13:u05:placement, 10:u06:reflux, 22:u14:gastro-oesophageal, 22:u05:gastro-oesophageal, -15:u01:open-label,, 13:u04:placement, 10:u05:reflux, 14:u08:necessary,, 22:u13:gastro-oesophageal, 22:u04:gastro-oesophageal, -15:u00:open-label,, 13:u03:placement, 10:u04:reflux, 14:u07:necessary,, @@ -744669,14 +760281,12 @@ 14:u11:paralyzed,, 13:u12:15502065], 13:uI0:,..;:-.[:, -13:uI2:.,...;:-., 14:u02:paralyzed,, 13:u03:15502065], 13:u01:Unique™, 13:u05:10861152], 14:u10:paralyzed,, 13:u11:15502065], -13:uI1:.,...;:-., 14:u01:paralyzed,, 13:u02:15502065], 19:u07:Anesthesiology., @@ -744684,7 +760294,6 @@ 13:u00:Unique™, 13:u04:10861152], 13:u10:15502065], -13:uI0:.,...;:-., 14:u00:paralyzed,, 13:u01:15502065], 19:u06:Anesthesiology., @@ -744800,7 +760409,6 @@ 12:u12:9579506], 7:u22:957, 8:u23:9579, -11:uI2:.,,,.,-, 17:u02:spontaneously, 12:u03:9579506], 15:u05:SoftSeal™, @@ -744810,7 +760418,6 @@ 10:u07:Shafik, 17:u10:spontaneously, 12:u11:9579506], -11:uI1:.,,,.,-, 17:u01:spontaneously, 12:u02:9579506], 15:u04:SoftSeal™, @@ -744819,7 +760426,6 @@ 13:u05:15766338], 10:u06:Shafik, 12:u10:9579506], -11:uI0:.,,,.,-, 17:u00:spontaneously, 12:u01:9579506], 15:u03:SoftSeal™, @@ -745848,31 +761454,22 @@ 13:u03:inversely, 13:u11:inversely, 13:u02:inversely, -7:u08:dye, 13:u10:inversely, 13:u01:inversely, -7:u07:dye, 13:u00:inversely, -7:u06:dye, 9:u08:FRET., -7:u05:dye, 9:u07:FRET., -7:u04:dye, 9:u06:FRET., 12:u08:bilayer/, -7:u03:dye, 9:u05:FRET., 12:u07:bilayer/, 13:u08:CD3ζ-GFP, -7:u02:dye, 9:u04:FRET., 12:u06:bilayer/, -7:u01:dye, 9:u03:FRET., 12:u05:bilayer/, 13:u07:CD3ζ-GFP, 7:u08:Cy3, -7:u00:dye, 9:u02:FRET., 12:u04:bilayer/, 13:u06:CD3ζ-GFP, @@ -747014,7 +762611,6 @@ 13:u06:TCR/CD3ζ, 11:u07:ImageJ,, 8:u05:bar:, -9:u08:Figs., 14:u10:acceptor),, 10:u12:to-hot, 13:u14:tcr/cd3ζ, @@ -747025,7 +762621,6 @@ 13:u05:TCR/CD3ζ, 11:u06:ImageJ,, 8:u04:bar:, -9:u07:Figs., 10:u11:to-hot, 13:u13:tcr/cd3ζ, 11:u14:imagej,, @@ -747035,7 +762630,6 @@ 13:u04:TCR/CD3ζ, 11:u05:ImageJ,, 8:u03:bar:, -9:u06:Figs., 10:u10:to-hot, 13:u12:tcr/cd3ζ, 11:u13:imagej,, @@ -747045,7 +762639,6 @@ 13:u03:TCR/CD3ζ, 11:u04:ImageJ,, 8:u02:bar:, -9:u05:Figs., 13:u11:tcr/cd3ζ, 11:u12:imagej,, 11:uI2:,.,...-, @@ -747054,7 +762647,6 @@ 11:u03:ImageJ,, 22:u08:antigen-presenting, 8:u01:bar:, -9:u04:Figs., 13:u10:tcr/cd3ζ, 11:u11:imagej,, 11:uI1:,.,...-, @@ -747062,7 +762654,6 @@ 13:u01:TCR/CD3ζ, 11:u02:ImageJ,, 8:u00:bar:, -9:u03:Figs., 11:u10:imagej,, 11:uI0:,.,...-, 11:uI1:-()().-, @@ -747070,16 +762661,13 @@ 13:u00:TCR/CD3ζ, 11:u01:ImageJ,, 22:u07:antigen-presenting, -9:u02:Figs., 11:uI0:-()().-, 11:uI1:()().--, 11:u00:ImageJ,, 22:u06:antigen-presenting, -9:u01:Figs., 22:u14:antigen-presenting, 11:uI0:()().--, 22:u05:antigen-presenting, -9:u00:Figs., 22:u13:antigen-presenting, 22:u04:antigen-presenting, 22:u12:antigen-presenting, @@ -747515,11 +763103,8 @@ 17:u04:piezoelectric, 11:uI0:.-..-(), 17:u03:piezoelectric, -13:uI2:.(),(),(), 17:u02:piezoelectric, -13:uI1:.(),(),(), 17:u01:piezoelectric, -13:uI0:.(),(),(), 17:u00:piezoelectric, 10:uI2:()..--, 10:uI1:()..--, @@ -750776,19 +766361,16 @@ 12:u04:Jonsson,, 10:u07:Xiong,, 10:uI1:.,../-, -11:uI2:.....,-, 8:u00:202,, 13:u00:1031-1036, 9:u01:Hong,, 12:u03:Jonsson,, 10:u06:Xiong,, 10:uI0:.,../-, -11:uI1:.....,-, 13:u07:5659-5667, 9:u00:Hong,, 12:u02:Jonsson,, 10:u05:Xiong,, -11:uI0:.....,-, 13:u06:5659-5667, 12:u01:Jonsson,, 10:u04:Xiong,, @@ -751253,21 +766835,18 @@ 12:u05:Krutzik,, 9:u08:Huse,, 13:u10:tracking., -18:uI2:.,..,,.,,..,.., 13:u01:tracking., 12:u00:Tinevez,, 14:u02:Dominguez,, 12:u04:Krutzik,, 9:u07:Huse,, 12:u08:agonist., -18:uI1:.,..,,.,,..,.., 13:u00:tracking., 20:u07:photoactivatable, 14:u01:Dominguez,, 12:u03:Krutzik,, 9:u06:Huse,, 12:u07:agonist., -18:uI0:.,..,,.,,..,.., 20:u06:photoactivatable, 14:u00:Dominguez,, 12:u02:Krutzik,, @@ -751388,30 +766967,25 @@ 18:u08:Hirschsprung's, 13:u03:neoplasia, 13:u07:reserved., -7:u08:RET, 17:u10:spermatogonia, 17:u01:spermatogonia, 13:u02:neoplasia, 13:u06:reserved., -7:u07:RET, 10:u14:rights, 17:u00:spermatogonia, 18:u07:Hirschsprung's, 13:u01:neoplasia, 13:u05:reserved., -7:u06:RET, 10:u13:rights, 18:u06:Hirschsprung's, 7:u08:362, 13:u00:neoplasia, 13:u04:reserved., -7:u05:RET, 10:u12:rights, 18:u14:hirschsprung's, 11:uI2::-;-;;;, 18:u05:Hirschsprung's, 13:u03:reserved., -7:u04:RET, 10:u11:rights, 18:u13:hirschsprung's, 11:uI1::-;-;;;, @@ -751419,7 +766993,6 @@ 7:u07:362, 7:u08:363, 13:u02:reserved., -7:u03:RET, 8:u08:GDNF, 10:u10:rights, 18:u12:hirschsprung's, @@ -751427,7 +767000,6 @@ 18:u03:Hirschsprung's, 7:u06:362, 13:u01:reserved., -7:u02:RET, 8:u07:GDNF, 18:u11:hirschsprung's, 7:u14:362, @@ -751438,7 +767010,6 @@ 7:u07:363, 7:u08:364, 13:u00:reserved., -7:u01:RET, 8:u06:GDNF, 18:u10:hirschsprung's, 7:u13:362, @@ -751447,7 +767018,6 @@ 18:u01:Hirschsprung's, 7:u04:362, 7:u06:363, -7:u00:RET, 8:u05:GDNF, 7:u12:362, 7:u14:363, @@ -751654,30 +767224,22 @@ 18:u08:proto-oncogene, 54:uI1:.................................................., 6:uI1:50, -7:u14:ret, 54:uI0:.................................................., 6:uI0:50, 18:u07:proto-oncogene, 20:u08:cadherin-related, -7:u13:ret, 18:u06:proto-oncogene, 12:u08:10q11.2., 20:u07:cadherin-related, -7:u12:ret, 18:u14:proto-oncogene, -7:u22:RET, -7:u23:RET, 18:u05:proto-oncogene, 20:u06:cadherin-related, 10:u08:[4-7]., -7:u11:ret, 18:u13:proto-oncogene, 18:u04:proto-oncogene, 12:u07:10q11.2., -12:u08:splicing, 20:u05:cadherin-related, 10:u07:[4-7]., -7:u10:ret, 18:u12:proto-oncogene, 18:u03:proto-oncogene, 12:u06:10q11.2., @@ -751687,7 +767249,6 @@ 12:u14:10q11.2., 18:u02:proto-oncogene, 12:u05:10q11.2., -12:u07:splicing, 20:u03:cadherin-related, 10:u05:[4-7]., 18:u10:proto-oncogene, @@ -751695,7 +767256,6 @@ 13:uI2:..[-].,(,, 18:u01:proto-oncogene, 12:u04:10q11.2., -12:u06:splicing, 20:u02:cadherin-related, 10:u04:[4-7]., 12:u12:10q11.2., @@ -751705,7 +767265,6 @@ 13:uI1:..[-].,(,, 18:u00:proto-oncogene, 12:u03:10q11.2., -12:u05:splicing, 12:u08:mocytoma, 20:u01:cadherin-related, 10:u03:[4-7]., @@ -751715,7 +767274,6 @@ 13:uI0:..[-].,(,, 9:uI2:[,](., 12:u02:10q11.2., -12:u04:splicing, 20:u00:cadherin-related, 10:u02:[4-7]., 9:u07:crest, @@ -751723,25 +767281,21 @@ 12:u12:splicing, 9:uI1:[,](., 12:u01:10q11.2., -12:u03:splicing, 12:u07:mocytoma, 10:u01:[4-7]., 9:u06:crest, 12:u11:splicing, 9:uI0:[,](., 12:u00:10q11.2., -12:u02:splicing, 12:u06:mocytoma, 10:u00:[4-7]., 9:u05:crest, 12:u10:splicing, 12:u14:mocytoma, -12:u01:splicing, 12:u05:mocytoma, 12:u08:drenalin, 9:u04:crest, 12:u13:mocytoma, -12:u00:splicing, 12:u04:mocytoma, 9:u03:crest, 12:u12:mocytoma, @@ -751900,7 +767454,6 @@ 15:u05:(RET/PTC5),, 12:u06:kinectin, 15:u07:(ELKS/RET)., -14:u08:carcinoma,, 13:u00:papillary, 17:u04:ELE1(RET/PTC3, 8:u05:hTIF, @@ -751934,7 +767487,6 @@ 15:u03:(RET/PTC5),, 12:u04:kinectin, 15:u05:(ELKS/RET)., -14:u07:carcinoma,, 17:u02:ELE1(RET/PTC3, 8:u03:hTIF, 15:u04:(RET/PTC8),, @@ -751949,7 +767501,6 @@ 15:u02:(RET/PTC5),, 12:u03:kinectin, 15:u04:(ELKS/RET)., -14:u06:carcinoma,, 17:u01:ELE1(RET/PTC3, 8:u02:hTIF, 15:u03:(RET/PTC8),, @@ -751957,7 +767508,6 @@ 15:u10:(ret/ptc5),, 12:u11:kinectin, 15:u12:(elks/ret)., -14:u14:carcinoma,, 7:u22:(EL, 8:u23:(ELK, 11:uI0:(/),(/), @@ -751966,39 +767516,29 @@ 15:u01:(RET/PTC5),, 12:u02:kinectin, 15:u03:(ELKS/RET)., -14:u05:carcinoma,, 17:u00:ELE1(RET/PTC3, 8:u01:hTIF, 15:u02:(RET/PTC8),, 9:u07:-35%), 12:u10:kinectin, 15:u11:(elks/ret)., -14:u13:carcinoma,, 10:uI0:(/).,/, 15:u00:(RET/PTC5),, 12:u01:kinectin, 15:u02:(ELKS/RET)., -14:u04:carcinoma,, 8:u00:hTIF, 15:u01:(RET/PTC8),, 9:u06:-35%), 15:u10:(elks/ret)., -14:u12:carcinoma,, 12:u00:kinectin, 15:u01:(ELKS/RET)., -14:u03:carcinoma,, 15:u00:(RET/PTC8),, 9:u05:-35%), -14:u11:carcinoma,, 15:u00:(ELKS/RET)., -14:u02:carcinoma,, 9:u04:-35%), -14:u10:carcinoma,, 9:uI2:[,](), -14:u01:carcinoma,, 9:u03:-35%), 9:uI1:[,](), -14:u00:carcinoma,, 9:u02:-35%), 9:uI0:[,](), 9:u01:-35%), @@ -752165,7 +767705,6 @@ 9:u08:Y905,, 7:u00:[42, 9:u12:hscr,, -6:u21:HS, 7:u22:HSC, 8:u23:HSCR, 9:u03:HSCR,, @@ -752677,7 +768216,6 @@ 8:u04:AKT,, 10:u03:(ERK),, 8:u12:akt,, -7:u22:AKT, 8:u23:AKT,, 11:uI0:(),-()/, 12:uI2:--()[-]., @@ -753258,7 +768796,6 @@ 6:u22:2B, 6:u23:2B, 6:u03:2B, -12:u08:germline, 10:u03:[109]., 7:u04:883, 15:u05:(designated, @@ -753269,42 +768806,35 @@ 15:u04:(designated, 6:u10:2b, 6:u01:2B, -12:u07:germline, 12:u08:teristic, 10:u01:[109]., 7:u02:883, 15:u03:(designated, 6:u00:2B, -12:u06:germline, 10:u00:[109]., 7:u01:883, 15:u02:(designated, -12:u05:germline, 12:u07:teristic, 11:u08:corneal, 7:u00:883, 15:u01:(designated, 12:u08:neuroma,, -12:u04:germline, 12:u06:teristic, 15:u00:(designated, 12:u07:neuroma,, 10:u08:nerves, 12:u14:teristic, -12:u03:germline, 12:u05:teristic, 11:u07:corneal, 12:u06:neuroma,, 10:u07:nerves, 12:u13:teristic, -12:u02:germline, 12:u04:teristic, 11:u06:corneal, 12:u05:neuroma,, 10:u06:nerves, 12:u12:teristic, 11:u14:corneal, -12:u01:germline, 12:u03:teristic, 11:u05:corneal, 9:u08:MEN2B, @@ -753312,7 +768842,6 @@ 10:u05:nerves, 12:u11:teristic, 11:u13:corneal, -12:u00:germline, 12:u02:teristic, 11:u04:corneal, 12:u03:neuroma,, @@ -753685,8 +769214,6 @@ 8:u04:JNK,, 11:u07:Billaud, 13:u12:pi3k/akt,, -7:u22:PI3, -8:u23:PI3K, 9:uI1:/,,/-, 14:u00:RET-MEN2A,, 13:u03:PI3K/AKT,, @@ -753710,7 +769237,6 @@ 14:uI0:(.)[,,].,-, 13:u00:PI3K/AKT,, 12:u05:RET-MEN2, -14:u08:mutations., 8:u00:JNK,, 11:u03:Billaud, 12:u13:ret-men2, @@ -753718,37 +769244,29 @@ 11:u02:Billaud, 12:u12:ret-men2, 12:u03:RET-MEN2, -14:u07:mutations., 11:u01:Billaud, 12:u11:ret-men2, 12:u02:RET-MEN2, -14:u06:mutations., 11:u00:Billaud, 12:u10:ret-men2, 14:u14:mutations., 12:u01:RET-MEN2, -14:u05:mutations., 16:u08:Transforming, 14:u13:mutations., 12:u00:RET-MEN2, -14:u04:mutations., 20:u08:Disulfide-linked, 14:u12:mutations., -14:u03:mutations., 16:u07:Transforming, 13:u08:Tyrosines, 14:u11:mutations., -14:u02:mutations., 16:u06:Transforming, 20:u07:Disulfide-linked, 13:u08:Phenotype, 14:u10:mutations., -14:u01:mutations., 16:u05:Transforming, 20:u06:Disulfide-linked, 13:u07:Tyrosines, 20:u14:disulfide-linked, -14:u00:mutations., 16:u04:Transforming, 20:u05:Disulfide-linked, 13:u06:Tyrosines, @@ -753766,7 +769284,6 @@ 13:u04:Tyrosines, 13:u05:Phenotype, 20:u11:disulfide-linked, -8:u23:Tyro, 16:u01:Transforming, 20:u02:Disulfide-linked, 13:u03:Tyrosines, @@ -754320,18 +769837,13 @@ 12:u02:dogenous, 16:u06:Heterozygous, 12:u10:dogenous, -9:u14:gene., 12:u01:dogenous, 16:u05:Heterozygous, -9:u13:gene., 12:u00:dogenous, 16:u04:Heterozygous, -9:u12:gene., 16:u03:Heterozygous, -9:u11:gene., 21:u08:pheochromocytoma., 16:u02:Heterozygous, -9:u10:gene., 16:u01:Heterozygous, 21:u07:pheochromocytoma., 20:u08:glioneuromatosis, @@ -754950,7 +770462,6 @@ 15:u13:1993;8:1087, 14:u00:1989;4:805, 15:u04:1993;8:1087, -14:u08:terization, 11:u01:Iwamoto, 8:u04:-91., 12:u05:Ishizaka, @@ -754964,48 +770475,35 @@ 10:u07:Tahira, 15:u11:1993;8:1087, 15:u02:1993;8:1087, -14:u07:terization, 8:u02:-91., 12:u03:Ishizaka, 10:u06:Tahira, 15:u10:1993;8:1087, 15:u01:1993;8:1087, -14:u06:terization, 8:u01:-91., 12:u02:Ishizaka, 10:u05:Tahira, -14:u14:terization, 15:u00:1993;8:1087, -14:u05:terization, 8:u00:-91., 12:u01:Ishizaka, 10:u04:Tahira, 9:u08:Myers, -14:u13:terization, -14:u04:terization, 12:u00:Ishizaka, 10:u03:Tahira, 9:u07:Myers, -14:u12:terization, -14:u03:terization, 16:u08:1995;11:2039, 10:u02:Tahira, 9:u06:Myers, 10:u08:sites:, -14:u11:terization, -14:u02:terization, 10:u01:Tahira, 9:u05:Myers, 10:u07:sites:, 8:u08:-45., -14:u10:terization, -14:u01:terization, 16:u07:1995;11:2039, 10:u00:Tahira, 9:u04:Myers, 10:u06:sites:, 8:u07:-45., -14:u00:terization, 16:u06:1995;11:2039, 17:u08:neuroblastoma, 9:u03:Myers, @@ -755723,7 +771221,6 @@ 7:u07:Jpn, 7:u08:Zou, 7:u05:ret, -9:u08:Saudi, 15:u02:1991;6:1667, 13:u03:Wajjwalku, 13:u04:Funahashi, @@ -755740,7 +771237,6 @@ 11:u08:Arabia., 7:u23:ret, 7:u03:ret, -9:u07:Saudi, 16:u08:Komissarenko, 15:u00:1991;6:1667, 13:u01:Wajjwalku, @@ -755750,7 +771246,6 @@ 12:u06:(PTC/ret, 11:u07:Arabia., 7:u02:ret, -9:u06:Saudi, 13:u00:Wajjwalku, 13:u01:Funahashi, 7:u03:Jpn, @@ -755760,7 +771255,6 @@ 7:u08:IV,, 9:u14:saudi, 7:u01:ret, -9:u05:Saudi, 16:u07:Komissarenko, 13:u08:accident., 13:u00:Funahashi, @@ -755771,7 +771265,6 @@ 7:u07:IV,, 9:u13:saudi, 7:u00:ret, -9:u04:Saudi, 16:u06:Komissarenko, 7:u01:Jpn, 7:u02:Zou, @@ -755781,7 +771274,6 @@ 9:u12:saudi, 16:u14:komissarenko, 8:u23:Saud, -9:u03:Saudi, 16:u05:Komissarenko, 13:u07:accident., 7:u00:Jpn, @@ -755792,7 +771284,6 @@ 13:u08:Fugazzola, 9:u11:saudi, 16:u13:komissarenko, -9:u02:Saudi, 16:u04:Komissarenko, 13:u06:accident., 7:u00:Zou, @@ -755805,7 +771296,6 @@ 13:u14:accident., 7:u22:Kom, 8:u23:Komi, -9:u01:Saudi, 16:u03:Komissarenko, 13:u05:accident., 11:u08:exposed, @@ -755815,7 +771305,6 @@ 13:u06:Fugazzola, 16:u11:komissarenko, 13:u13:accident., -9:u00:Saudi, 16:u02:Komissarenko, 13:u04:accident., 16:u08:1995;55:5617, @@ -757954,28 +773443,23 @@ 13:u04:Poteryaev, 7:u07:a1., 10:u11:commun, -7:u14:src, 7:u05:Src, 13:u03:Poteryaev, 7:u06:a1., 10:u10:commun, -7:u13:src, 7:u04:Src, 13:u02:Poteryaev, 7:u05:a1., 7:u08:Hö, -7:u12:src, 7:u23:Src, 7:u03:Src, 13:u01:Poteryaev, 7:u04:a1., 7:u07:Hö, -7:u11:src, 7:u02:Src, 13:u00:Poteryaev, 7:u03:a1., 7:u06:Hö, -7:u10:src, 7:u01:Src, 7:u02:a1., 7:u05:Hö, @@ -760138,7 +775622,6 @@ 9:u07:20.52, 8:u12:neg., 7:u13:379, -8:u14:12.4, 8:u23:Neg., 8:u03:Neg., 7:u04:379, @@ -760146,7 +775629,6 @@ 9:u07:15.46, 8:u11:neg., 7:u12:379, -8:u13:12.4, 9:u14:20.52, 7:u23:379, 8:u02:Neg., @@ -760156,7 +775638,6 @@ 8:u08:4.05, 8:u10:neg., 7:u11:379, -8:u12:12.4, 9:u13:20.52, 9:u14:15.46, 8:u01:Neg., @@ -760165,7 +775646,6 @@ 9:u05:15.46, 9:u08:16.75, 7:u10:379, -8:u11:12.4, 9:u12:20.52, 9:u13:15.46, 8:u23:20.5, @@ -760175,7 +775655,6 @@ 9:u04:15.46, 8:u07:4.05, 8:u08:6.53, -8:u10:12.4, 9:u11:20.52, 9:u12:15.46, 7:u00:379, @@ -761036,7 +776515,6 @@ 8:u04:1005, 9:u06:19.53, 8:u07:7.93, -8:u08:1876, 9:u10:11.62, 8:u12:1005, 9:u14:19.53, @@ -761053,7 +776531,6 @@ 8:u02:1005, 9:u04:19.53, 8:u05:7.93, -8:u07:1876, 9:u08:35.26, 9:u08:54.46, 8:u10:1005, @@ -761062,56 +776539,44 @@ 8:u01:1005, 9:u03:19.53, 8:u04:7.93, -8:u06:1876, 9:u07:26.07, 9:u07:54.46, 9:u11:19.53, 8:u12:7.93, -8:u14:1876, 8:u23:7.93, 8:u00:1005, 9:u02:19.53, 8:u03:7.93, -8:u05:1876, 9:u06:26.07, 9:u07:35.26, 9:u06:54.46, 9:u10:19.53, 8:u11:7.93, -8:u13:1876, 9:u14:26.07, 9:u01:19.53, 8:u02:7.93, -8:u04:1876, 9:u05:26.07, 9:u06:35.26, 11:u08:events:, 9:u05:54.46, 8:u10:7.93, -8:u12:1876, 9:u13:26.07, 9:u14:35.26, -8:u23:1876, 9:u00:19.53, 8:u01:7.93, -8:u03:1876, 9:u04:26.07, 9:u05:35.26, 9:u04:54.46, -8:u11:1876, 9:u12:26.07, 9:u13:35.26, 8:u23:26.0, 8:u00:7.93, -8:u02:1876, 9:u03:26.07, 9:u04:35.26, 11:u07:events:, 9:u03:54.46, -8:u10:1876, 9:u11:26.07, 9:u12:35.26, -8:u01:1876, 9:u02:26.07, 9:u03:35.26, 11:u06:events:, @@ -761120,7 +776585,6 @@ 9:u10:26.07, 9:u11:35.26, 11:u14:events:, -8:u00:1876, 9:u01:26.07, 9:u02:35.26, 11:u05:events:, @@ -761532,7 +776996,6 @@ 14:u12:oxidation,, 16:u14:double-edged, 9:uI1:,.[,], -8:uI2:()/,, 14:u03:oxidation,, 16:u05:double-edged, 10:u05:sword,, @@ -761540,14 +777003,12 @@ 14:u11:oxidation,, 16:u13:double-edged, 9:uI0:,.[,], -8:uI1:()/,, 14:u02:oxidation,, 16:u04:double-edged, 10:u04:sword,, 8:u06:[8b], 14:u10:oxidation,, 16:u12:double-edged, -8:uI0:()/,, 14:u01:oxidation,, 16:u03:double-edged, 10:u03:sword,, @@ -761761,7 +777222,6 @@ 9:u12:eebe,, 7:u13:[d], 8:u14:alba, -6:u21:EE, 7:u22:EEB, 8:u23:EEBE, 13:u01:Barcelona, @@ -761861,7 +777321,6 @@ 10:u07:K-edge, 8:u12:5372, 15:u13:chemcatchem, -7:u22:537, 8:u23:5372, 8:u03:5372, 15:u04:ChemCatChem, @@ -763136,7 +778595,6 @@ 12:u08:719-728;, 14:u12:6122-6127;, 15:u13:weckhuysen,, -7:u22:612, 8:u23:6122, 20:uI0:,..,..,.......,,, 19:uI1:-;).,...,...,.., @@ -763538,32 +778996,18 @@ 13:u04:assertion, 13:u12:assertion, 13:u03:assertion, -12:u08:Missense, 13:u11:assertion, 13:u02:assertion, 13:u10:assertion, 13:u01:assertion, -12:u07:Missense, 11:u08:ClinVar, 13:u00:assertion, -12:u06:Missense, 11:u07:ClinVar, -12:u14:missense, -12:u05:Missense, 11:u06:ClinVar, -12:u13:missense, -12:u04:Missense, 11:u05:ClinVar, -12:u12:missense, -12:u03:Missense, 11:u04:ClinVar, -12:u11:missense, -12:u02:Missense, 11:u03:ClinVar, -12:u10:missense, -12:u01:Missense, 11:u02:ClinVar, -12:u00:Missense, 11:u01:ClinVar, 11:u00:ClinVar, 9:u08:14819, @@ -763873,29 +779317,13 @@ 8:uI2:/,"", 12:u11:earlier., 8:uI1:/,"", -8:u08:CADD, 12:u10:earlier., 8:uI0:/,"", -8:u07:CADD, -8:u06:CADD, -8:u14:cadd, -8:u05:CADD, -8:u13:cadd, -8:u04:CADD, -8:u12:cadd, -7:u22:CAD, -8:u23:CADD, -8:u03:CADD, 11:u08:star(F), -8:u11:cadd, 9:uI2:.))/:, -8:u02:CADD, -8:u10:cadd, 9:uI1:.))/:, -8:u01:CADD, 11:u07:star(F), 9:uI0:.))/:, -8:u00:CADD, 11:u06:star(F), 11:u14:star(f), 11:u05:star(F), @@ -763965,32 +779393,27 @@ 11:u06:adhered, 8:u07:vote, 9:u07:rule., -7:u08:VUS, 11:u14:adhered, 11:u05:adhered, 8:u06:vote, 9:u06:rule., -7:u07:VUS, 11:u13:adhered, 8:u14:vote, 11:u04:adhered, 8:u05:vote, 9:u05:rule., -7:u06:VUS, 12:u08:guidance, 11:u12:adhered, 8:u13:vote, 11:u03:adhered, 8:u04:vote, 9:u04:rule., -7:u05:VUS, 12:u07:guidance, 11:u11:adhered, 8:u12:vote, 11:u02:adhered, 8:u03:vote, 9:u03:rule., -7:u04:VUS, 12:u06:guidance, 11:u10:adhered, 8:u11:vote, @@ -763998,33 +779421,21 @@ 8:u02:vote, 16:u08:infrequently, 9:u02:rule., -7:u03:VUS, 12:u05:guidance, 8:u10:vote, -7:u14:vus, 11:u00:adhered, 8:u01:vote, 9:u01:rule., -7:u02:VUS, 12:u04:guidance, -7:u13:vus, 8:u00:vote, 16:u07:infrequently, 9:u00:rule., -7:u01:VUS, 12:u03:guidance, -7:u12:vus, -6:u21:VU, -7:u22:VUS, -7:u23:VUS, 16:u06:infrequently, -7:u00:VUS, 12:u02:guidance, -7:u11:vus, 16:u14:infrequently, 16:u05:infrequently, 12:u01:guidance, -7:u10:vus, 16:u13:infrequently, 16:u04:infrequently, 12:u00:guidance, @@ -765364,7 +780775,6 @@ 8:u23:Susc, 12:u02:Maxwell,, 11:u06:Sawyer,, -11:u08:Bailey,, 8:u02:K.N., 12:u07:odyssey:, 12:u10:maxwell,, @@ -765378,7 +780788,6 @@ 9:uI2:,...-, 12:u00:Maxwell,, 11:u04:Sawyer,, -11:u07:Bailey,, 8:u00:K.N., 12:u05:odyssey:, 8:u07:J.N., @@ -765388,7 +780797,6 @@ 9:uI1:,...-, 11:uI2::.,-()., 11:u03:Sawyer,, -11:u06:Bailey,, 12:u04:odyssey:, 8:u06:J.N., 11:u11:sawyer,, @@ -765396,31 +780804,25 @@ 9:uI0:,...-, 11:uI1::.,-()., 11:u02:Sawyer,, -11:u05:Bailey,, 12:u03:odyssey:, 8:u05:J.N., 11:u10:sawyer,, 11:u13:bailey,, 11:uI0::.,-()., 11:u01:Sawyer,, -11:u04:Bailey,, 12:u02:odyssey:, 8:u04:J.N., 11:u12:bailey,, 11:u00:Sawyer,, -11:u03:Bailey,, 12:u01:odyssey:, 8:u03:J.N., 11:u11:bailey,, -11:u02:Bailey,, 12:u00:odyssey:, 8:u02:J.N., 11:u10:bailey,, -11:u01:Bailey,, 13:u08:Thusberg,, 8:u01:J.N., 17:uI2:,.,,.,,.,..:-, -11:u00:Bailey,, 8:u00:J.N., 17:uI1:,.,,.,,.,..:-, 13:u07:Thusberg,, @@ -765533,7 +780935,6 @@ 9:u07:440-9, 18:u11:substitutions., 19:u13:gonzalez-perez,, -17:u14:nonsynonymous, 10:uI2:-,.-,., 18:u02:substitutions., 19:u04:Gonzalez-Perez,, @@ -765542,7 +780943,6 @@ 9:u06:440-9, 18:u10:substitutions., 19:u12:gonzalez-perez,, -17:u13:nonsynonymous, 10:uI1:-,.-,., 18:u01:substitutions., 19:u03:Gonzalez-Perez,, @@ -765550,7 +780950,6 @@ 8:u04:SNVs, 9:u05:440-9, 19:u11:gonzalez-perez,, -17:u12:nonsynonymous, 10:uI0:-,.-,., 18:u00:substitutions., 19:u02:Gonzalez-Perez,, @@ -765559,13 +780958,11 @@ 8:u03:SNVs, 9:u04:440-9, 19:u10:gonzalez-perez,, -17:u11:nonsynonymous, 19:u01:Gonzalez-Perez,, 17:u02:nonsynonymous, 8:u02:SNVs, 9:u03:440-9, 8:u08:N.M., -17:u10:nonsynonymous, 19:uI2:,.,,.,,..,,..,., 19:u00:Gonzalez-Perez,, 17:u01:nonsynonymous, @@ -767248,7 +782645,6 @@ 9:u03:M-CSF, 12:u08:Dark-red, 10:u10:(fbs),, -7:u22:TRA, 8:u23:TRAP, 10:u01:(FBS),, 8:u03:TRAP, @@ -767586,7 +782982,6 @@ 23:u11:gcacagtcaatgacggctc, 8:u12:mmp9, 26:u13:tgtaccgctatggttacactcg, -7:u22:MMP, 8:u23:MMP9, 10:u00:NFATc1, 24:u01:CACCGCATCACAGGGAAGAC, @@ -769167,7 +784562,6 @@ 7:u22:DZ,, 7:u23:DZ,, 13:uI1:,,.,,,,,,, -10:uI2:,,.,,,, 7:u03:DZ,, 11:u06:FUNDING, 13:u08:81571608,, @@ -769179,14 +784573,12 @@ 7:u22:DL,, 7:u23:DL,, 13:uI0:,,.,,,,,,, -10:uI1:,,.,,,, 7:u02:DZ,, 11:u05:FUNDING, 7:u02:ZC,, 7:u03:YZ,, 7:u10:dz,, 7:u11:dl,, -10:uI0:,,.,,,, 7:u01:DZ,, 11:u04:FUNDING, 13:u07:81571608,, @@ -771681,49 +787073,34 @@ 21:u00:high/intermediate, 9:u03:W2-W3, 16:uI0:-(.-.;.-.;)., -7:u08:PGR, 9:u02:W2-W3, 11:u08:(IGSF1,, 9:u01:W2-W3, -7:u07:PGR, 9:u00:W2-W3, 9:u08:MSMB,, -7:u06:PGR, 11:u07:(IGSF1,, 8:u08:MSMB, 9:u07:MSMB,, -7:u14:pgr, -7:u05:PGR, 11:u06:(IGSF1,, 9:u06:MSMB,, -7:u13:pgr, 11:u14:(igsf1,, -7:u04:PGR, 11:u05:(IGSF1,, 8:u07:MSMB, 9:u05:MSMB,, -7:u12:pgr, 11:u13:(igsf1,, -7:u22:PGR, -7:u23:PGR, -7:u03:PGR, 11:u04:(IGSF1,, 8:u06:MSMB, 9:u04:MSMB,, -7:u11:pgr, 11:u12:(igsf1,, 8:u14:msmb, 7:u22:(IG, 8:u23:(IGS, -7:u02:PGR, 11:u03:(IGSF1,, 8:u05:MSMB, 10:u08:0.024;, 9:u03:MSMB,, -7:u10:pgr, 11:u11:(igsf1,, 8:u13:msmb, -7:u01:PGR, 11:u02:(IGSF1,, 8:u04:MSMB, 7:u08:PgR, @@ -771732,7 +787109,6 @@ 8:u12:msmb, 7:u22:MSM, 8:u23:MSMB, -7:u00:PGR, 11:u01:(IGSF1,, 8:u03:MSMB, 10:u07:0.024;, @@ -771782,20 +787158,17 @@ 21:u02:positive/negative, 8:u03:Ki67, 11:uI1:(.,..,., -8:uI2:;.)., 10:u00:0.024;, 7:u01:PgR, 12:u08:AvProlif, 21:u01:positive/negative, 8:u02:Ki67, 11:uI0:(.,..,., -8:uI1:;.)., 14:uI2:(.,.)(.,.), 7:u00:PgR, 21:u00:positive/negative, 8:u01:Ki67, 10:u14:avprog, -8:uI0:;.)., 14:uI1:(.,.)(.,.), 12:u07:AvProlif, 8:u00:Ki67, @@ -772011,15 +787384,6 @@ 6:u00:E2, 16:u01:progesterone, 16:u00:progesterone, -10:u08:Tumour, -10:u07:Tumour, -10:u06:Tumour, -10:u05:Tumour, -10:u04:Tumour, -10:u03:Tumour, -10:u02:Tumour, -10:u01:Tumour, -10:u00:Tumour, 12:u08:ascribed, 12:u07:ascribed, 12:u06:ascribed, @@ -772641,8 +788005,6 @@ 11:u10:geomean, 10:u12:top2a,, 9:u13:prgs;, -7:u22:TOP, -8:u23:TOP2, 10:uI0:,(;,,,, 11:u01:geomean, 10:u03:TOP2A,, @@ -772672,7 +788034,6 @@ 10:u04:SF3A1,, 9:u10:prgs;, 10:u12:psmc4,, -7:u22:PSM, 8:u23:PSMC, 10:u00:TOP2A,, 9:u01:PRGs;, @@ -772820,8 +788181,6 @@ 17:u08:progesterone-, 14:u12:oestrogen-, 18:u14:proliferation-, -6:u21:Oe, -7:u22:Oes, 8:u23:Oest, 14:u03:Oestrogen-, 18:u05:Proliferation-, @@ -772865,68 +788224,37 @@ 17:u00:progesterone-, 9:u13:down-, 9:u04:Down-, -8:u08:ESR1, 9:u12:down-, 7:u14:ovx, 9:u03:Down-, -9:u08:ERBB2, 9:u11:down-, 7:u13:ovx, 9:u02:Down-, -8:u07:ESR1, 9:u08:ACOX2, 9:u10:down-, 7:u12:ovx, 7:u23:OvX, 9:u01:Down-, -8:u06:ESR1, -9:u07:ERBB2, 7:u11:ovx, -8:u14:esr1, 9:u00:Down-, -8:u05:ESR1, -9:u06:ERBB2, 9:u07:ACOX2, 7:u10:ovx, -8:u13:esr1, -9:u14:erbb2, -8:u04:ESR1, -9:u05:ERBB2, 9:u06:ACOX2, -8:u12:esr1, -9:u13:erbb2, 9:u14:acox2, -8:u23:ESR1, -8:u03:ESR1, -9:u04:ERBB2, 9:u05:ACOX2, 8:u08:AGR2, -8:u11:esr1, -9:u12:erbb2, 9:u13:acox2, -7:u22:ERB, -8:u23:ERBB, -8:u02:ESR1, -9:u03:ERBB2, 9:u04:ACOX2, -8:u10:esr1, -9:u11:erbb2, 9:u12:acox2, 7:u22:ACO, 8:u23:ACOX, -8:u01:ESR1, -9:u02:ERBB2, 9:u03:ACOX2, 8:u07:AGR2, -9:u10:erbb2, 9:u11:acox2, -8:u00:ESR1, -9:u01:ERBB2, 9:u02:ACOX2, 8:u06:AGR2, 9:u10:acox2, 8:u14:agr2, -9:u00:ERBB2, 9:u01:ACOX2, 8:u05:AGR2, 12:u08:ATP6V1B1, @@ -773056,9 +788384,6 @@ 9:u00:GREB1, 9:u04:IGSF1, 9:u12:igsf1, -6:u21:IG, -7:u22:IGS, -8:u23:IGSF, 9:u03:IGSF1, 8:u07:IRS1, 9:u11:igsf1, @@ -773140,47 +788465,14 @@ 11:u02:PDZK1P1, 11:u10:pdzk1p1, 11:u01:PDZK1P1, -9:u08:PTGS2, 11:u00:PDZK1P1, -9:u07:PTGS2, -9:u06:PTGS2, -9:u08:RUNX1, -9:u14:ptgs2, -9:u05:PTGS2, -9:u13:ptgs2, -9:u04:PTGS2, -9:u07:RUNX1, -9:u12:ptgs2, -7:u22:PTG, -8:u23:PTGS, -9:u03:PTGS2, -9:u06:RUNX1, -9:u11:ptgs2, -9:u14:runx1, -9:u02:PTGS2, -9:u05:RUNX1, 12:u08:SERPINA3, -9:u10:ptgs2, -9:u13:runx1, -9:u01:PTGS2, -9:u04:RUNX1, -9:u12:runx1, -6:u21:RU, -7:u22:RUN, -8:u23:RUNX, -9:u00:PTGS2, -9:u03:RUNX1, 12:u07:SERPINA3, -9:u11:runx1, -9:u02:RUNX1, 12:u06:SERPINA3, -9:u10:runx1, 12:u14:serpina3, -9:u01:RUNX1, 12:u05:SERPINA3, 12:u08:SERPINA5, 12:u13:serpina3, -9:u00:RUNX1, 12:u04:SERPINA3, 12:u12:serpina3, 7:u22:SER, @@ -773287,8 +788579,6 @@ 9:u00:TGFB3, 9:u04:ZFP36, 9:u12:zfp36, -7:u22:ZFP, -8:u23:ZFP3, 9:u03:ZFP36, 9:u07:EFHD1, 9:u08:FKBP5, @@ -773461,28 +788751,14 @@ 9:u02:CDC20, 9:u10:cdc20, 9:u01:CDC20, -9:u08:TOP2A, 9:u00:CDC20, -9:u07:TOP2A, -9:u06:TOP2A, -9:u14:top2a, -9:u05:TOP2A, 8:u08:HMMR, -9:u13:top2a, -9:u04:TOP2A, -9:u12:top2a, -9:u03:TOP2A, 8:u07:HMMR, -9:u11:top2a, -9:u02:TOP2A, 8:u06:HMMR, 9:u08:UBE2C, -9:u10:top2a, 8:u14:hmmr, -9:u01:TOP2A, 8:u05:HMMR, 8:u13:hmmr, -9:u00:TOP2A, 8:u04:HMMR, 9:u07:UBE2C, 8:u12:hmmr, @@ -773499,7 +788775,6 @@ 8:u01:HMMR, 9:u04:UBE2C, 9:u12:ube2c, -8:u23:UBE2, 8:u00:HMMR, 9:u03:UBE2C, 9:u07:UBE2T, @@ -773619,7 +788894,6 @@ 13:u01:Tamoxifen, 12:u03:Dowsett,, 13:u07:1380-1388, -13:u08:Freedman,, 16:u10:double-blind, 16:u00:Anastrozole,, 16:u01:double-blind, @@ -773627,23 +788901,19 @@ 13:u00:Tamoxifen, 12:u02:Dowsett,, 13:u06:1380-1388, -13:u07:Freedman,, 16:u00:double-blind, 15:u07:neoadjuvant, 12:u01:Dowsett,, 13:u05:1380-1388, -13:u06:Freedman,, 15:u06:neoadjuvant, 14:u07:menopausal, 12:u00:Dowsett,, 13:u04:1380-1388, -13:u05:Freedman,, 10:u08:Treat., 15:u14:neoadjuvant, 15:u05:neoadjuvant, 14:u06:menopausal, 13:u03:1380-1388, -13:u04:Freedman,, 10:u07:Treat., 10:u08:Klijn,, 15:u13:neoadjuvant, @@ -773652,7 +788922,6 @@ 14:u05:menopausal, 11:u08:903-911, 13:u02:1380-1388, -13:u03:Freedman,, 10:u06:Treat., 10:u07:Klijn,, 15:u12:neoadjuvant, @@ -773660,7 +788929,6 @@ 15:u03:neoadjuvant, 14:u04:menopausal, 13:u01:1380-1388, -13:u02:Freedman,, 10:u05:Treat., 10:u06:Klijn,, 15:u11:neoadjuvant, @@ -773670,7 +788938,6 @@ 14:u03:menopausal, 11:u07:903-911, 13:u00:1380-1388, -13:u01:Freedman,, 10:u04:Treat., 10:u05:Klijn,, 13:u08:Jannuzzo,, @@ -773679,7 +788946,6 @@ 15:u01:neoadjuvant, 14:u02:menopausal, 11:u06:903-911, -13:u00:Freedman,, 10:u03:Treat., 10:u04:Klijn,, 13:u07:Jannuzzo,, @@ -773715,7 +788981,6 @@ 13:u02:Jannuzzo,, 12:u05:Dunbier,, 11:u08:Haynes,, -8:u23:Brea, 11:u00:903-911, 13:u01:Jannuzzo,, 12:u04:Dunbier,, @@ -773771,34 +789036,28 @@ 13:u08:Jerevall,, 13:u12:subtypes., 17:u14:her2-negative, -10:uI2:.,..-,, 13:u03:subtypes., 17:u05:HER2-negative, 13:u08:1762-1769, 11:u02:Parker,, 13:u04:Filipits,, 13:u07:Jerevall,, -15:u08:early-stage, 13:u11:subtypes., 17:u13:her2-negative, -10:uI1:.,..-,, 13:u02:subtypes., 17:u04:HER2-negative, 11:u01:Parker,, 13:u03:Filipits,, 13:u06:Jerevall,, -15:u07:early-stage, 13:u10:subtypes., 17:u12:her2-negative, 8:u23:HER2, -10:uI0:.,..-,, 13:u01:subtypes., 17:u03:HER2-negative, 13:u07:1762-1769, 11:u00:Parker,, 13:u02:Filipits,, 13:u05:Jerevall,, -15:u06:early-stage, 19:u08:López-Knowles,, 17:u11:her2-negative, 13:u00:subtypes., @@ -773806,7 +789065,6 @@ 13:u06:1762-1769, 13:u01:Filipits,, 13:u04:Jerevall,, -15:u05:early-stage, 19:u07:López-Knowles,, 17:u10:her2-negative, 13:u14:1762-1769, @@ -773814,20 +789072,17 @@ 13:u05:1762-1769, 13:u00:Filipits,, 13:u03:Jerevall,, -15:u04:early-stage, 19:u06:López-Knowles,, 13:u13:1762-1769, 17:u00:HER2-negative, 13:u04:1762-1769, 13:u08:Oestrogen, 13:u02:Jerevall,, -15:u03:early-stage, 19:u05:López-Knowles,, 13:u12:1762-1769, 8:u23:1762, 13:u03:1762-1769, 13:u01:Jerevall,, -15:u02:early-stage, 19:u04:López-Knowles,, 21:u08:Receptor-Positive, 13:u11:1762-1769, @@ -773835,14 +789090,12 @@ 13:u02:1762-1769, 13:u07:Oestrogen, 13:u00:Jerevall,, -15:u01:early-stage, 19:u03:López-Knowles,, 21:u07:Receptor-Positive, 13:u10:1762-1769, 15:u13:carcinomas., 13:u01:1762-1769, 13:u06:Oestrogen, -15:u00:early-stage, 19:u02:López-Knowles,, 21:u06:Receptor-Positive, 15:u12:carcinomas., @@ -778562,41 +793815,32 @@ 12:uI1:://./-/., 11:u08:Novick,, 12:uI0:://./-/., -11:u08:(2020)., 11:u07:Novick,, 15:u08:Pastorello,, 11:u06:Novick,, 15:u07:Pastorello,, -11:u07:(2020)., 12:u08:Zealand., 11:u05:Novick,, 15:u06:Pastorello,, 18:uI2:.,...:...,-()., -11:u06:(2020)., 11:u04:Novick,, 15:u05:Pastorello,, 18:u08:Biogeosciences, -11:u14:(2020)., 18:uI1:.,...:...,-()., -11:u05:(2020)., 12:u07:Zealand., 10:u08:Vapor,, 11:u03:Novick,, 15:u04:Pastorello,, 18:u07:Biogeosciences, 14:u08:Baldocchi,, -11:u13:(2020)., 18:uI0:.,...:...,-()., -11:u04:(2020)., 12:u06:Zealand., 11:u02:Novick,, 15:u03:Pastorello,, 18:u06:Biogeosciences, 14:u07:Baldocchi,, -11:u12:(2020)., 12:u14:zealand., 10:uI2:.,..::, -11:u03:(2020)., 12:u05:Zealand., 10:u07:Vapor,, 11:u01:Novick,, @@ -778604,10 +793848,8 @@ 18:u05:Biogeosciences, 14:u06:Baldocchi,, 19:u08:Seyednasrollah,, -11:u11:(2020)., 12:u13:zealand., 10:uI1:.,..::, -11:u02:(2020)., 12:u04:Zealand., 10:u06:Vapor,, 11:u00:Novick,, @@ -778615,14 +793857,12 @@ 18:u04:Biogeosciences, 14:u05:Baldocchi,, 19:u07:Seyednasrollah,, -11:u10:(2020)., 12:u12:zealand., 10:u14:vapor,, 7:u22:Zea, 8:u23:Zeal, 10:uI0:.,..::, 11:uI2:.,..:-,, -11:u01:(2020)., 12:u03:Zealand., 10:u05:Vapor,, 15:u00:Pastorello,, @@ -778634,7 +793874,6 @@ 10:u13:vapor,, 11:uI1:.,..:-,, 15:uI2:,.....,-()., -11:u00:(2020)., 12:u02:Zealand., 10:u04:Vapor,, 18:u02:Biogeosciences, @@ -779935,7 +795174,6 @@ 12:u07:rearing,, 13:u12:bisecting, 9:u13:floor, -7:u22:bis, 8:u23:bise, 9:uI2:.,(.;, 13:u03:bisecting, @@ -782533,29 +797771,24 @@ 10:u01:Orger,, 12:u04:Stowers,, 8:u07:Ash,, -11:u14:(2014)., 19:uI1:.,..,,.,,.,,.,., 15:u04:engineering, 9:u08:Rift:, 10:u00:Orger,, 12:u03:Stowers,, 8:u06:Ash,, -11:u13:(2014)., 19:uI0:.,..,,.,,.,,.,., 15:u03:engineering, 12:u02:Stowers,, 8:u05:Ash,, -11:u12:(2014)., 15:u02:engineering, 9:u07:Rift:, 12:u01:Stowers,, 8:u04:Ash,, -11:u11:(2014)., 15:u01:engineering, 9:u06:Rift:, 12:u00:Stowers,, 8:u03:Ash,, -11:u10:(2014)., 9:u14:rift:, 20:uI2:.,.,,..,,.,,.,.., 15:u00:engineering, @@ -782988,14 +798221,11 @@ 11:u11:arena's, 9:uI0:',-.., 8:uI1:'.(), -8:uI2:,',-, 15:u03:projector's, 11:u10:arena's, 8:uI0:'.(), -8:uI1:,',-, 12:uI2:-().()-', 15:u02:projector's, -8:uI0:,',-, 12:uI1:-().()-', 15:u01:projector's, 12:uI0:-().()-', @@ -784071,40 +799301,30 @@ 12:u02:object),, 11:u02:+/-30cm, 12:u10:object),, -9:u05:Amide, 18:u07:Chemoselective, 13:u04:Edition:D, 19:u05:Dehydrogenation, 13:u06:Edition:D, 23:u07:a,b-Dehydrogenation, -9:u13:amide, -9:u04:Amide, 18:u06:Chemoselective, 12:u08:genation, 13:u03:Edition:D, 19:u04:Dehydrogenation, 13:u05:Edition:D, 23:u06:a,b-Dehydrogenation, -9:u12:amide, 18:u14:chemoselective, -8:u23:Amid, -9:u03:Amide, 18:u05:Chemoselective, 13:u02:Edition:D, 19:u03:Dehydrogenation, 23:u05:a,b-Dehydrogenation, -9:u11:amide, 18:u13:chemoselective, -9:u02:Amide, 18:u04:Chemoselective, 12:u07:genation, 13:u01:Edition:D, 19:u02:Dehydrogenation, 23:u04:a,b-Dehydrogenation, -9:u10:amide, 18:u12:chemoselective, 10:uI2:.,,.,*, -9:u01:Amide, 18:u03:Chemoselective, 12:u06:genation, 20:u08:dehydrogenation., @@ -784114,7 +799334,6 @@ 18:u11:chemoselective, 12:u14:genation, 10:uI1:.,,.,*, -9:u00:Amide, 18:u02:Chemoselective, 12:u05:genation, 19:u00:Dehydrogenation, @@ -784372,22 +799591,18 @@ 11:u08:herein., 12:u00:lactams,, 11:u02:iridium, -12:u14:carbonyl, 11:uI0:,-().[], 10:u08:LiCyan, 11:u01:iridium, 9:u08:DIPEA, -12:u13:carbonyl, 11:u07:herein., 6:u08:Tf, 11:u00:iridium, 9:u07:DIPEA, -12:u12:carbonyl, 11:u06:herein., 10:u07:LiCyan, 7:u08:[*], 9:u06:DIPEA, -12:u11:carbonyl, 11:u14:herein., 11:u05:herein., 10:u06:LiCyan, @@ -784395,7 +799610,6 @@ 15:u08:Universityo, 9:u05:DIPEA, 12:u08:Dr.C.J.T, -12:u10:carbonyl, 11:u13:herein., 10:u14:licyan, 10:uI2:.,---,, @@ -785729,7 +800943,6 @@ 13:u04:However,d, 9:u04:uring, 13:u12:however,d, -9:u14:amide, 13:u03:However,d, 9:u03:uring, 8:u08:18,w, @@ -786351,7 +801564,6 @@ 8:u04:95,5, 13:u00:128,13404, 7:u04:813, -6:u08:.T, 9:u10:1819., 8:u12:95,5, 7:u22:95,, @@ -786364,7 +801576,6 @@ 14:u07:1013;b)R.J, 11:u08:14569;b, 7:u03:813, -6:u07:.T, 8:u11:95,5, 19:uI0:,-;)..,..,..,.., 17:uI1:..,,-;)..,..,, @@ -786373,7 +801584,6 @@ 8:u02:95,5, 14:u06:1013;b)R.J, 7:u02:813, -6:u06:.T, 8:u10:95,5, 14:u14:1013;b)r.j, 17:uI0:..,,-;)..,..,, @@ -786383,7 +801593,6 @@ 14:u05:1013;b)R.J, 11:u07:14569;b, 7:u01:813, -6:u05:.T, 14:u13:1013;b)r.j, 15:uI0:..,....,,-., 19:uI1:[]).,.,.,...,,-, @@ -786392,7 +801601,6 @@ 14:u04:1013;b)R.J, 11:u06:14569;b, 7:u00:813, -6:u04:.T, 14:u12:1013;b)r.j, 11:u14:14569;b, 8:u23:1013, @@ -786401,7 +801609,6 @@ 19:uI2:[]).,..,....,,-, 14:u03:1013;b)R.J, 11:u05:14569;b, -6:u03:.T, 14:u11:1013;b)r.j, 11:u13:14569;b, 16:uI0:;)..,...,,-., @@ -786409,7 +801616,6 @@ 18:uI2:;).,.,..,....,, 14:u02:1013;b)R.J, 11:u04:14569;b, -6:u02:.T, 14:u10:1013;b)r.j, 11:u12:14569;b, 8:u23:1456, @@ -786417,12 +801623,10 @@ 18:uI1:;).,.,..,....,, 14:u01:1013;b)R.J, 11:u03:14569;b, -6:u01:.T, 11:u11:14569;b, 18:uI0:;).,.,..,....,, 14:u00:1013;b)R.J, 11:u02:14569;b, -6:u00:.T, 11:u10:14569;b, 11:u01:14569;b, 11:u00:14569;b, @@ -787147,34 +802351,25 @@ 7:u02:451, 7:u10:451, 7:u01:451, -21:u05:Vol.:(0123456789), 36:u08:www.nature.com/scientificreports, 11:u06:Reports, 12:u07:10:21715, 46:u08:https://doi.org/10.1038/s41598-020-78623-5, -21:u13:vol.:(0123456789), -21:u04:Vol.:(0123456789), 17:u08:Microchemical, 11:u05:Reports, 12:u06:10:21715, 46:u07:https://doi.org/10.1038/s41598-020-78623-5, -21:u12:vol.:(0123456789), 10:u14:(2020), -21:u03:Vol.:(0123456789), 11:u04:Reports, 12:u05:10:21715, 46:u06:https://doi.org/10.1038/s41598-020-78623-5, -21:u11:vol.:(0123456789), 10:u13:(2020), -21:u02:Vol.:(0123456789), 17:u07:Microchemical, 11:u03:Reports, 12:u04:10:21715, 46:u05:https://doi.org/10.1038/s41598-020-78623-5, 11:u08:Vinci's, -21:u10:vol.:(0123456789), 10:u12:(2020), -21:u01:Vol.:(0123456789), 17:u06:Microchemical, 11:u02:Reports, 12:u03:10:21715, @@ -787182,7 +802377,6 @@ 11:u07:Vinci's, 10:u11:(2020), 17:u14:microchemical, -21:u00:Vol.:(0123456789), 17:u05:Microchemical, 11:u01:Reports, 12:u02:10:21715, @@ -787468,24 +802662,20 @@ 19:u08:Gif-sur-Yvette,, 9:u11:cnrs,, 11:uI0:,(),,,,, -11:uI2:(),,,.,, 8:u06:BP48, 9:u07:91192, 14:u05:Ministère, 19:u07:Gif-sur-Yvette,, 9:u10:cnrs,, 8:u14:bp48, -11:uI1:(),,,.,, 12:uI2:,,---,-,, 8:u05:BP48, 9:u06:91192, 12:u07:equally:, -21:u08:Vol:.(1234567890), 14:u04:Ministère, 19:u06:Gif-sur-Yvette,, 8:u13:bp48, 9:u14:91192, -11:uI0:(),,,.,, 12:uI1:,,---,-,, 15:uI2:.,--,.,',.,, 8:u04:BP48, @@ -787504,7 +802694,6 @@ 8:u03:BP48, 9:u04:91192, 12:u05:equally:, -21:u07:Vol:.(1234567890), 14:u02:Ministère, 19:u04:Gif-sur-Yvette,, 11:u08:Reports, @@ -787518,7 +802707,6 @@ 8:u02:BP48, 9:u03:91192, 12:u04:equally:, -21:u06:Vol:.(1234567890), 14:u01:Ministère, 19:u03:Gif-sur-Yvette,, 11:u07:Reports, @@ -787526,45 +802714,33 @@ 8:u10:bp48, 9:u11:91192, 12:u12:equally:, -21:u14:vol:.(1234567890), 12:uI0:--,.,,,., 10:uI1::.*:@., 8:u01:BP48, 9:u02:91192, 12:u03:equally:, -21:u05:Vol:.(1234567890), 14:u00:Ministère, 19:u02:Gif-sur-Yvette,, 9:u10:91192, 12:u11:equally:, -21:u13:vol:.(1234567890), 10:uI0::.*:@., 8:u00:BP48, 9:u01:91192, 12:u02:equally:, -21:u04:Vol:.(1234567890), 15:u08:Renaissance, 19:u01:Gif-sur-Yvette,, 12:u10:equally:, -21:u12:vol:.(1234567890), -8:u23:Vol:, 9:u00:91192, 12:u01:equally:, -21:u03:Vol:.(1234567890), 19:u00:Gif-sur-Yvette,, -21:u11:vol:.(1234567890), 46:u14:https://doi.org/10.1038/s41598-020-78623-5, 12:u00:equally:, -21:u02:Vol:.(1234567890), 15:u07:Renaissance, -21:u10:vol:.(1234567890), 46:u13:https://doi.org/10.1038/s41598-020-78623-5, -21:u01:Vol:.(1234567890), 15:u06:Renaissance, 9:u08:uity,, 46:u12:https://doi.org/10.1038/s41598-020-78623-5, 15:u14:renaissance, -21:u00:Vol:.(1234567890), 15:u05:Renaissance, 46:u11:https://doi.org/10.1038/s41598-020-78623-5, 15:u13:renaissance, @@ -787636,7 +802812,6 @@ 10:u10:today,, 12:uI1:-().,---, 10:u01:Today,, -21:u08:Vol.:(0123456789), 14:u00:perceptive, 15:u01:quantifying, 12:u07:courtesy, @@ -787645,12 +802820,9 @@ 15:u00:quantifying, 12:u06:courtesy, 14:uI2:.,.,(),-,., -21:u07:Vol.:(0123456789), 12:u05:courtesy, 14:uI1:.,.,(),-,., -21:u06:Vol.:(0123456789), 12:u04:courtesy, -21:u14:vol.:(0123456789), 14:uI0:.,.,(),-,., 12:u03:courtesy, 12:u02:courtesy, @@ -788097,13 +803269,10 @@ 8:u10:(w%), 8:u01:(w%), 13:u02:painter's, -9:uI2::,;,-, 8:u00:(w%), 7:u08:[C], 13:u01:painter's, -9:uI1::,;,-, 13:u00:painter's, -9:uI0::,;,-, 7:u07:[C], 7:u06:[C], 6:u08:Ŵ, @@ -788320,21 +803489,18 @@ 17:u04:crystallites,, 27:u05:wavelength-independent,, 11:u13:or-less, -9:uI2:--,.,, 11:u04:or-less, 17:u03:crystallites,, 27:u04:wavelength-independent,, 11:u12:or-less, 7:u22:or-, 8:u23:or-l, -9:uI1:--,.,, 11:u03:or-less, 8:u07:lira, 17:u02:crystallites,, 27:u03:wavelength-independent,, 11:u11:or-less, 13:u14:reserved., -9:uI0:--,.,, 11:u02:or-less, 8:u06:lira, 17:u01:crystallites,, @@ -792805,19 +807971,10 @@ 9:uI1:-.-.,, 14:u00:worldwide., 20:u03:mcr-1.1-carrying, -12:u08:Spectrum, 9:uI0:-.-.,, 20:u02:mcr-1.1-carrying, -12:u07:Spectrum, 20:u01:mcr-1.1-carrying, -12:u06:Spectrum, 20:u00:mcr-1.1-carrying, -12:u05:Spectrum, -12:u04:Spectrum, -12:u03:Spectrum, -12:u02:Spectrum, -12:u01:Spectrum, -12:u00:Spectrum, 9:u08:Worth, 9:u07:Worth, 9:u06:Worth, @@ -792966,7 +808123,6 @@ 13:uI2:--»(,,)., 8:u00:11.0, 7:u04:ens, -13:u08:Germany)., 27:u00:(http://www.eucast.org,, 7:u04:MDR, 7:u23:ens, @@ -792976,50 +808132,37 @@ 7:u03:MDR, 13:uI0:--»(,,)., 7:u02:ens, -13:u07:Germany)., 7:u02:MDR, 9:u08:USA),, 7:u01:ens, -13:u06:Germany)., 7:u01:MDR, 9:u07:USA),, -13:u14:germany)., 7:u00:ens, -13:u05:Germany)., 7:u00:MDR, 9:u06:USA),, -13:u13:germany)., 8:uI2:)..(, -13:u04:Germany)., 11:u08:Oxford,, 9:u05:USA),, 12:u08:Nanopore, -13:u12:germany)., 8:uI1:)..(, 12:uI2:,),(,,,), -13:u03:Germany)., 17:u08:Technologies,, 9:u04:USA),, 12:u07:Nanopore, 7:u08:UK), -13:u11:germany)., 8:uI0:)..(, 12:uI1:,),(,,,), -13:u02:Germany)., 11:u07:Oxford,, 9:u03:USA),, 12:u06:Nanopore, 7:u07:UK), -13:u10:germany)., 12:uI0:,),(,,,), -13:u01:Germany)., 11:u06:Oxford,, 17:u07:Technologies,, 9:u02:USA),, 12:u05:Nanopore, 7:u06:UK), 11:u14:oxford,, -13:u00:Germany)., 11:u05:Oxford,, 17:u06:Technologies,, 9:u08:22.03, @@ -795961,7 +811104,6 @@ 12:u11:plasmid., 15:u12:isms8111775, 8:u23:isms, -11:uI2:.,,,,.., 12:u02:plasmid., 15:u03:isms8111775, 15:u07:Antibiotics, @@ -795969,65 +811111,54 @@ 23:u01:Multidrug-resistant, 18:u02:Microorganisms, 11:u07:(Basel), -6:u08:Hu, 12:u10:plasmid., 15:u11:isms8111775, -11:uI1:.,,,,.., 12:u01:plasmid., 15:u02:isms8111775, 15:u06:Antibiotics, 23:u00:Multidrug-resistant, 18:u01:Microorganisms, 11:u06:(Basel), -6:u07:Hu, 15:u10:isms8111775, 15:u14:antibiotics, -11:uI0:.,,,,.., 12:u00:plasmid., 15:u01:isms8111775, 15:u05:Antibiotics, 19:u07:fluoroquinolone, 18:u00:Microorganisms, 11:u05:(Basel), -6:u06:Hu, 15:u13:antibiotics, 15:uI2:():.://././, 15:u00:isms8111775, 15:u04:Antibiotics, 19:u06:fluoroquinolone, 11:u04:(Basel), -6:u05:Hu, 15:u12:antibiotics, 19:u14:fluoroquinolone, 15:uI1:():.://././, 15:u03:Antibiotics, 19:u05:fluoroquinolone, 11:u03:(Basel), -6:u04:Hu, 15:u11:antibiotics, 19:u13:fluoroquinolone, 15:uI0:():.://././, 15:u02:Antibiotics, 19:u04:fluoroquinolone, 11:u02:(Basel), -6:u03:Hu, 15:u10:antibiotics, 19:u12:fluoroquinolone, 15:u01:Antibiotics, 19:u03:fluoroquinolone, 10:u08:Korea., 11:u01:(Basel), -6:u02:Hu, 19:u11:fluoroquinolone, 15:u00:Antibiotics, 19:u02:fluoroquinolone, 14:u08:JFP-16-502, 11:u00:(Basel), -6:u01:Hu, 19:u10:fluoroquinolone, 19:u01:fluoroquinolone, 10:u07:Korea., -6:u00:Hu, 19:u00:fluoroquinolone, 10:u06:Korea., 14:u07:JFP-16-502, @@ -796210,7 +811341,6 @@ 9:u12:2023., 14:u13:anginosus., 16:u14:2023.1188671, -8:u23:2023, 15:uI2:.:.://././., 40:u01:doi.org/10.1016/j.meegid.2019.103916, 9:u03:2023., @@ -799017,7 +814147,6 @@ 7:u03:mm., 8:u10:t2w), 7:u12:smg, -7:u22:SMG, 7:u23:SMG, 8:u01:T2w), 7:u03:SMG, @@ -801192,7 +816321,6 @@ 13:u08:Weschler,, 40:u13:https://doi.org/10.1212/wnl.58.2.198, 18:uI0:,-,://././/()., -17:uI2:://././...()., 32:u00:j.neurobiolaging.2004.02.019, 10:u02:Cortex, 40:u04:https://doi.org/10.1212/wnl.58.2.198, @@ -801201,7 +816329,6 @@ 13:u07:Weschler,, 14:u08:Jenkinson,, 40:u12:https://doi.org/10.1212/wnl.58.2.198, -17:uI1:://././...()., 10:u01:Cortex, 40:u03:https://doi.org/10.1212/wnl.58.2.198, 11:u04:Sowell,, @@ -801209,7 +816336,6 @@ 14:u07:Jenkinson,, 49:u08:https://doi.org/10.1016/s1361-8415(01)00036-6, 40:u11:https://doi.org/10.1212/wnl.58.2.198, -17:uI0:://././...()., 10:u00:Cortex, 40:u02:https://doi.org/10.1212/wnl.58.2.198, 12:u07:143-156,, @@ -802175,7 +817301,6 @@ 12:u06:Achieved, 15:u04:throughput., 15:u06:Throughput., -8:u23:Abso, 12:u03:Absolute, 12:u05:Achieved, 12:u08:dination, @@ -802478,23 +817603,18 @@ 12:u02:Breaking, 9:u04:eral,, 9:u12:eral,, -10:u14:serves, 12:u01:Breaking, 9:u03:eral,, 14:u08:increases,, 9:u11:eral,, -10:u13:serves, 12:u00:Breaking, 9:u02:eral,, 14:u07:increases,, 9:u10:eral,, -10:u12:serves, 9:u01:eral,, 14:u06:increases,, -10:u11:serves, 9:u00:eral,, 14:u05:increases,, -10:u10:serves, 14:u04:increases,, 13:u08:producers, 14:u03:increases,, @@ -803990,7 +819110,6 @@ 15:uI1:(,,)-(,),,,, 15:u01:compilation, 10:u04:TRiPS,, -9:u08:proxy, 12:u00:PaleoDB,, 13:u03:(1,25,28), 12:u05:PaleoDB., @@ -804002,36 +819121,28 @@ 12:u04:PaleoDB., 10:u11:trips,, 10:u02:TRiPS,, -9:u07:proxy, 13:u01:(1,25,28), 12:u03:PaleoDB., 10:u10:trips,, 10:u01:TRiPS,, -9:u06:proxy, 13:u00:(1,25,28), 12:u02:PaleoDB., 9:u14:proxy, 10:uI2:(,).,,, 10:u00:TRiPS,, -9:u05:proxy, 12:u01:PaleoDB., 15:u08:disentangle, 9:u13:proxy, 10:uI1:(,).,,, -9:u04:proxy, 12:u00:PaleoDB., 15:u07:disentangle, 9:u12:proxy, 10:uI0:(,).,,, -9:u03:proxy, 15:u06:disentangle, 9:u11:proxy, -9:u02:proxy, 15:u05:disentangle, 9:u10:proxy, -9:u01:proxy, 15:u04:disentangle, -9:u00:proxy, 15:u03:disentangle, 11:u08:clumped, 15:u02:disentangle, @@ -805811,7 +820922,6 @@ 8:u03:Late, 9:u05:(Maa), 8:u06:72,1, -7:u08:375, 9:u13:(maa), 8:u14:72,1, 8:u02:Late, @@ -805826,7 +820936,6 @@ 9:u03:(Maa), 8:u04:72,1, 7:u06:6,1, -7:u07:375, 9:u11:(maa), 8:u12:72,1, 7:u14:6,1, @@ -805835,42 +820944,34 @@ 9:u02:(Maa), 8:u03:72,1, 7:u05:6,1, -7:u06:375, 9:u07:(397), 8:u08:407), 8:u08:(383, 9:u10:(maa), 8:u11:72,1, 7:u13:6,1, -7:u14:375, 9:u01:(Maa), 8:u02:72,1, 7:u04:6,1, -7:u05:375, 9:u06:(397), 8:u08:0,95, 8:u07:(383, 8:u10:72,1, 7:u12:6,1, -7:u13:375, 9:u14:(397), 7:u22:6,1, 7:u23:6,1, 9:u00:(Maa), 8:u01:72,1, 7:u03:6,1, -7:u04:375, 9:u05:(397), 8:u07:407), 8:u06:(383, 9:u08:(0,94, 7:u11:6,1, -7:u12:375, 9:u13:(397), -7:u23:375, 8:u00:72,1, 7:u02:6,1, -7:u03:375, 9:u04:(397), 8:u06:407), 8:u07:0,95, @@ -805878,23 +820979,19 @@ 8:u05:(383, 9:u07:(0,94, 7:u10:6,1, -7:u11:375, 9:u12:(397), 8:u14:407), 8:u23:(397, 7:u01:6,1, -7:u02:375, 9:u03:(397), 8:u05:407), 8:u06:0,95, 8:u04:(383, 9:u06:(0,94, -7:u10:375, 9:u11:(397), 8:u13:407), 8:u14:0,95, 7:u00:6,1, -7:u01:375, 9:u02:(397), 8:u04:407), 8:u05:0,95, @@ -805907,7 +821004,6 @@ 8:u13:0,95, 8:u23:407), 10:uI2:,(,-,), -7:u00:375, 9:u01:(397), 8:u03:407), 8:u04:0,95, @@ -808095,7 +823191,6 @@ 9:u11:(kim), 9:u12:157,3, 8:u13:152,, -8:u23:157,, 8:u00:0,87, 16:u01:Kimmeridgian, 9:u02:(Kim), @@ -808182,7 +823277,6 @@ 7:u02:0,8, 8:u05:0,86, 13:u06:Oxfordian, -8:u08:157,, 7:u01:(35, 9:u02:(0,68, 9:u05:(0,75, @@ -808203,7 +823297,6 @@ 8:u03:0,86, 13:u04:Oxfordian, 9:u06:163,5, -8:u07:157,, 7:u08:6,2, 9:u00:(0,68, 9:u03:(0,75, @@ -808213,53 +823306,41 @@ 8:u02:0,86, 13:u03:Oxfordian, 9:u05:163,5, -8:u06:157,, 9:u02:(0,75, 8:u10:0,86, 13:u11:oxfordian, 9:u13:163,5, -8:u14:157,, 8:u01:0,86, 13:u02:Oxfordian, 9:u04:163,5, -8:u05:157,, 7:u07:6,2, 9:u01:(0,75, 13:u10:oxfordian, 9:u12:163,5, -8:u13:157,, 8:u00:0,86, 13:u01:Oxfordian, 9:u03:163,5, -8:u04:157,, 7:u06:6,2, 9:u00:(0,75, 7:u08:(89, 9:u11:163,5, -8:u12:157,, 7:u14:6,2, 13:u00:Oxfordian, 9:u02:163,5, -8:u03:157,, 7:u05:6,2, 7:u07:(89, 9:u10:163,5, -8:u11:157,, 7:u13:6,2, 9:u01:163,5, -8:u02:157,, 7:u04:6,2, 7:u06:(89, -8:u10:157,, 7:u12:6,2, 7:u23:6,2, 9:u00:163,5, -8:u01:157,, 7:u03:6,2, 7:u08:0,3, 7:u05:(89, 7:u11:6,2, -8:u00:157,, 7:u02:6,2, 7:u04:(89, 9:u08:(0,09, @@ -809641,32 +824722,23 @@ 9:uI0:.,,-(, 14:u03:deciphered, 14:u04:modelling., -8:u08:(3D), 14:u02:deciphered, 14:u03:modelling., 14:u01:deciphered, 14:u02:modelling., -8:u07:(3D), 14:u00:deciphered, 14:u01:modelling., -8:u06:(3D), 14:u00:modelling., 8:u14:(3d), -8:u05:(3D), 8:u13:(3d), -8:u04:(3D), 8:u12:(3d), 7:u22:(3D, 8:u23:(3D), -8:u03:(3D), 8:u08:Hi-C, 8:u11:(3d), -8:u02:(3D), 8:u07:Hi-C, 8:u10:(3d), -8:u01:(3D), 8:u06:Hi-C, -8:u00:(3D), 8:u05:Hi-C, 8:u08:(4D), 8:u04:Hi-C, @@ -810484,32 +825556,23 @@ 11:uI2:(//).,., 11:uI1:(//).,., 11:uI0:(//).,., -16:u08:Optimization, -16:u07:Optimization, 6:u08:||, -16:u06:Optimization, 6:u07:||, -16:u05:Optimization, 6:u06:||, 7:u08:(i,, 8:u14:norm, -16:u04:Optimization, 6:u05:||, 7:u07:(i,, 8:u13:norm, -16:u03:Optimization, 6:u04:||, 7:u06:(i,, 8:u12:norm, -16:u02:Optimization, 6:u03:||, 7:u05:(i,, 8:u11:norm, -16:u01:Optimization, 6:u02:||, 7:u04:(i,, 8:u10:norm, -16:u00:Optimization, 6:u01:||, 7:u03:(i,, 7:u08:⃝, @@ -811067,20 +826130,15 @@ 6:u10:ri, 6:u07:Rg, 6:u06:Rg, -6:u14:rg, 6:u05:Rg, -6:u13:rg, 6:u04:Rg, 12:u08:i=nstart, -6:u12:rg, 6:u21:Rg, 6:u22:Rg, 6:u23:Rg, 6:u03:Rg, -6:u11:rg, 6:u02:Rg, 12:u07:i=nstart, -6:u10:rg, 6:u01:Rg, 12:u06:i=nstart, 12:u14:i=nstart, @@ -812297,7 +827355,6 @@ 12:u14:licenses, 16:uI2:(..,)(..,).(, 12:u05:Licenses, -18:u08:Authentication, 11:u05:below.), 12:u13:licenses, 16:uI1:(..,)(..,).(, @@ -812306,35 +827363,27 @@ 12:u12:licenses, 16:uI0:(..,)(..,).(, 12:u03:Licenses, -18:u07:Authentication, 11:u03:below.), 12:u11:licenses, 10:uI2:(),..,, 12:u02:Licenses, -18:u06:Authentication, 12:u08:password, 11:u02:below.), 12:u10:licenses, 10:uI1:(),..,, 12:u01:Licenses, -18:u05:Authentication, 11:u01:below.), 10:uI0:(),..,, 12:u00:Licenses, -18:u04:Authentication, 12:u07:password, 11:u00:below.), -18:u03:Authentication, 12:u06:password, 12:u14:password, -18:u02:Authentication, 12:u05:password, 17:u08:Accessibility, 12:u13:password, -18:u01:Authentication, 12:u04:password, 12:u12:password, -18:u00:Authentication, 12:u03:password, 17:u07:Accessibility, 12:u11:password, @@ -813027,20 +828076,17 @@ 24:u03:'consentInformation', 79:u05:https://github.com/datatagsuite/schema/blob/master/consent_info_schema.json, 12:u12:modifies, -14:uI2:://./////., 12:u03:modifies, 24:u02:'consentInformation', 79:u04:https://github.com/datatagsuite/schema/blob/master/consent_info_schema.json, 10:u08:schema, 12:u11:modifies, -14:uI1:://./////., 12:u02:modifies, 22:u07:ConsentInformation, 24:u01:'consentInformation', 79:u03:https://github.com/datatagsuite/schema/blob/master/consent_info_schema.json, 10:u07:schema, 12:u10:modifies, -14:uI0:://./////., 12:u01:modifies, 22:u06:ConsentInformation, 24:u00:'consentInformation', @@ -813123,32 +828169,27 @@ 9:u04:(MGH), 10:u08:atrial, 14:u10:'material', -12:u14:ancestry, 11:uI1:().(//), 15:u00:individual., 14:u01:'material', 11:u01:entity., 9:u03:(MGH), 10:u07:atrial, -12:u13:ancestry, 11:uI0:().(//), 14:u00:'material', 15:u07:recipient's, 11:u00:entity., 9:u02:(MGH), 10:u06:atrial, -12:u12:ancestry, 15:u06:recipient's, 9:u01:(MGH), 10:u05:atrial, 25:u08:'consentInformation'., -12:u11:ancestry, 15:u14:recipient's, 15:u05:recipient's, 9:u00:(MGH), 10:u04:atrial, 25:u07:'consentInformation'., -12:u10:ancestry, 15:u13:recipient's, 15:u04:recipient's, 29:u08:Health/Medical/Biomedical, @@ -813270,7 +828311,6 @@ 24:u11:maternity/paternity,, 12:u01:pedigree, 24:u02:maternity/paternity,, -13:u08:approvals, 16:u03:stigmatizing, 24:u10:maternity/paternity,, 12:u00:pedigree, @@ -813278,49 +828318,37 @@ 20:u08:Disease-Specific, 16:u02:stigmatizing, 24:u00:maternity/paternity,, -13:u07:approvals, 17:u08:Fibrillation,, 16:u01:stigmatizing, 11:u08:(Atrial, -13:u06:approvals, 20:u07:Disease-Specific, 16:u00:stigmatizing, 11:u07:(Atrial, 8:u08:IRB,, -13:u14:approvals, -13:u05:approvals, 20:u06:Disease-Specific, 17:u07:Fibrillation,, 11:u06:(Atrial, 8:u07:IRB,, -13:u13:approvals, 20:u14:disease-specific, -13:u04:approvals, 20:u05:Disease-Specific, 17:u06:Fibrillation,, 11:u05:(Atrial, 8:u06:IRB,, -13:u12:approvals, 20:u13:disease-specific, 17:u14:fibrillation,, -13:u03:approvals, 20:u04:Disease-Specific, 17:u05:Fibrillation,, 11:u04:(Atrial, 8:u05:IRB,, -13:u11:approvals, 20:u12:disease-specific, 17:u13:fibrillation,, -13:u02:approvals, 20:u03:Disease-Specific, 17:u04:Fibrillation,, 11:u03:(Atrial, 8:u04:IRB,, 16:u08:fibrillation, -13:u10:approvals, 20:u11:disease-specific, 17:u12:fibrillation,, -13:u01:approvals, 20:u02:Disease-Specific, 17:u03:Fibrillation,, 9:u08:dbGaP, @@ -813329,7 +828357,6 @@ 16:u07:fibrillation, 20:u10:disease-specific, 17:u11:fibrillation,, -13:u00:approvals, 20:u01:Disease-Specific, 17:u02:Fibrillation,, 42:u08:bin/study.cgi?study_id=phs001062.v3.p2, @@ -813687,7 +828714,6 @@ 10:u00:Abowd,, 17:u04:Psychologist,, 11:u06:Privacy, -11:u08:England, 11:u03:George,, 10:u04:73(2),, 14:u10:databases,, @@ -813709,7 +828735,6 @@ 17:u02:Psychologist,, 11:u04:Privacy, 11:u06:Bierer,, -11:u07:England, 11:u01:George,, 10:u02:73(2),, 17:u10:psychologist,, @@ -813719,19 +828744,16 @@ 17:u01:Psychologist,, 11:u03:Privacy, 11:u05:Bierer,, -11:u06:England, 11:u07:Bourne,, 11:u00:George,, 10:u01:73(2),, 9:u08:Beth., 11:u11:privacy, 11:u13:bierer,, -11:u14:england, 21:uI2:,..,,.,,.,,.().,., 17:u00:Psychologist,, 11:u02:Privacy, 11:u04:Bierer,, -11:u05:England, 11:u06:Bourne,, 10:u08:Broes,, 10:u00:73(2),, @@ -813739,49 +828761,41 @@ 15:u08:Informatics, 11:u10:privacy, 11:u12:bierer,, -11:u13:england, 11:u14:bourne,, 8:u23:Bier, 21:uI1:,..,,.,,.,,.().,., 11:u01:Privacy, 11:u03:Bierer,, -11:u04:England, 11:u05:Bourne,, 9:u06:Beth., 15:u07:Informatics, 11:u11:bierer,, -11:u12:england, 11:u13:bourne,, 21:uI0:,..,,.,,.,,.().,., 21:uI2:,.,,,,,,.,,,,,..., 11:u00:Privacy, 11:u02:Bierer,, -11:u03:England, 11:u04:Bourne,, 10:u07:Broes,, 28:u08:610.3389/fmed.2018.00006, 9:u05:Beth., 15:u06:Informatics, 11:u10:bierer,, -11:u11:england, 11:u12:bourne,, 21:uI1:,.,,,,,,.,,,,,..., 12:uI2:,.().()., 11:u01:Bierer,, -11:u02:England, 11:u03:Bourne,, 10:u06:Broes,, 17:u08:Budin-Ljosne,, 9:u04:Beth., 15:u05:Informatics, -11:u10:england, 11:u11:bourne,, 10:u14:broes,, 21:uI0:,.,,,,,,.,,,,,..., 12:uI1:,.().()., 15:uI2::,(),-.:.//, 11:u00:Bierer,, -11:u01:England, 11:u02:Bourne,, 10:u05:Broes,, 28:u07:610.3389/fmed.2018.00006, @@ -813791,7 +828805,6 @@ 10:u13:broes,, 12:uI0:,.().()., 15:uI1::,(),-.:.//, -11:u00:England, 11:u01:Bourne,, 10:u04:Broes,, 28:u06:610.3389/fmed.2018.00006, @@ -813878,7 +828891,6 @@ 13:u14:chassang,, 7:u23:Car, 13:uI0:.,.:./---, -11:uI2:://.//-, 17:u00:Budin-Ljosne,, 7:u03:Car, 40:u04:https://github.com/nicholascar/agr-o, @@ -813890,7 +828902,6 @@ 7:u11:car, 40:u12:https://github.com/nicholascar/agr-o, 13:u13:chassang,, -11:uI1:://.//-, 7:u02:Car, 40:u03:https://github.com/nicholascar/agr-o, 13:u04:Chassang,, @@ -813902,7 +828913,6 @@ 40:u11:https://github.com/nicholascar/agr-o, 13:u12:chassang,, 8:u23:Chas, -11:uI0:://.//-, 14:uI2:.,,-.:./.., 7:u01:Car, 40:u02:https://github.com/nicholascar/agr-o, @@ -816049,7 +831059,6 @@ 11:u06:acutely, 10:u05:"Fecal, 8:u06:ill,, -12:u08:patient,, 12:u13:gerding,, 11:u14:acutely, 12:u04:Gerding,, @@ -816057,7 +831066,6 @@ 15:u07:incontinent, 10:u04:"Fecal, 8:u05:ill,, -12:u07:patient,, 12:u12:gerding,, 11:u13:acutely, 8:u23:Gerd, @@ -816067,7 +831075,6 @@ 15:u06:incontinent, 10:u03:"Fecal, 8:u04:ill,, -12:u06:patient,, 12:u11:gerding,, 11:u12:acutely, 15:u14:incontinent, @@ -816078,7 +831085,6 @@ 9:u08:nence, 10:u02:"Fecal, 8:u03:ill,, -12:u05:patient,, 12:u10:gerding,, 11:u11:acutely, 15:u13:incontinent, @@ -816088,7 +831094,6 @@ 15:u04:incontinent, 10:u01:"Fecal, 8:u02:ill,, -12:u04:patient,, 11:u10:acutely, 15:u12:incontinent, 10:uI2:.,.-,., @@ -816098,25 +831103,21 @@ 9:u07:nence, 10:u00:"Fecal, 8:u01:ill,, -12:u03:patient,, 15:u11:incontinent, 10:uI1:.,.-,., 11:u00:acutely, 15:u02:incontinent, 9:u06:nence, 8:u00:ill,, -12:u02:patient,, 15:u10:incontinent, 9:u14:nence, 10:uI0:.,.-,., 15:u01:incontinent, 9:u05:nence, 12:u08:149-154,, -12:u01:patient,, 9:u13:nence, 15:u00:incontinent, 9:u04:nence, -12:u00:patient,, 9:u12:nence, 8:u23:nenc, 9:u03:nence, @@ -817804,25 +832805,11 @@ 7:u11:nlh, 9:u00:page., 7:u10:nlh, -9:u08:3.1.3, -9:u07:3.1.3, -9:u06:3.1.3, -9:u14:3.1.3, -9:u05:3.1.3, 12:u08:marginal, -9:u13:3.1.3, -9:u04:3.1.3, 12:u07:marginal, -9:u12:3.1.3, -9:u03:3.1.3, 12:u06:marginal, -9:u11:3.1.3, -9:u02:3.1.3, 12:u05:marginal, -9:u10:3.1.3, -9:u01:3.1.3, 12:u04:marginal, -9:u00:3.1.3, 12:u03:marginal, 12:u02:marginal, 12:u01:marginal, @@ -817889,19 +832876,16 @@ 7:u06:473, 13:u13:engineers, 7:u14:473, -8:uI2:(-):, 13:u04:Engineers, 7:u05:473, 13:u12:engineers, 7:u13:473, -8:uI1:(-):, 13:u03:Engineers, 7:u04:473, 13:u11:engineers, 7:u12:473, 7:u22:473, 7:u23:473, -8:uI0:(-):, 13:u02:Engineers, 7:u03:473, 13:u10:engineers, @@ -818403,20 +833387,11 @@ 14:u10:precisions, 14:u01:precisions, 14:u00:precisions, -15:u08:erroneously, -15:u07:erroneously, -15:u06:erroneously, 15:u14:erroneously, -15:u05:erroneously, 15:u13:erroneously, -15:u04:erroneously, 15:u12:erroneously, -15:u03:erroneously, 15:u11:erroneously, -15:u02:erroneously, 15:u10:erroneously, -15:u01:erroneously, -15:u00:erroneously, 10:uI2:.();,., 10:uI1:.();,., 10:uI0:.();,., @@ -819209,7 +834184,6 @@ 7:u04:TPC, 16:u05:Extrapolated, 7:u12:tpc, -6:u21:TP, 7:u22:TPC, 7:u23:TPC, 7:u03:TPC, @@ -820390,15 +835364,12 @@ 8:u12:foil, 8:u23:foil, 8:u03:foil, -11:u02:holder., 15:u04:uniformity., 8:u11:foil, 8:u02:foil, -11:u01:holder., 15:u03:uniformity., 8:u10:foil, 8:u01:foil, -11:u00:holder., 15:u02:uniformity., 8:u00:foil, 15:u01:uniformity., @@ -821183,7 +836154,6 @@ 11:u08:Rutgers, 11:u12:zentrum, 12:u14:hamburg,, -7:u22:Zen, 8:u23:Zent, 12:u05:Hamburg,, 14:u06:Guangdong,, @@ -822248,7 +837218,6 @@ 8:u05:PLD,, 18:u10:marcks-derived, 7:u12:fgf, -7:u22:FGF, 7:u23:FGF, 18:u01:MARCKS-derived, 7:u03:FGF, @@ -822901,7 +837870,6 @@ 23:u05:Immunoprecipitation, 25:u06:peptide-N-glycosidase, 15:u12:subcellular, -8:u23:Subc, 15:u03:Subcellular, 23:u04:Immunoprecipitation, 25:u05:peptide-N-glycosidase, @@ -823626,7 +838594,6 @@ 14:u07:Ispanovic,, 18:u08:reorganization, 16:u10:nmda-induced, -14:u14:metastatic, 13:uI0:.,...----, 16:uI2:.,.,,.,.-(-), 16:u01:NMDA-induced, @@ -823636,7 +838603,6 @@ 14:u06:Ispanovic,, 18:u07:reorganization, 10:u08:Greif,, -14:u13:metastatic, 16:uI1:.,.,,.,.-(-), 16:u00:NMDA-induced, 11:u00:retinal, @@ -823644,7 +838610,6 @@ 14:u05:Ispanovic,, 18:u06:reorganization, 10:u07:Greif,, -14:u12:metastatic, 16:uI0:.,.,,.,.-(-), 12:uI2:.,.,..--, 12:u00:Ridnour,, @@ -823652,14 +838617,12 @@ 18:u05:reorganization, 10:u06:Greif,, 11:u08:Secher,, -14:u11:metastatic, 12:uI1:.,.,..--, 15:uI2:......,-()., 14:u03:Ispanovic,, 18:u04:reorganization, 10:u05:Greif,, 11:u07:Secher,, -14:u10:metastatic, 12:uI0:.,.,..--, 15:uI1:......,-()., 11:u08:435-452, @@ -828792,19 +843755,10 @@ 19:u02:multiplicities., 19:u10:multiplicities., 19:u01:multiplicities., -12:u08:removal., 19:u00:multiplicities., -12:u07:removal., -12:u06:removal., -12:u05:removal., -12:u04:removal., 8:u08:6.3., -12:u03:removal., -12:u02:removal., 8:u07:6.3., -12:u01:removal., 8:u06:6.3., -12:u00:removal., 8:u14:6.3., 8:u05:6.3., 8:u13:6.3., @@ -835605,8 +850559,6 @@ 7:u08:Yao, 8:u11:b.t., 8:u12:b.k., -7:u22:B.K, -8:u23:B.K., 20:uI0:..,.,.,..,..,.,,, 22:uI1:..,.,..,..,.,.,..,, 10:u00:L.A.M., @@ -836018,44 +850970,33 @@ 12:u00:Palacký, 8:u02:LAL,, 8:u01:LAL,, -7:u08:126, 8:u00:LAL,, 12:u08:Coimbra,, 12:uI2:"",..,.,, -7:u07:126, 10:u08:Cosmos, 12:u08:Coimbra;, 12:uI1:"",..,.,, 13:uI2:();().,,,, -7:u06:126, 12:u07:Coimbra,, 12:u07:Coimbra;, -7:u14:126, 12:uI0:"",..,.,, 13:uI1:();().,,,, -7:u05:126, 12:u06:Coimbra,, 10:u07:Cosmos, 12:u06:Coimbra;, -7:u13:126, 12:u14:coimbra,, 13:uI0:();().,,,, 17:uI2:()-,;(),,;(),, -7:u04:126, 12:u05:Coimbra,, 10:u06:Cosmos, 12:u05:Coimbra;, -7:u12:126, 12:u13:coimbra,, 10:u14:cosmos, -7:u23:126, 17:uI1:()-,;(),,;(),, 17:uI2:,;(),;(),,;(), -7:u03:126, 12:u04:Coimbra,, 10:u05:Cosmos, 12:u04:Coimbra;, -7:u11:126, 12:u12:coimbra,, 10:u13:cosmos, 7:u22:Coi, @@ -836063,23 +851004,19 @@ 17:uI0:()-,;(),,;(),, 17:uI1:,;(),;(),,;(), 14:uI2:,,();(),,,, -7:u02:126, 12:u03:Coimbra,, 10:u04:Cosmos, 12:u03:Coimbra;, -7:u10:126, 12:u11:coimbra,, 10:u12:cosmos, 17:uI0:,;(),;(),,;(), 14:uI1:,,();(),,,, -7:u01:126, 12:u02:Coimbra,, 10:u03:Cosmos, 12:u02:Coimbra;, 12:u10:coimbra,, 10:u11:cosmos, 14:uI0:,,();(),,,, -7:u00:126, 12:u01:Coimbra,, 10:u02:Cosmos, 12:u01:Coimbra;, @@ -836421,13 +851358,10 @@ 11:u01:medRxiv, 7:u04:+86, 11:uI1::-;-:@., -7:uI2:#,., 11:u00:medRxiv, 7:u03:+86, 11:uI0::-;-:@., -7:uI1:#,., 7:u02:+86, -7:uI0:#,., 7:u01:+86, 7:u00:+86, 14:u14:collected,, @@ -836844,12 +851778,9 @@ 8:u02:low,, 8:u01:low,, 8:u00:low,, -10:uI2:(.),,,, 13:u08:restricts, -10:uI1:(.),,,, 16:uI2:/,-,-,,(.,)., 13:u07:restricts, -10:uI0:(.),,,, 16:uI1:/,-,-,,(.,)., 13:u06:restricts, 16:uI0:/,-,-,,(.,)., @@ -838373,7 +853304,6 @@ 10:u00:(DZL),, 11:u08:(J.H.),, 29:u07:jan.hasenauer@uni-bonn.de, -14:u08:Highlights, 11:u07:(J.H.),, 29:u06:jan.hasenauer@uni-bonn.de, 11:u06:(J.H.),, @@ -838410,15 +853340,12 @@ 11:u00:(J.H.),, 15:u04:Single-cell, 11:u06:Minimal, -9:uI2:•--, 10:u08:(Epo)., 15:u03:Single-cell, 11:u05:Minimal, -9:uI1:•--, 10:u07:graded, 15:u02:Single-cell, 11:u04:Minimal, -9:uI0:•--, 10:u06:graded, 10:u07:(Epo)., 15:u01:Single-cell, @@ -838653,8 +853580,6 @@ 14:u12:jak2/stat5, 13:u13:feedbacks, 9:u14:cfu-e, -7:u22:JAK, -8:u23:JAK2, 14:u03:JAK2/STAT5, 13:u04:feedbacks, 14:u11:jak2/stat5, @@ -840344,10 +855269,7 @@ 14:u02:pseudotime, 14:u10:pseudotime, 14:u01:pseudotime, -9:uI2:-(,),, 14:u00:pseudotime, -9:uI1:-(,),, -9:uI0:-(,),, 16:u08:Mixed-effect, 16:u07:Mixed-effect, 18:u08:Approximations, @@ -841339,7 +856261,6 @@ 15:u11:multisensor, 8:u12:hass, 12:u14:e0186927, -8:uI2:--.:, 12:u00:Hanebeck, 15:u02:Multisensor, 8:u03:Hass, @@ -841353,7 +856274,6 @@ 8:u11:hass, 12:u13:e0186927, 12:u14:heinrich, -8:uI1:--.:, 15:u01:Multisensor, 8:u02:Hass, 12:u04:e0186927, @@ -841367,7 +856287,6 @@ 13:u14:hasenauer, 7:u22:e01, 8:u23:e018, -8:uI0:--.:, 15:u00:Multisensor, 8:u01:Hass, 12:u03:e0186927, @@ -843627,30 +858546,24 @@ 8:u04:7.9,, 10:u05:μg/ml, 9:u07:4°C., -7:u14:40,, 11:uI0:(:.,.,,, 10:uI1:.,,,)/, 17:u00:fractionation, 8:u03:7.9,, 10:u04:μg/ml, 9:u06:4°C., -7:u13:40,, 10:uI0:.,,,)/, 8:u02:7.9,, 10:u03:μg/ml, 9:u05:4°C., -7:u12:40,, -7:u23:40,, 8:u01:7.9,, 10:u02:μg/ml, 9:u04:4°C., 10:u08:AEBSF., -7:u11:40,, 8:u00:7.9,, 10:u01:μg/ml, 9:u03:4°C., 10:u07:AEBSF., -7:u10:40,, 10:u00:μg/ml, 9:u02:4°C., 10:u06:AEBSF., @@ -846594,7 +861507,6 @@ 9:u05:Maday, 21:u08:neurodegenerative, 14:u12:biogenesis, -8:u23:biog, 9:u04:Maday, 21:u07:neurodegenerative, 14:u11:biogenesis, @@ -847086,7 +861998,6 @@ 9:u08:Which, 11:u11:nakatsu, 17:u12:dell'angelica, -8:u23:Dell, 11:uI1:'.,).,-, 11:u02:Nakatsu, 17:u03:Dell'Angelica, @@ -848291,7 +863202,6 @@ 12:uI1:(,,',).,, 9:uI2:.,-.-, 15:u02:vertebrates, -15:u08:molecularly, 10:u05:export, 15:u10:vertebrates, 12:uI0:(,,',).,, @@ -848301,61 +863211,39 @@ 17:u14:subpopulation, 9:uI0:.,-.-, 15:u00:vertebrates, -15:u07:molecularly, 10:u03:export, 17:u13:subpopulation, -15:u06:molecularly, 10:u02:export, 17:u12:subpopulation, -15:u14:molecularly, -15:u05:molecularly, 10:u01:export, 17:u11:subpopulation, -15:u13:molecularly, -15:u04:molecularly, 10:u00:export, 17:u10:subpopulation, -15:u12:molecularly, -15:u03:molecularly, -15:u11:molecularly, -15:u02:molecularly, -15:u10:molecularly, -15:u01:molecularly, -18:u08:centrifugation, -15:u00:molecularly, 17:u08:compositional, 11:u08:(Boyken, -18:u07:centrifugation, 11:u07:(Boyken, -18:u06:centrifugation, 17:u07:compositional, 11:u06:(Boyken, 18:u14:centrifugation, -18:u05:centrifugation, 17:u06:compositional, 11:u05:(Boyken, 18:u13:centrifugation, 17:u14:compositional, -18:u04:centrifugation, 17:u05:compositional, 11:u04:(Boyken, 18:u12:centrifugation, 17:u13:compositional, -18:u03:centrifugation, 17:u04:compositional, 11:u03:(Boyken, 18:u11:centrifugation, 17:u12:compositional, -18:u02:centrifugation, 17:u03:compositional, 11:u02:(Boyken, 18:u10:centrifugation, 17:u11:compositional, -18:u01:centrifugation, 17:u02:compositional, 11:u01:(Boyken, 17:u10:compositional, -18:u00:centrifugation, 17:u01:compositional, 11:u00:(Boyken, 17:u00:compositional, @@ -849584,11 +864472,8 @@ 19:uI2:().""(),*.****., 18:u00:8(bp251)/Atg14, 19:uI1:().""(),*.****., -9:uI2:()-'., 11:u08:*p<0.01, 19:uI0:().""(),*.****., -9:uI1:()-'., -9:uI0:()-'., 11:u07:*p<0.01, 11:u06:*p<0.01, 19:u08:9(bp320)/Atg101, @@ -852374,7 +867259,6 @@ 10:u06:CLARK,, 16:u08:COLON-RAMOS,, 11:u12:cheung,, -7:u22:CHE, 8:u23:CHEU, 12:uI1:,..,...', 18:u00:CHANTRANUPONG,, @@ -853164,7 +868048,6 @@ 14:u07:KARABIYIK,, 10:u02:Stress, 16:u06:Compartments, -7:u22:SIN, 8:u23:SING, 22:uI0:,.,,.,,..,,..,,..,, 11:uI2:..-,..., @@ -853437,7 +868320,6 @@ 22:u03:neurodegeneration., 12:u11:prevents, 12:u13:darvish,, -6:u21:KR, 7:u22:KRE, 8:u23:KREB, 13:u00:JAWORSKI,, @@ -853470,7 +868352,6 @@ 12:u10:darvish,, 9:u12:synj1, 13:u14:kulkarni,, -7:u22:SYN, 8:u23:SYNJ, 16:uI0:.,,.,,..-,.., 10:u00:KREBS,, @@ -853587,7 +868468,6 @@ 11:u11:343-57., 14:u12:lynch-day,, 12:u14:a009357., -7:u22:LYN, 8:u23:LYNC, 21:uI1:-,..,,.,,.,,.,..., 9:u01:EPG-6, @@ -856809,38 +871689,29 @@ 12:u06:[12-16]., 8:u04:DDR,, 12:u05:[12-16]., -7:u08:ATR, 8:u07:ATM,, 8:u03:DDR,, 12:u04:[12-16]., -7:u07:ATR, 8:u06:ATM,, 8:u02:DDR,, 12:u03:[12-16]., -7:u06:ATR, 8:u14:atm,, 8:u05:ATM,, 8:u01:DDR,, 12:u02:[12-16]., -7:u05:ATR, 8:u13:atm,, 8:u04:ATM,, 8:u00:DDR,, 12:u01:[12-16]., -7:u04:ATR, 8:u12:atm,, 8:u23:ATM,, 8:u03:ATM,, 12:u00:[12-16]., -7:u03:ATR, 8:u11:atm,, 8:u02:ATM,, -7:u02:ATR, 8:u10:atm,, 8:u01:ATM,, -7:u01:ATR, 8:u00:ATM,, -7:u00:ATR, 7:u08:RBP, 7:u07:RBP, 8:u08:G1/S, @@ -856888,7 +871759,6 @@ 8:u12:p27,, 8:u23:p27,, 8:u03:p27,, -13:u08:Motivated, 13:u00:non-small, 20:u06:chemosensitivity, 8:u11:p27,, @@ -856896,26 +871766,13 @@ 20:u05:chemosensitivity, 8:u10:p27,, 8:u01:p27,, -13:u07:Motivated, 20:u04:chemosensitivity, 8:u00:p27,, -13:u06:Motivated, 20:u03:chemosensitivity, -13:u14:motivated, -13:u05:Motivated, 20:u02:chemosensitivity, -13:u13:motivated, -13:u04:Motivated, 20:u01:chemosensitivity, -13:u12:motivated, -13:u03:Motivated, 20:u00:chemosensitivity, -13:u11:motivated, -13:u02:Motivated, -13:u10:motivated, -13:u01:Motivated, 12:u08:RNA-seq,, -13:u00:Motivated, 12:u07:RNA-seq,, 12:u06:RNA-seq,, 12:u14:rna-seq,, @@ -859047,7 +873904,6 @@ 8:u10:raly, 9:u13:0.801, 12:u14:hnrnpcl1, -6:u21:HN, 7:u22:HNR, 8:u23:HNRN, 8:u01:RALY, @@ -859174,8 +874030,6 @@ 9:u10:u2af2, 9:u11:0.783, 11:u12:pcbp2-4, -7:u22:PCB, -8:u23:PCBP, 9:u00:0.787, 9:u01:U2AF2, 9:u02:0.783, @@ -859706,17 +874560,14 @@ 33:u04:https://www.bioconductor.org., 8:u08:labs, 10:u13:hosted, -13:uI2:(://.//)., 10:u04:hosted, 33:u03:https://www.bioconductor.org., 8:u07:labs, 10:u12:hosted, -13:uI1:(://.//)., 10:u03:hosted, 33:u02:https://www.bioconductor.org., 8:u06:labs, 10:u11:hosted, -13:uI0:(://.//)., 10:u02:hosted, 33:u01:https://www.bioconductor.org., 8:u05:labs, @@ -860804,7 +875655,6 @@ 19:u11:springer-verlag, 22:uI1:[],.,,.,,.,,.,,.(,, 19:u02:Springer-Verlag, -13:u08:massively, 11:u03:Coppin,, 13:u04:Messenger, 16:u05:Conventional, @@ -860820,58 +875670,45 @@ 13:u06:Zykovich,, 8:uI1:--?., 19:u00:Springer-Verlag, -13:u07:massively, 11:u01:Coppin,, 13:u02:Messenger, 16:u03:Conventional, 13:u05:Zykovich,, 8:uI0:--?., 21:uI2:[],.,,.,,..(,)--:, -13:u06:massively, 11:u08:Lander,, 11:u00:Coppin,, 13:u01:Messenger, 16:u02:Conventional, 13:u04:Zykovich,, -13:u14:massively, 21:uI1:[],.,,.,,..(,)--:, -13:u05:massively, 13:u00:Messenger, 16:u01:Conventional, 13:u03:Zykovich,, -13:u13:massively, 21:uI0:[],.,,.,,..(,)--:, 11:uI2:..,(),., -13:u04:massively, 11:u07:Lander,, 16:u00:Conventional, 13:u02:Zykovich,, -13:u12:massively, 11:uI1:..,(),., 20:uI2:[],.,,.,,..,,.,,, -13:u03:massively, 11:u06:Lander,, 10:u08:15550., 13:u01:Zykovich,, -13:u11:massively, 11:u14:lander,, 11:uI0:..,(),., 20:uI1:[],.,,.,,..,,.,,, 22:uI2:..,,..,,.,,..,,..,, -13:u02:massively, 11:u05:Lander,, 13:u00:Zykovich,, -13:u10:massively, 11:u13:lander,, 20:uI0:[],.,,.,,..,,.,,, 22:uI1:..,,..,,.,,..,,..,, -13:u01:massively, 11:u04:Lander,, 10:u07:15550., 16:u08:Costa-Silva,, 11:u12:lander,, 22:uI0:..,,..,,.,,..,,..,, -13:u00:massively, 11:u03:Lander,, 10:u06:15550., 16:u07:Costa-Silva,, @@ -862004,24 +876841,15 @@ 9:u00:GmbH,, 7:u03:CSF, 7:u02:CSF, -13:u08:biomarker, 7:u01:CSF, -13:u07:biomarker, 7:u00:CSF, -13:u06:biomarker, -13:u05:biomarker, 11:u08:cranial, -13:u04:biomarker, -13:u03:biomarker, 11:u07:cranial, 12:u08:deficit), -13:u02:biomarker, 11:u06:cranial, -13:u01:biomarker, 11:u14:cranial, 11:u05:cranial, 12:u07:deficit), -13:u00:biomarker, 11:u13:cranial, 11:u04:cranial, 12:u06:deficit), @@ -862119,24 +876947,15 @@ 13:uI0:,(.),(.),, 16:u00:supplemental, 11:u03:(44.4%), -7:u08:IL6, 11:u11:(44.4%), 11:u02:(44.4%), -7:u07:IL6, 11:u10:(44.4%), 11:u01:(44.4%), -7:u06:IL6, 11:u00:(44.4%), -7:u05:IL6, -7:u04:IL6, 20:u08:Metallopeptidase, -7:u03:IL6, 20:u07:Metallopeptidase, -7:u02:IL6, 20:u06:Metallopeptidase, -7:u01:IL6, 20:u05:Metallopeptidase, -7:u00:IL6, 20:u04:Metallopeptidase, 17:u08:Intercellular, 20:u03:Metallopeptidase, @@ -862448,24 +877267,19 @@ 12:u14:injury's, 12:u05:injury's, 12:u13:injury's, -13:u14:biomarker, 12:u04:injury's, 11:u08:vorable, 12:u12:injury's, -13:u13:biomarker, 12:u03:injury's, 12:u11:injury's, -13:u12:biomarker, 12:u02:injury's, 11:u07:vorable, 11:u08:values), 12:u10:injury's, -13:u11:biomarker, 12:u01:injury's, 11:u06:vorable, 11:u07:values), 11:u08:10-fold, -13:u10:biomarker, 11:u14:vorable, 12:u00:injury's, 11:u05:vorable, @@ -867564,7 +882378,6 @@ 14:uI0:.],.-;).,', 15:uI2:[-.,.],-()., 10:u02:0.58],, -11:u08:notably, 10:u04:-0.10,, 24:u08:neuropeptide-related, 10:u10:0.58],, @@ -867578,18 +882391,15 @@ 9:u11:[95ci, 15:uI0:[-.,.],-()., 10:u00:0.58],, -11:u07:notably, 10:u02:-0.10,, 24:u06:neuropeptide-related, 11:u08:factor), 9:u10:[95ci, -11:u06:notably, 13:u07:releasing, 10:u01:-0.10,, 24:u05:neuropeptide-related, 11:u07:factor), 11:u14:notably, -11:u05:notably, 13:u06:releasing, 10:u00:-0.10,, 24:u04:neuropeptide-related, @@ -867597,21 +882407,18 @@ 11:u13:notably, 13:u14:releasing, 9:uI2:,-(;-, -11:u04:notably, 13:u05:releasing, 24:u03:neuropeptide-related, 11:u05:factor), 11:u12:notably, 13:u13:releasing, 9:uI1:,-(;-, -11:u03:notably, 13:u04:releasing, 24:u02:neuropeptide-related, 11:u04:factor), 11:u11:notably, 13:u12:releasing, 9:uI0:,-(;-, -11:u02:notably, 13:u03:releasing, 7:u08:CRH, 24:u01:neuropeptide-related, @@ -867619,14 +882426,12 @@ 11:u10:notably, 13:u11:releasing, 17:uI2:(.[-.,.],.;)., -11:u01:notably, 13:u02:releasing, 24:u00:neuropeptide-related, 11:u02:factor), 10:u08:exerts, 13:u10:releasing, 17:uI1:(.[-.,.],.;)., -11:u00:notably, 13:u01:releasing, 7:u07:CRH, 11:u01:factor), @@ -869249,7 +884054,6 @@ 13:u05:Groenink,, 12:u06:Olivier,, 27:u07:corticotropin-releasing, -10:u08:Gross,, 34:u10:doi:10.1016/j.pbb.2011.06.027., 12:u11:griebel,, 13:u13:groenink,, @@ -869272,7 +884076,6 @@ 12:u04:Olivier,, 27:u05:corticotropin-releasing, 38:u06:doi:10.1016/S0014-2999(03)01281-0., -10:u07:Gross,, 8:u08:Hen,, 13:u11:groenink,, 12:u12:olivier,, @@ -869284,7 +884087,6 @@ 12:u03:Olivier,, 27:u04:corticotropin-releasing, 38:u05:doi:10.1016/S0014-2999(03)01281-0., -10:u06:Gross,, 11:u08:Haller,, 8:u07:Hen,, 13:u10:groenink,, @@ -869296,7 +884098,6 @@ 12:u02:Olivier,, 27:u03:corticotropin-releasing, 38:u04:doi:10.1016/S0014-2999(03)01281-0., -10:u05:Gross,, 8:u06:Hen,, 12:u10:olivier,, 27:u11:corticotropin-releasing, @@ -869306,7 +884107,6 @@ 12:u01:Olivier,, 27:u02:corticotropin-releasing, 38:u03:doi:10.1016/S0014-2999(03)01281-0., -10:u04:Gross,, 11:u07:Haller,, 8:u05:Hen,, 27:u10:corticotropin-releasing, @@ -869315,7 +884115,6 @@ 12:u00:Olivier,, 27:u01:corticotropin-releasing, 38:u02:doi:10.1016/S0014-2999(03)01281-0., -10:u03:Gross,, 11:u06:Haller,, 11:u08:Hermes,, 8:u04:Hen,, @@ -869326,7 +884125,6 @@ 13:uI2:-.,-.:./., 27:u00:corticotropin-releasing, 38:u01:doi:10.1016/S0014-2999(03)01281-0., -10:u02:Gross,, 11:u05:Haller,, 8:u03:Hen,, 12:u07:403-412., @@ -869334,7 +884132,6 @@ 11:u13:haller,, 13:uI1:-.,-.:./., 38:u00:doi:10.1016/S0014-2999(03)01281-0., -10:u01:Gross,, 11:u04:Haller,, 11:u07:Hermes,, 23:u08:synaptic-associated, @@ -869343,7 +884140,6 @@ 12:u08:profound, 11:u12:haller,, 13:uI0:-.,-.:./., -10:u00:Gross,, 11:u03:Haller,, 11:u06:Hermes,, 38:u08:doi:10.1016/j.physbeh.2010.12.019., @@ -870034,7 +884830,6 @@ 12:u12:251-259., 18:u13:leite-almeida,, 15:u14:pertovaara,, -8:u23:251-, 26:uI2:-,.,,..,,.,-,.,-,.,,.,, 10:u00:Lapiz,, 17:u01:noradrenaline, @@ -871401,7 +886196,6 @@ 10:u05:Praag,, 12:u08:Howells,, 22:u12:2982.2007.00951.x., -7:u22:298, 8:u23:2982, 12:uI0:.-.:./.-, 11:uI2:,..().?, @@ -873738,7 +888532,6 @@ 9:u04:mSerT, 8:u08:5.18, 9:u12:msert, -6:u21:mS, 7:u22:mSe, 8:u23:mSer, 9:u03:mSerT, @@ -874436,7 +889229,6 @@ 8:u12:snvs, 13:u13:2,280,175, 10:u14:(minor, -7:u22:SNV, 8:u23:SNVs, 10:uI0:,,).,,, 17:uI2:,,(.)(.),,(.), @@ -874645,7 +889437,6 @@ 15:u04:AFR/AMR/ASN, 9:u03:4,325, 12:u04:sharing., -14:u08:confirming, 12:u11:mixture:, 15:u12:afr/amr/asn, 7:u22:AFR, @@ -874657,7 +889448,6 @@ 11:u07:tions"), 9:u02:4,325, 12:u03:sharing., -14:u07:confirming, 12:u10:mixture:, 15:u11:afr/amr/asn, 10:uI0://.(),, @@ -874667,7 +889457,6 @@ 14:u08:Europeans., 9:u01:4,325, 12:u02:sharing., -14:u06:confirming, 15:u10:afr/amr/asn, 11:u14:tions"), 7:uI2:("-, @@ -874676,7 +889465,6 @@ 11:u05:tions"), 9:u00:4,325, 12:u01:sharing., -14:u05:confirming, 11:u13:tions"), 7:uI1:("-, 14:uI2:")(,)(..)., @@ -874684,29 +889472,24 @@ 11:u04:tions"), 14:u07:Europeans., 12:u00:sharing., -14:u04:confirming, 11:u12:tions"), 7:uI0:("-, 14:uI1:")(,)(..)., 11:u03:tions"), 14:u06:Europeans., -14:u03:confirming, 11:u11:tions"), 14:u14:europeans., 14:uI0:")(,)(..)., 11:u02:tions"), 14:u05:Europeans., -14:u02:confirming, 11:u10:tions"), 14:u13:europeans., 11:u01:tions"), 14:u04:Europeans., -14:u01:confirming, 14:u12:europeans., 9:u14:(48)., 11:u00:tions"), 14:u03:Europeans., -14:u00:confirming, 14:u11:europeans., 9:u13:(48)., 14:u02:Europeans., @@ -875599,20 +890382,11 @@ 24:uI2:.,.,.,.,.,/,/,/,/,/(, 24:uI1:.,.,.,.,.,/,/,/,/,/(, 24:uI0:.,.,.,.,.,/,/,/,/,/(, -12:u08:Project., -12:u07:Project., 12:uI2:().--()., -12:u06:Project., 12:uI1:().--()., -12:u05:Project., 12:uI0:().--()., -12:u04:Project., -12:u03:Project., -12:u02:Project., 9:uI2:().:., -12:u01:Project., 9:uI1:().:., -12:u00:Project., 9:uI0:().:., 8:uI2:/).-, 8:uI1:/).-, @@ -876070,13 +890844,10 @@ 26:u13:european/asian/african, 26:u04:European/Asian/African, 26:u12:european/asian/african, -9:uI2:.://., 26:u03:European/Asian/African, 26:u11:european/asian/african, -9:uI1:.://., 26:u02:European/Asian/African, 26:u10:european/asian/african, -9:uI0:.://., 26:u01:European/Asian/African, 26:u00:European/Asian/African, 14:u14:europeans,, @@ -880206,7 +894977,6 @@ 13:u01:mutation;, 9:u04:erved, 8:u06:omic, -7:u08:den, 7:u11:ong, 9:u12:erved, 8:u14:omic, @@ -880221,7 +894991,6 @@ 9:u02:erved, 8:u04:omic, 12:u06:ericans,, -7:u07:den, 11:u08:ctional, 9:u10:erved, 8:u12:omic, @@ -880230,59 +894999,46 @@ 9:u01:erved, 8:u03:omic, 12:u05:ericans,, -7:u06:den, 8:u11:omic, 12:u13:ericans,, -7:u14:den, 9:uI2:,;.),, 9:u00:erved, 8:u02:omic, 12:u04:ericans,, -7:u05:den, 11:u07:ctional, 8:u10:omic, 12:u12:ericans,, -7:u13:den, 7:u22:eri, 8:u23:eric, 9:uI1:,;.),, 8:u01:omic, 12:u03:ericans,, -7:u04:den, 11:u06:ctional, 12:u08:plicable, 12:u11:ericans,, -7:u12:den, 11:u14:ctional, -7:u23:den, 9:uI0:,;.),, 8:u00:omic, 12:u02:ericans,, -7:u03:den, 11:u05:ctional, 12:u10:ericans,, -7:u11:den, 11:u13:ctional, 10:uI2:(,(.),, 12:u01:ericans,, -7:u02:den, 11:u04:ctional, 12:u07:plicable, 9:u08:thods, -7:u10:den, 11:u12:ctional, 6:u21:ct, 7:u22:cti, 8:u23:ctio, 10:uI1:(,(.),, 12:u00:ericans,, -7:u01:den, 11:u03:ctional, 12:u06:plicable, 11:u11:ctional, 12:u14:plicable, 10:uI0:(,(.),, -7:u00:den, 11:u02:ctional, 12:u05:plicable, 9:u07:thods, @@ -880722,8 +895478,6 @@ 11:u01:35m/58f, 7:u02:93s, 8:u06:ASIA, -7:u22:AME, -8:u23:AMER, 10:u02:EUROPE, 12:u03:AMERICAS, 10:u04:AFRICA, @@ -881195,35 +895949,26 @@ 8:u23:Bust, 15:u03:Bustamante., 12:u06:origins., -10:u08:Burns,, 15:u11:bustamante., 11:uI2:[]....., 15:u02:Bustamante., 12:u05:origins., -10:u07:Burns,, 15:u10:bustamante., 11:uI1:[]....., 15:u01:Bustamante., 12:u04:origins., -10:u06:Burns,, 11:uI0:[]....., 24:uI2:[]..,..,.,..,..,.,.,, 15:u00:Bustamante., 12:u03:origins., -10:u05:Burns,, 24:uI1:[]..,..,.,..,..,.,.,, 17:uI2:.,.,.,.,.,..., 12:u02:origins., -10:u04:Burns,, 24:uI0:[]..,..,.,..,..,.,.,, 17:uI1:.,.,.,.,.,..., 12:u01:origins., -10:u03:Burns,, 17:uI0:.,.,.,.,.,..., 12:u00:origins., -10:u02:Burns,, -10:u01:Burns,, -10:u00:Burns,, 9:u08:Bodo,, 12:uI2:[].....:, 8:u08:791,, @@ -882966,7 +897711,6 @@ 11:u02:sweeps,, 13:u06:four-fold, 10:u12:mantel, -8:u23:Mant, 10:u03:Mantel, 11:u01:sweeps,, 13:u05:four-fold, @@ -885390,7 +900134,6 @@ 8:u23:ToLs, 15:u01:artificial), 8:u03:ToLs, -20:u08:well-established, 11:u00:"create, 16:u07:differently,, 8:u11:tols, @@ -885399,34 +900142,22 @@ 16:u06:differently,, 8:u10:tols, 8:u01:ToLs, -20:u07:well-established, 16:u05:differently,, 8:u00:ToLs, -20:u06:well-established, 16:u04:differently,, -20:u14:well-established, -20:u05:well-established, 12:u08:Weston's, 16:u03:differently,, -20:u13:well-established, -20:u04:well-established, 18:u08:preponderantly, 16:u02:differently,, 14:u08:generality, -20:u12:well-established, -20:u03:well-established, 12:u07:Weston's, 16:u01:differently,, 14:u07:generality, -20:u11:well-established, -20:u02:well-established, 12:u06:Weston's, 18:u07:preponderantly, 16:u00:differently,, 14:u06:generality, -20:u10:well-established, 12:u14:weston's, -20:u01:well-established, 12:u05:Weston's, 18:u06:preponderantly, 14:u05:generality, @@ -885434,7 +900165,6 @@ 12:u13:weston's, 18:u14:preponderantly, 9:uI2:'[,],, -20:u00:well-established, 12:u04:Weston's, 18:u05:preponderantly, 14:u04:generality, @@ -886629,11 +901359,8 @@ 12:uI1:...,:.,-, 13:u06:symbiosis, 12:uI0:...,:.,-, -11:uI2:...,..,, 13:u05:symbiosis, -11:uI1:...,..,, 13:u04:symbiosis, -11:uI0:...,..,, 16:uI2:..-,.,.,.,.,, 13:u03:symbiosis, 16:uI1:..-,.,.,.,.,, @@ -889997,8 +904724,6 @@ 10:u07:(58.1), 10:u08:(64.1), 14:u11:post-event, -7:u22:Bli, -8:u23:Blin, 14:u02:Post-event, 11:u03:Blinded, 8:u08:6096, @@ -890483,15 +905208,12 @@ 15:u06:variations., 11:u07:(12/70), 15:u05:variations., -9:uI2:..(/), 11:u06:(12/70), 15:u04:variations., 11:u14:(12/70), -9:uI1:..(/), 11:u05:(12/70), 15:u03:variations., 11:u13:(12/70), -9:uI0:..(/), 11:u04:(12/70), 15:u02:variations., 11:u12:(12/70), @@ -891310,7 +906032,6 @@ 7:u13:chd, 10:u03:(11.4), 7:u12:chd, -7:u22:CHD, 7:u23:CHD, 10:u02:(11.4), 7:u11:chd, @@ -892686,32 +907407,23 @@ 12:u10:dmrcate,, 12:u01:DMRcate,, 12:u00:DMRcate,, -11:u08:timings, 9:u14:stark, -11:u07:timings, 9:u13:stark, -11:u06:timings, 9:u12:stark, 11:u14:timings, -11:u05:timings, 9:u11:stark, 11:u13:timings, -11:u04:timings, 11:u08:(FASD),, 9:u10:stark, 11:u12:timings, -11:u03:timings, 11:u07:(FASD),, 18:u08:abnormalities,, 11:u11:timings, -11:u02:timings, 11:u06:(FASD),, 18:u07:abnormalities,, 11:u10:timings, -11:u01:timings, 11:u05:(FASD),, 18:u06:abnormalities,, -11:u00:timings, 11:u04:(FASD),, 18:u05:abnormalities,, 11:u03:(FASD),, @@ -893152,13 +907864,10 @@ 8:u02:out", 13:u07:NK-cells,, 8:u10:out", -10:uI2:[].[],, 8:u01:out", 13:u06:NK-cells,, -10:uI1:[].[],, 8:u00:out", 13:u05:NK-cells,, -10:uI0:[].[],, 13:u04:NK-cells,, 17:u08:P-value<0.05,, 13:u03:NK-cells,, @@ -893598,13 +908307,11 @@ 7:u05:S10, 12:u04:models)., 11:u06:ALSPAC,, -10:u08:panel:, 7:u13:s10, 11:uI1:-).-*--, 7:u04:S10, 12:u03:models)., 11:u05:ALSPAC,, -10:u07:panel:, 7:u12:s10, 7:u23:S10, 11:uI0:-).-*--, @@ -893612,39 +908319,32 @@ 9:u08:(90%), 12:u02:models)., 11:u04:ALSPAC,, -10:u06:panel:, 7:u11:s10, 7:u02:S10, 12:u01:models)., 11:u03:ALSPAC,, -10:u05:panel:, 7:u10:s10, 7:u01:S10, 9:u07:(90%), 12:u00:models)., 11:u02:ALSPAC,, -10:u04:panel:, 7:u00:S10, 9:u06:(90%), 11:u01:ALSPAC,, -10:u03:panel:, 9:u14:(90%), 9:uI2:,-.,/, 9:u05:(90%), 20:u08:Portales-Casamar, 11:u00:ALSPAC,, -10:u02:panel:, 9:u13:(90%), 9:uI1:,-.,/, 9:u04:(90%), -10:u01:panel:, 9:u12:(90%), 7:u22:(90, 8:u23:(90%, 9:uI0:,-.,/, 9:u03:(90%), 20:u07:Portales-Casamar, -10:u00:panel:, 9:u11:(90%), 9:u02:(90%), 20:u06:Portales-Casamar, @@ -896031,7 +910731,6 @@ 11:u05:2.1E-10, 11:u06:2.0E-07, 10:u07:Chr17:, -10:u08:ALOX12, 19:u07:6899085-6899759, 28:u10:chr5:110062343-110062838, 11:u12:tmem232, @@ -896054,7 +910753,6 @@ 11:u03:2.1E-10, 11:u04:2.0E-07, 10:u05:Chr17:, -10:u07:ALOX12, 11:u08:9.3E-07, 19:u05:6899085-6899759, 11:u10:tmem232, @@ -896066,31 +910764,26 @@ 11:u02:2.1E-10, 11:u03:2.0E-07, 10:u04:Chr17:, -10:u06:ALOX12, 11:u07:1.3E-09, 10:u08:Chr12:, 19:u04:6899085-6899759, 11:u10:2.1e-10, 11:u11:2.0e-07, 10:u12:chr17:, -10:u14:alox12, 11:u00:TMEM232, 11:u01:2.1E-10, 11:u02:2.0E-07, 10:u03:Chr17:, -10:u05:ALOX12, 11:u06:1.3E-09, 11:u07:9.3E-07, 19:u03:6899085-6899759, 21:u08:31271783-31272120, 11:u10:2.0e-07, 10:u11:chr17:, -10:u13:alox12, 11:u14:1.3e-09, 11:u00:2.1E-10, 11:u01:2.0E-07, 10:u02:Chr17:, -10:u04:ALOX12, 11:u05:1.3E-09, 11:u06:9.3E-07, 10:u07:Chr12:, @@ -896098,14 +910791,10 @@ 19:u02:6899085-6899759, 21:u07:31271783-31272120, 10:u10:chr17:, -10:u12:alox12, 11:u13:1.3e-09, 11:u14:9.3e-07, -7:u22:ALO, -8:u23:ALOX, 11:u00:2.0E-07, 10:u01:Chr17:, -10:u03:ALOX12, 11:u04:1.3E-09, 11:u05:9.3E-07, 10:u06:Chr12:, @@ -896113,13 +910802,11 @@ 19:u01:6899085-6899759, 21:u06:31271783-31272120, 11:u08:8.8E-09, -10:u11:alox12, 11:u12:1.3e-09, 11:u13:9.3e-07, 10:u14:chr12:, 8:u23:1.3E, 10:u00:Chr17:, -10:u02:ALOX12, 11:u03:1.3E-09, 11:u04:9.3E-07, 10:u05:Chr12:, @@ -896128,12 +910815,10 @@ 19:u00:6899085-6899759, 21:u05:31271783-31272120, 11:u07:8.8E-09, -10:u10:alox12, 11:u11:1.3e-09, 11:u12:9.3e-07, 10:u13:chr12:, 8:u23:9.3E, -10:u01:ALOX12, 11:u02:1.3E-09, 11:u03:9.3E-07, 10:u04:Chr12:, @@ -896146,7 +910831,6 @@ 11:u11:9.3e-07, 10:u12:chr12:, 17:u14:dkfzp434c0631, -10:u00:ALOX12, 11:u01:1.3E-09, 11:u02:9.3E-07, 10:u03:Chr12:, @@ -896916,7 +911600,6 @@ 9:u10:chr4:, 10:u12:lrpap1, 11:u13:9.2e-06, -7:u22:LRP, 8:u23:LRPA, 11:u00:7.4E-03, 9:u01:Chr4:, @@ -897422,25 +912105,21 @@ 10:u07:GAL4),, 14:u06:(24B-GAL4,, 8:u08:TRiP, -11:u14:drivers, 10:u06:GAL4),, 13:u07:UAS-shRNA, 14:u05:(24B-GAL4,, 8:u07:TRiP, -11:u13:drivers, 10:u14:gal4),, 10:u05:GAL4),, 13:u06:UAS-shRNA, 14:u04:(24B-GAL4,, 8:u06:TRiP, -11:u12:drivers, 10:u13:gal4),, 13:u14:uas-shrna, 10:u04:GAL4),, 13:u05:UAS-shRNA, 14:u03:(24B-GAL4,, 8:u05:TRiP, -11:u11:drivers, 10:u12:gal4),, 13:u13:uas-shrna, 8:u23:GAL4, @@ -897449,7 +912128,6 @@ 11:u08:crosses, 14:u02:(24B-GAL4,, 8:u04:TRiP, -11:u10:drivers, 10:u11:gal4),, 13:u12:uas-shrna, 7:u22:UAS, @@ -897512,7 +912190,6 @@ 24:u08:ACGGGGACTATGGGGAGAAA, 10:u01:virgin, 24:u07:CTGACCCACAGCAGAAGAGG, -10:u14:cdkn1a, 12:u00:crosses,, 10:u05:Cdkn1a, 24:u06:GGAACATCTCAGGGCCGAAA, @@ -897520,7 +912197,6 @@ 10:u00:virgin, 24:u06:CTGACCCACAGCAGAAGAGG, 24:u08:AATCTCACAGTCGCACAGCA, -10:u13:cdkn1a, 24:u14:ggaacatctcagggccgaaa, 10:u04:Cdkn1a, 24:u05:GGAACATCTCAGGGCCGAAA, @@ -897528,7 +912204,6 @@ 24:u08:CCACCTCCAACTGCTCTGAC, 24:u05:CTGACCCACAGCAGAAGAGG, 24:u07:AATCTCACAGTCGCACAGCA, -10:u12:cdkn1a, 24:u13:ggaacatctcagggccgaaa, 9:u14:mef2c, 7:u22:Cdk, @@ -897540,7 +912215,6 @@ 24:u08:AGCTGGACACGGAGCTTTTA, 24:u04:CTGACCCACAGCAGAAGAGG, 24:u06:AATCTCACAGTCGCACAGCA, -10:u11:cdkn1a, 24:u12:ggaacatctcagggccgaaa, 9:u13:mef2c, 24:u14:acggggactatggggagaaa, @@ -897553,7 +912227,6 @@ 9:u08:Myod1, 24:u03:CTGACCCACAGCAGAAGAGG, 24:u05:AATCTCACAGTCGCACAGCA, -10:u10:cdkn1a, 24:u11:ggaacatctcagggccgaaa, 9:u12:mef2c, 24:u13:acggggactatggggagaaa, @@ -898036,25 +912709,21 @@ 9:u07:31039, 9:u08:31314, 9:u01:Stock, -8:u14:tsc1, 15:u00:Bloomington, 8:u05:Tsc1, 9:u06:31039, 9:u00:Stock, -8:u13:tsc1, 9:u14:31039, 8:u04:Tsc1, 9:u05:31039, 9:u07:31314, 9:u08:35144, -8:u12:tsc1, 9:u13:31039, 7:u22:Tsc, 8:u23:Tsc1, 8:u03:Tsc1, 9:u04:31039, 9:u06:31314, -8:u11:tsc1, 9:u12:31039, 9:u14:31314, 8:u23:3103, @@ -898062,7 +912731,6 @@ 9:u03:31039, 9:u05:31314, 9:u07:35144, -8:u10:tsc1, 9:u11:31039, 9:u13:31314, 8:u01:Tsc1, @@ -899632,7 +914300,6 @@ 23:u08:rapamycin-sensitive, 15:u12:tsc2-mtorc1, 9:u13:e6189, -7:u22:TSC, 8:u23:TSC2, 15:u03:TSC2-mTORC1, 9:u04:e6189, @@ -900784,7 +915451,6 @@ 9:u05:31528, 9:u06:31529, 9:u07:34814, -10:u08:Driver, 8:u11:pupa, 9:u13:31528, 9:u14:31529, @@ -900795,7 +915461,6 @@ 9:u05:31529, 9:u06:34814, 14:u07:24B−GAL4, -10:u07:Driver, 8:u10:pupa, 9:u12:31528, 9:u13:31529, @@ -900807,7 +915472,6 @@ 9:u04:31529, 9:u05:34814, 14:u06:24B−GAL4, -10:u06:Driver, 9:u11:31528, 9:u12:31529, 9:u13:34814, @@ -900818,7 +915482,6 @@ 9:u03:31529, 9:u04:34814, 14:u05:24B−GAL4, -10:u05:Driver, 9:u10:31528, 9:u11:31529, 9:u12:34814, @@ -900829,7 +915492,6 @@ 9:u02:31529, 9:u03:34814, 14:u04:24B−GAL4, -10:u04:Driver, 9:u10:31529, 9:u11:34814, 14:u12:24b−gal4, @@ -900838,23 +915500,19 @@ 9:u01:31529, 9:u02:34814, 14:u03:24B−GAL4, -10:u03:Driver, 9:u10:34814, 14:u11:24b−gal4, 9:u00:31529, 9:u01:34814, 14:u02:24B−GAL4, 14:u08:shRNA/GAL4, -10:u02:Driver, 14:u10:24b−gal4, 9:u00:34814, 14:u01:24B−GAL4, 16:u08:shRNA/TM3,Sb, -10:u01:Driver, 14:u00:24B−GAL4, 14:u07:shRNA/GAL4, 13:u08:GAL4/TM6B, -10:u00:Driver, 14:u06:shRNA/GAL4, 16:u07:shRNA/TM3,Sb, 14:u14:shrna/gal4, @@ -901872,25 +916530,21 @@ 9:u07:16386, 9:u08:phore, 7:u02:CuN, -8:u08:FTIR, 9:u06:16386, 10:u07:tion)., 7:u01:CuN, -8:u07:FTIR, 9:u14:16386, 9:u05:16386, 10:u06:tion)., 9:u07:phore, 14:u08:disordered, 7:u00:CuN, -8:u06:FTIR, 9:u13:16386, 10:u14:tion)., 17:uI2:...-.,....,,-, 9:u04:16386, 10:u05:tion)., 9:u06:phore, -8:u05:FTIR, 9:u12:16386, 10:u13:tion)., 9:u14:phore, @@ -901899,7 +916553,6 @@ 10:u04:tion)., 9:u05:phore, 14:u07:disordered, -8:u04:FTIR, 9:u11:16386, 10:u12:tion)., 9:u13:phore, @@ -901908,7 +916561,6 @@ 10:u03:tion)., 9:u04:phore, 14:u06:disordered, -8:u03:FTIR, 9:u10:16386, 10:u11:tion)., 9:u12:phore, @@ -901917,7 +916569,6 @@ 10:u02:tion)., 9:u03:phore, 14:u05:disordered, -8:u02:FTIR, 10:u10:tion)., 9:u11:phore, 14:u13:disordered, @@ -901926,13 +916577,11 @@ 9:u02:phore, 14:u04:disordered, 18:u08:polydispersity, -8:u01:FTIR, 9:u10:phore, 14:u12:disordered, 10:u00:tion)., 9:u01:phore, 14:u03:disordered, -8:u00:FTIR, 14:u11:disordered, 9:u00:phore, 14:u02:disordered, @@ -902832,7 +917481,6 @@ 13:u03:Aspects,S, 14:u05:Adv.Mater., 10:u07:1306;c, -6:u08:.H, 14:u13:zollfrank,, 19:uI1:[]).,.,.,..,.,., 17:uI2:,..,,;)..,..,, @@ -902842,7 +917490,6 @@ 13:u02:Aspects,S, 14:u04:Adv.Mater., 10:u06:1306;c, -6:u07:.H, 16:u08:.Alivisatos,, 14:u12:zollfrank,, 9:u14:107,2, @@ -902858,7 +917505,6 @@ 13:u01:Aspects,S, 14:u03:Adv.Mater., 10:u05:1306;c, -6:u06:.H, 16:u07:.Alivisatos,, 17:u08:Zherebetskyy,, 14:u11:zollfrank,, @@ -902875,7 +917521,6 @@ 13:u00:Aspects,S, 14:u02:Adv.Mater., 10:u04:1306;c, -6:u05:.H, 16:u06:.Alivisatos,, 17:u07:Zherebetskyy,, 14:u10:zollfrank,, @@ -902892,7 +917537,6 @@ 10:u08:Zhao,W, 14:u01:Adv.Mater., 10:u03:1306;c, -6:u04:.H, 16:u05:.Alivisatos,, 17:u06:Zherebetskyy,, 13:u08:.Ritchie,, @@ -902911,11 +917555,9 @@ 18:u07:Alivisatos,R.O, 14:u00:Adv.Mater., 10:u02:1306;c, -6:u03:.H, 16:u04:.Alivisatos,, 17:u05:Zherebetskyy,, 13:u07:.Ritchie,, -6:u08:.L, 9:u10:107,2, 11:u11:luong,l, 15:u12:ritchie,a.p, @@ -902927,11 +917569,9 @@ 18:u06:Alivisatos,R.O, 10:u07:Zhao,W, 10:u01:1306;c, -6:u02:.H, 16:u03:.Alivisatos,, 17:u04:Zherebetskyy,, 13:u06:.Ritchie,, -6:u07:.L, 11:u10:luong,l, 15:u11:ritchie,a.p, 18:u14:alivisatos,r.o, @@ -902943,11 +917583,9 @@ 18:u05:Alivisatos,R.O, 10:u06:Zhao,W, 10:u00:1306;c, -6:u01:.H, 16:u02:.Alivisatos,, 17:u03:Zherebetskyy,, 13:u05:.Ritchie,, -6:u06:.L, 15:u10:ritchie,a.p, 18:u13:alivisatos,r.o, 10:u14:zhao,w, @@ -902958,11 +917596,9 @@ 18:u04:Alivisatos,R.O, 10:u05:Zhao,W, 11:u08:Imato,T, -6:u00:.H, 16:u01:.Alivisatos,, 17:u02:Zherebetskyy,, 13:u04:.Ritchie,, -6:u05:.L, 18:u12:alivisatos,r.o, 10:u13:zhao,w, 14:u14:stevenson,, @@ -902976,7 +917612,6 @@ 16:u00:.Alivisatos,, 17:u01:Zherebetskyy,, 13:u03:.Ritchie,, -6:u04:.L, 14:u08:.Kanehara,, 18:u11:alivisatos,r.o, 10:u12:zhao,w, @@ -902990,7 +917625,6 @@ 28:u08:Kosuge,K.Imato,R.Goseki,, 17:u00:Zherebetskyy,, 13:u02:.Ritchie,, -6:u03:.L, 14:u07:.Kanehara,, 14:u08:Takahara,H, 18:u10:alivisatos,r.o, @@ -903004,7 +917638,6 @@ 11:u06:Imato,T, 8:u08:49,5, 13:u01:.Ritchie,, -6:u02:.L, 14:u06:.Kanehara,, 14:u07:Takahara,H, 10:u10:zhao,w, @@ -903018,7 +917651,6 @@ 11:u05:Imato,T, 28:u07:Kosuge,K.Imato,R.Goseki,, 13:u00:.Ritchie,, -6:u01:.L, 14:u05:.Kanehara,, 14:u06:Takahara,H, 8:u08:903., @@ -903031,7 +917663,6 @@ 11:u04:Imato,T, 28:u06:Kosuge,K.Imato,R.Goseki,, 8:u07:49,5, -6:u00:.L, 14:u04:.Kanehara,, 14:u05:Takahara,H, 8:u07:903., @@ -904373,40 +919004,31 @@ 9:uI2:.(;'-, 12:u04:overall., 18:u02:LCA-preserving, -8:u08:seek, 12:u12:overall., 9:uI1:.(;'-, 12:u03:overall., 18:u01:LCA-preserving, -8:u07:seek, 12:u11:overall., 9:uI0:.(;'-, 18:uI2:(,')(,').((,'), 12:u02:overall., 18:u00:LCA-preserving, -8:u06:seek, 12:u10:overall., 18:uI1:(,')(,').((,'), 12:u01:overall., -8:u05:seek, 18:uI0:(,')(,').((,'), 12:u00:overall., -8:u04:seek, 13:uI2:(,')(,')., 11:u08:weaker,, -8:u03:seek, 18:u08:LeA-preserving, 13:uI1:(,')(,')., -8:u02:seek, 18:u07:LeA-preserving, 24:u08:dominance-preserving, 13:uI0:(,')(,')., 11:u07:weaker,, -8:u01:seek, 18:u06:LeA-preserving, 24:u07:dominance-preserving, 11:u06:weaker,, -8:u00:seek, 18:u05:LeA-preserving, 24:u06:dominance-preserving, 11:u14:weaker,, @@ -906938,7 +921560,6 @@ 8:u12:scsr, 13:u13:(russia);, 18:u14:(switzerland);, -7:u22:SCS, 8:u23:SCSR, 15:uI0:);();();();, 11:uI2:();,();, @@ -908639,16 +923260,11 @@ 7:uI0:?.?, 6:u00:3?, 11:u07:B-site., -11:u14:arising, 11:u06:B-site., -11:u13:arising, 11:u05:B-site., -11:u12:arising, 9:u08:Bragg, 11:u04:B-site., -11:u11:arising, 11:u03:B-site., -11:u10:arising, 9:u07:Bragg, 11:u02:B-site., 9:u06:Bragg, @@ -910527,7 +925143,6 @@ 12:u08:Kamilov,, 10:u10:cobalt, 9:u13:hahn,, -15:u14:crystalline, 15:uI0:.......,-(), 23:uI1:.,.,,..,,.,,..,,..,, 10:u01:cobalt, @@ -910536,7 +925151,6 @@ 9:u06:spray, 12:u07:Kamilov,, 9:u12:hahn,, -15:u13:crystalline, 13:u14:nebulized, 23:uI0:.,.,,..,,.,,..,,..,, 12:uI2:..-(.,.), @@ -910548,7 +925162,6 @@ 12:u06:Kamilov,, 9:u08:OYu.,, 9:u11:hahn,, -15:u12:crystalline, 13:u13:nebulized, 12:uI1:..-(.,.), 14:uI2:....(),-(), @@ -910560,7 +925173,6 @@ 12:u05:Kamilov,, 9:u07:OYu.,, 9:u10:hahn,, -15:u11:crystalline, 13:u12:nebulized, 15:u14:aliverdiev,, 7:u22:neb, @@ -910574,7 +925186,6 @@ 9:u03:spray, 12:u04:Kamilov,, 9:u06:OYu.,, -15:u10:crystalline, 13:u11:nebulized, 15:u13:aliverdiev,, 10:u14:benko,, @@ -915120,15 +929731,6 @@ 11:uI2:.).,,,,, 11:uI1:.).,,,,, 11:uI0:.).,,,,, -9:u08:drug., -9:u07:drug., -9:u06:drug., -9:u05:drug., -9:u04:drug., -9:u03:drug., -9:u02:drug., -9:u01:drug., -9:u00:drug., 9:u08:eQTL,, 9:u07:eQTL,, 9:u06:eQTL,, @@ -915405,7 +930007,6 @@ 14:u12:alkylating, 13:u13:alkylates, 10:u14:arrest, -8:u23:Alky, 14:u02:Carmustine, 14:u03:Alkylating, 13:u04:Alkylates, @@ -915493,7 +930094,6 @@ 13:u02:Puromycin, 19:u03:Aminonucleoside, 18:u06:aminoacyl-tRNA, -10:u08:Silver, 19:u11:aminonucleoside, 18:u14:aminoacyl-trna, 11:u00:breaks,, @@ -915506,33 +930106,24 @@ 13:u00:Puromycin, 19:u01:Aminonucleoside, 18:u04:aminoacyl-tRNA, -10:u07:Silver, 17:u08:Multi-faceted, 18:u12:aminoacyl-trna, 19:u00:Aminonucleoside, 18:u03:aminoacyl-tRNA, -10:u06:Silver, 18:u11:aminoacyl-trna, 18:u02:aminoacyl-tRNA, -10:u05:Silver, 17:u07:Multi-faceted, 18:u10:aminoacyl-trna, 18:u01:aminoacyl-tRNA, -10:u04:Silver, 17:u06:Multi-faceted, 17:u14:multi-faceted, -8:u23:Silv, 18:u00:aminoacyl-tRNA, -10:u03:Silver, 17:u05:Multi-faceted, 17:u13:multi-faceted, -10:u02:Silver, 17:u04:Multi-faceted, 17:u12:multi-faceted, -10:u01:Silver, 17:u03:Multi-faceted, 17:u11:multi-faceted, -10:u00:Silver, 17:u02:Multi-faceted, 17:u10:multi-faceted, 17:u01:Multi-faceted, @@ -915980,7 +930571,6 @@ 11:u04:234-37., 13:u05:Borrello,, 11:u06:Cancer:, -10:u08:Brady,, 12:u03:"Finding, 9:u07:Windy, 10:u10:bloom,, @@ -916007,7 +930597,6 @@ 11:u02:234-37., 13:u03:Borrello,, 11:u04:Cancer:, -10:u07:Brady,, 22:u08:Bleomycin-Response, 12:u01:"Finding, 9:u05:Windy, @@ -916020,7 +930609,6 @@ 11:u01:234-37., 13:u02:Borrello,, 11:u03:Cancer:, -10:u06:Brady,, 10:u07:Daehan, 14:u08:Breitling,, 12:u00:"Finding, @@ -916034,7 +930622,6 @@ 11:u00:234-37., 13:u01:Borrello,, 11:u02:Cancer:, -10:u05:Brady,, 10:u06:Daehan, 22:u07:Bleomycin-Response, 12:u08:Gerrits,, @@ -916048,7 +930635,6 @@ 14:uI2:,.,,.,.,.,, 13:u00:Borrello,, 11:u01:Cancer:, -10:u04:Brady,, 10:u05:Daehan, 22:u06:Bleomycin-Response, 14:u07:Breitling,, @@ -916061,7 +930647,6 @@ 9:uI0:.":-., 14:uI1:,.,,.,.,.,, 11:u00:Cancer:, -10:u03:Brady,, 10:u04:Daehan, 22:u05:Bleomycin-Response, 14:u06:Breitling,, @@ -916079,7 +930664,6 @@ 8:u23:Daeh, 14:uI0:,.,,.,.,.,, 12:uI2:-."():-., -10:u02:Brady,, 10:u03:Daehan, 22:u04:Bleomycin-Response, 14:u05:Breitling,, @@ -916095,7 +930679,6 @@ 12:u14:gerrits,, 12:uI1:-."():-., 12:uI2:,,,.,,,,, -10:u01:Brady,, 10:u02:Daehan, 22:u03:Bleomycin-Response, 14:u04:Breitling,, @@ -916113,7 +930696,6 @@ 12:uI0:-."():-., 12:uI1:,,,.,,,,, 11:uI2:,..":.", -10:u00:Brady,, 10:u01:Daehan, 22:u02:Bleomycin-Response, 14:u03:Breitling,, @@ -928058,7 +942640,6 @@ 13:u14:receivers, 13:uI0:.,.,.:-.:, 16:uI1:(.,.,.)-(,)., -18:uI2:.,.,,..,,..,.., 11:u01:156-189, 13:u05:receivers, 16:u07:great-tailed, @@ -928066,7 +942647,6 @@ 12:u07:grackles, 13:u13:receivers, 16:uI0:(.,.,.)-(,)., -18:uI1:.,.,,..,,..,.., 11:u00:156-189, 13:u04:receivers, 16:u06:great-tailed, @@ -928074,7 +942654,6 @@ 12:u06:grackles, 13:u12:receivers, 16:u14:great-tailed, -18:uI0:.,.,,..,,..,.., 19:uI2:.,..,,..,,..,.., 13:u03:receivers, 16:u05:great-tailed, @@ -928569,32 +943148,27 @@ 11:u01:Konner,, 12:u03:Grieser,, 12:u12:prosodic, -13:u14:evidence., 12:uI2:.,.,.-:-, 12:u03:prosodic, 13:u07:preverbal, 11:u00:Konner,, 12:u02:Grieser,, 12:u11:prosodic, -13:u13:evidence., 12:uI1:.,.,.-:-, 12:u02:prosodic, 13:u06:preverbal, 12:u01:Grieser,, 12:u10:prosodic, -13:u12:evidence., 13:u14:preverbal, 12:uI0:.,.,.-:-, 11:uI2:.,..-'', 12:u01:prosodic, 13:u05:preverbal, 12:u00:Grieser,, -13:u11:evidence., 13:u13:preverbal, 11:uI1:.,..-'', 12:u00:prosodic, 13:u04:preverbal, -13:u10:evidence., 13:u12:preverbal, 11:uI0:.,..-'', 13:u03:preverbal, @@ -928954,13 +943528,11 @@ 11:u02:261-268, 12:u05:Mertens,, 7:u10:r.), -10:uI2:.,.:-., 7:u01:R.), 12:u07:Rpackage, 11:u01:261-268, 12:u04:Mertens,, 9:u08:Yale,, -10:uI1:.,.:-., 7:u00:R.), 12:u06:Rpackage, 11:u00:261-268, @@ -928968,7 +943540,6 @@ 9:u07:Yale,, 13:u08:Salselas,, 12:u14:rpackage, -10:uI0:.,.:-., 14:uI2:.,.,,.,.-., 12:u05:Rpackage, 12:u02:Mertens,, @@ -929116,7 +943687,6 @@ 11:u02:Buyens,, 10:u04:(IEEE,, 7:u12:975, -7:u22:975, 7:u23:975, 7:u03:975, 11:u01:Buyens,, @@ -932216,7 +946786,6 @@ 14:u07:Harnessing, 17:u10:raubenheimer,, 13:u12:lemaitre,, -7:u14:ma,, 8:u23:Lema, 13:uI1:,.,-,.,.., 17:u01:Raubenheimer,, @@ -932227,7 +946796,6 @@ 9:u00:K.P.,, 14:u06:Harnessing, 13:u11:lemaitre,, -7:u13:ma,, 13:uI0:,.,-,.,.., 17:u00:Raubenheimer,, 13:u02:Lemaitre,, @@ -932236,7 +946804,6 @@ 12:u08:Allison,, 14:u05:Harnessing, 13:u10:lemaitre,, -7:u12:ma,, 9:u14:mair,, 7:u22:Ma,, 7:u23:Ma,, @@ -932246,7 +946813,6 @@ 13:u07:Mattison,, 14:u04:Harnessing, 9:u08:D.B.,, -7:u11:ma,, 9:u13:mair,, 18:uI2:,.,,.,,..,,.,., 13:u00:Lemaitre,, @@ -932256,7 +946822,6 @@ 12:u07:Allison,, 14:u03:Harnessing, 9:u07:D.B.,, -7:u10:ma,, 9:u12:mair,, 13:u14:mattison,, 8:u23:Mair, @@ -935734,9 +950299,6 @@ 9:u02:j,k,s, 9:u01:j,k,s, 9:u00:j,k,s, -12:uI2:(,,)(,,), -12:uI1:(,,)(,,), -12:uI0:(,,)(,,), 14:u08:paternally, 12:uI2:-(.)(.)., 14:u07:paternally, @@ -936414,7 +950976,6 @@ 32:u13:0963-0252/11/045003+09$33.00, 32:u04:0963-0252/11/045003+09$33.00, 32:u12:0963-0252/11/045003+09$33.00, -7:u22:096, 8:u23:0963, 32:u03:0963-0252/11/045003+09$33.00, 32:u11:0963-0252/11/045003+09$33.00, @@ -936983,27 +951544,18 @@ 6:u08:kA, 6:u02:(z, 6:u07:kA, -11:u08:tenfold, 6:u01:(z, 6:u06:kA, -11:u07:tenfold, 6:u00:(z, 6:u05:kA, -11:u06:tenfold, 12:uI2:−(()),, 6:u04:kA, -11:u05:tenfold, 12:uI1:−(()),, 6:u03:kA, -11:u04:tenfold, 12:uI0:−(()),, 6:u02:kA, -11:u03:tenfold, 6:u01:kA, -11:u02:tenfold, 6:u00:kA, -11:u01:tenfold, -11:u00:tenfold, 12:u08:toroidal, 12:u07:toroidal, 12:u06:toroidal, @@ -939779,7 +954331,6 @@ 9:u05:(vs),, 8:u06:(m),, 8:u07:2329, -9:u08:X-Ray, 17:u03:(Diamond-ATR,, 8:u04:(w),, 8:u05:1277, @@ -939815,7 +954366,6 @@ 9:u03:(vs),, 8:u04:(m),, 8:u05:2329, -9:u07:X-Ray, 15:u08:fractometer, 17:u01:(Diamond-ATR,, 8:u02:(w),, @@ -939833,7 +954383,6 @@ 9:u02:(vs),, 8:u03:(m),, 8:u04:2329, -9:u06:X-Ray, 17:u00:(Diamond-ATR,, 8:u01:(w),, 8:u02:1277, @@ -939847,7 +954396,6 @@ 9:u01:(vs),, 8:u02:(m),, 8:u03:2329, -9:u05:X-Ray, 15:u07:fractometer, 8:u00:(w),, 8:u01:1277, @@ -939858,7 +954406,6 @@ 9:u00:(vs),, 8:u01:(m),, 8:u02:2329, -9:u04:X-Ray, 15:u06:fractometer, 8:u00:1277, 8:u02:(5),, @@ -939869,26 +954416,22 @@ 8:u23:X-Ra, 8:u00:(m),, 8:u01:2329, -9:u03:X-Ray, 15:u05:fractometer, 8:u01:(5),, 15:u06:(wavelength, 15:u13:fractometer, 8:u00:2329, -9:u02:X-Ray, 15:u04:fractometer, 8:u00:(5),, 15:u05:(wavelength, 20:u08:anisotropically., 15:u12:fractometer, -9:u01:X-Ray, 15:u03:fractometer, 15:u04:(wavelength, 20:u07:anisotropically., 14:u08:ellipsoids, 15:u11:fractometer, 10:uI2:([])--, -9:u00:X-Ray, 15:u02:fractometer, 20:u08:Crystallographic, 15:u03:(wavelength, @@ -943111,10 +957654,7 @@ 13:u02:Inclusive, 13:u01:Inclusive, 13:u00:Inclusive, -10:uI2:,,,.(), -10:uI1:,,,.(), 12:u08:011108-7, -10:uI0:,,,.(), 12:u07:011108-7, 12:u06:011108-7, 6:u08:dW, @@ -944758,16 +959298,11 @@ 12:u08:Ionizing, 8:u01:germ, 8:u00:germ, -12:u14:ensuring, 12:u07:Ionizing, -12:u13:ensuring, 12:u06:Ionizing, -12:u12:ensuring, 12:u05:Ionizing, 10:u08:(GBs),, -12:u11:ensuring, 12:u04:Ionizing, -12:u10:ensuring, 12:u03:Ionizing, 10:u07:(GBs),, 11:u08:(16-SG), @@ -944888,7 +959423,6 @@ 18:u07:cell-intrinsic, 11:uI1:(.).,-,, 13:u00:acidified, -12:u08:robustly, 17:u00:compartments,, 18:u06:cell-intrinsic, 8:u14:germ, @@ -944896,34 +959430,26 @@ 10:uI2:(.-),-, 18:u05:cell-intrinsic, 10:uI1:(.-),-, -12:u07:robustly, 18:u04:cell-intrinsic, 10:uI0:(.-),-, -12:u06:robustly, 18:u03:cell-intrinsic, 12:u14:robustly, -12:u05:robustly, 18:u02:cell-intrinsic, 12:u13:robustly, 13:uI2:-,(-,-,-), -12:u04:robustly, 21:u08:post-irradiation,, 18:u01:cell-intrinsic, 12:u12:robustly, 13:uI1:-,(-,-,-), -12:u03:robustly, 18:u00:cell-intrinsic, 12:u11:robustly, 13:uI0:-,(-,-,-), -12:u02:robustly, 21:u07:post-irradiation,, 12:u10:robustly, 16:u14:dramatically, -12:u01:robustly, 21:u06:post-irradiation,, 16:u13:dramatically, 21:u14:post-irradiation,, -12:u00:robustly, 21:u05:post-irradiation,, 16:u12:dramatically, 21:u13:post-irradiation,, @@ -951154,7 +965680,6 @@ 13:uI1:*-.@..,(), 8:u01:LA22, 11:u05:Citizen, -15:u08:Partnership, 12:u00:Riverfly, 8:u01:0LP,, 11:u13:citizen, @@ -951163,24 +965688,11 @@ 8:u00:LA22, 8:u00:0LP,, 12:u13:catalyst, -15:u07:Partnership, 12:u12:catalyst, -15:u06:Partnership, 12:u11:catalyst, -15:u14:partnership, -15:u05:Partnership, 12:u10:catalyst, -15:u13:partnership, -15:u04:Partnership, -15:u12:partnership, -15:u03:Partnership, -15:u11:partnership, -15:u02:Partnership, 11:u08:citizen, -15:u10:partnership, -15:u01:Partnership, 11:u07:citizen, -15:u00:Partnership, 11:u06:citizen, 22:u08:Macroinvertebrates, 11:u05:citizen, @@ -951430,8 +965942,6 @@ 13:u10:dislodged, 10:u12:zigzag, 12:u13:habitats, -7:u22:zig, -8:u23:zigz, 13:u01:dislodged, 12:u04:habitats, 10:u11:zigzag, @@ -951594,7 +966104,6 @@ 17:u02:non-scientist, 11:u03:course., 11:u06:needed;, -15:u08:Manchester,, 12:u02:trainees, 17:u10:non-scientist, 11:u11:course., @@ -951608,44 +966117,31 @@ 17:u00:non-scientist, 11:u01:course., 11:u04:needed;, -15:u07:Manchester,, 11:u08:(Burton, 12:u00:trainees, 11:u12:needed;, 11:u00:course., 11:u03:needed;, -15:u06:Manchester,, 10:u08:2003)., 11:u11:needed;, -15:u14:manchester,, 11:u02:needed;, -15:u05:Manchester,, 11:u07:(Burton, 10:u07:2003)., 11:u10:needed;, -15:u13:manchester,, 11:u01:needed;, -15:u04:Manchester,, 11:u06:(Burton, 11:u08:(Hurley, 10:u06:2003)., -15:u12:manchester,, 11:u14:(burton, -8:u23:Manc, 11:u00:needed;, -15:u03:Manchester,, 11:u05:(Burton, 10:u08:drains, 10:u05:2003)., -15:u11:manchester,, 11:u13:(burton, -15:u02:Manchester,, 11:u04:(Burton, 11:u07:(Hurley, 10:u04:2003)., -15:u10:manchester,, 11:u12:(burton, -15:u01:Manchester,, 11:u03:(Burton, 11:u06:(Hurley, 10:u07:drains, @@ -951653,7 +966149,6 @@ 15:u08:Manchester., 11:u11:(burton, 11:u14:(hurley, -15:u00:Manchester,, 11:u02:(Burton, 11:u05:(Hurley, 10:u06:drains, @@ -955819,7 +970314,6 @@ 11:u01:Tweddle, 7:u00:HE,, 14:u12:hydrology,, -8:u23:Hydr, 11:u00:Tweddle, 37:u08:https://doi.org/10.1111/wej.12259, 14:u11:hydrology,, @@ -960318,8 +974812,6 @@ 8:u13:(74), 8:u04:(74), 8:u12:(74), -7:u22:(74, -8:u23:(74), 8:u03:(74), 12:u07:terizing, 8:u11:(74), @@ -963254,40 +977746,31 @@ 10:u02:15-25%, 10:u10:15-25%, 10:u01:15-25%, -15:u08:Eighty-five, 10:u00:15-25%, -15:u07:Eighty-five, 15:u08:generations, -15:u06:Eighty-five, 15:u07:generations, 10:u14:began., 10:u08:Mating, -15:u05:Eighty-five, 15:u06:generations, 10:u13:began., 16:u08:Necessarily,, -15:u04:Eighty-five, 15:u05:generations, 10:u12:began., 10:u07:Mating, -15:u03:Eighty-five, 15:u04:generations, 10:u11:began., 10:u06:Mating, 16:u07:Necessarily,, 8:u08:kely, -15:u02:Eighty-five, 15:u03:generations, 10:u10:began., 10:u05:Mating, 16:u06:Necessarily,, -15:u01:Eighty-five, 15:u02:generations, 16:u14:necessarily,, 10:u04:Mating, 16:u05:Necessarily,, 8:u07:kely, -15:u00:Eighty-five, 15:u01:generations, 16:u13:necessarily,, 10:u03:Mating, @@ -967862,8 +982345,6 @@ 23:u07:kiran.hilal@aku.edu, 8:u11:khan, 13:u12:pakistan,, -7:u22:Pak, -8:u23:Paki, 8:u02:Khan, 13:u03:Pakistan,, 13:u01:Radiology, @@ -968145,39 +982626,25 @@ 11:u04:395,000, 13:u10:covid-19,, 13:u01:COVID-19,, -13:u08:Pakistan., 11:u03:395,000, 13:u00:COVID-19,, 11:u02:395,000, -13:u07:Pakistan., 11:u01:395,000, 9:u08:[11],, 15:u14:inexpensive, -13:u06:Pakistan., 11:u00:395,000, 9:u07:[11],, 15:u13:inexpensive, -13:u14:pakistan., -13:u05:Pakistan., 9:u06:[11],, 15:u12:inexpensive, -13:u13:pakistan., -13:u04:Pakistan., 9:u05:[11],, 15:u11:inexpensive, -13:u12:pakistan., -13:u03:Pakistan., 9:u08:Chest, 9:u04:[11],, 15:u10:inexpensive, -13:u11:pakistan., -13:u02:Pakistan., 9:u03:[11],, -13:u10:pakistan., -13:u01:Pakistan., 9:u07:Chest, 9:u02:[11],, -13:u00:Pakistan., 9:u06:Chest, 9:u01:[11],, 9:u05:Chest, @@ -972459,7 +986926,6 @@ 10:u14:priori, 9:u01:open:, 15:u06:compatible., -13:u08:property., 10:u13:priori, 15:u14:compatible., 9:u00:open:, @@ -972467,30 +986933,22 @@ 10:u12:priori, 15:u13:compatible., 15:u04:compatible., -13:u07:property., 10:u11:priori, 15:u12:compatible., 15:u03:compatible., -13:u06:property., 10:u10:priori, 15:u11:compatible., 13:u14:property., 15:u02:compatible., -13:u05:property., 15:u10:compatible., 13:u13:property., 15:u01:compatible., -13:u04:property., 13:u12:property., 15:u00:compatible., -13:u03:property., 17:u08:Unfortunately, 13:u11:property., -13:u02:property., 13:u10:property., -13:u01:property., 17:u07:Unfortunately, -13:u00:property., 17:u06:Unfortunately, 17:u14:unfortunately, 17:u05:Unfortunately, @@ -976579,8 +991037,6 @@ 9:u04:viz.,, 13:u11:064013-12, 9:u12:viz.,, -7:u22:viz, -8:u23:viz., 13:u02:064013-12, 9:u03:viz.,, 8:u08:(B8), @@ -982891,7 +997347,6 @@ 15:u04:Peptidergic, 10:u05:Spinal, 21:u07:Di-/mesencephalon, -7:u08:CNS, 15:u12:peptidergic, 14:u00:projecting, 15:u03:Peptidergic, @@ -982904,7 +997359,6 @@ 10:u03:Spinal, 21:u05:Di-/mesencephalon, 13:u06:Hindbrain, -7:u07:CNS, 15:u08:Non-neurons, 15:u10:peptidergic, 21:u13:di-/mesencephalon, @@ -982913,59 +997367,46 @@ 10:u02:Spinal, 21:u04:Di-/mesencephalon, 13:u05:Hindbrain, -7:u06:CNS, 10:u08:Oligo-, 21:u12:di-/mesencephalon, 13:u13:hindbrain, -7:u14:cns, 7:u22:Di-, 8:u23:Di-/, 15:u00:Peptidergic, 10:u01:Spinal, 21:u03:Di-/mesencephalon, 13:u04:Hindbrain, -7:u05:CNS, 15:u07:Non-neurons, 14:u08:dendrocyte, 21:u11:di-/mesencephalon, 13:u12:hindbrain, -7:u13:cns, 10:u00:Spinal, 21:u02:Di-/mesencephalon, 13:u03:Hindbrain, -7:u04:CNS, 15:u06:Non-neurons, 10:u07:Oligo-, 10:u08:Rbfox3, 21:u10:di-/mesencephalon, 13:u11:hindbrain, -7:u12:cns, 15:u14:non-neurons, -7:u22:CNS, -7:u23:CNS, 21:u01:Di-/mesencephalon, 13:u02:Hindbrain, -7:u03:CNS, 15:u05:Non-neurons, 10:u06:Oligo-, 14:u07:dendrocyte, 13:u10:hindbrain, -7:u11:cns, 15:u13:non-neurons, 10:u14:oligo-, 21:u00:Di-/mesencephalon, 13:u01:Hindbrain, -7:u02:CNS, 15:u04:Non-neurons, 10:u05:Oligo-, 14:u06:dendrocyte, 10:u07:Rbfox3, -7:u10:cns, 15:u12:non-neurons, 10:u13:oligo-, 14:u14:dendrocyte, 13:u00:Hindbrain, -7:u01:CNS, 15:u03:Non-neurons, 10:u04:Oligo-, 14:u05:dendrocyte, @@ -982975,7 +997416,6 @@ 10:u12:oligo-, 14:u13:dendrocyte, 10:u14:rbfox3, -7:u00:CNS, 15:u02:Non-neurons, 10:u03:Oligo-, 14:u04:dendrocyte, @@ -984336,7 +998776,6 @@ 12:u05:Bertram,, 11:u06:Gierer,, 11:u07:Nelson,, -14:u08:activating, 8:u01:E.B., 18:u11:ultrastructure, 12:u13:bertram,, @@ -984356,7 +998795,6 @@ 12:u03:Bertram,, 11:u04:Gierer,, 11:u05:Nelson,, -14:u07:activating, 12:u11:bertram,, 11:u12:gierer,, 11:u13:nelson,, @@ -984367,7 +998805,6 @@ 12:u02:Bertram,, 11:u03:Gierer,, 11:u04:Nelson,, -14:u06:activating, 12:u10:bertram,, 11:u11:gierer,, 11:u12:nelson,, @@ -984377,7 +998814,6 @@ 12:u01:Bertram,, 11:u02:Gierer,, 11:u03:Nelson,, -14:u05:activating, 13:u08:Bilinska,, 11:u10:gierer,, 11:u11:nelson,, @@ -984385,24 +998821,19 @@ 12:u00:Bertram,, 11:u01:Gierer,, 11:u02:Nelson,, -14:u04:activating, 11:u10:nelson,, 11:u00:Gierer,, 11:u01:Nelson,, -14:u03:activating, 13:u07:Bilinska,, 11:u08:Butowt,, 11:u00:Nelson,, -14:u02:activating, 13:u06:Bilinska,, 11:u07:Butowt,, 13:u14:bilinska,, -14:u01:activating, 13:u05:Bilinska,, 11:u06:Butowt,, 13:u13:bilinska,, 14:uI2:,.,,.,,..,, -14:u00:activating, 13:u04:Bilinska,, 11:u05:Butowt,, 13:u12:bilinska,, @@ -985423,7 +999854,6 @@ 13:u10:submucosa, 23:u12:meningoencephalitis, 10:u13:50-55., -8:u23:meni, 13:u01:submucosa, 23:u03:meningoencephalitis, 10:u04:50-55., @@ -988482,7 +1002912,6 @@ 9:u11:47488, 13:u12:vd2973776, 7:u13:#1,, -6:u21:VD, 7:u22:VD2, 8:u23:VD29, 7:uI2:#,#, @@ -989424,7 +1003853,6 @@ 21:u06:ctep.nci.nih.gov., 33:u08:0732-183X/10/2835-5197/$20.00, 13:u03:Biometric, -12:u08:Oncology, 8:u11:phd,, 13:u12:epn-8129,, 21:u14:ctep.nci.nih.gov., @@ -989435,7 +1003863,6 @@ 13:u03:EPN-8129,, 21:u05:ctep.nci.nih.gov., 13:u02:Biometric, -12:u07:Oncology, 8:u10:phd,, 13:u11:epn-8129,, 21:u13:ctep.nci.nih.gov., @@ -989445,7 +1003872,6 @@ 21:u04:ctep.nci.nih.gov., 33:u07:0732-183X/10/2835-5197/$20.00, 13:u01:Biometric, -12:u06:Oncology, 28:u08:10.1200/JCO.2010.31.5382, 13:u10:epn-8129,, 21:u12:ctep.nci.nih.gov., @@ -989458,14 +1003884,12 @@ 33:u06:0732-183X/10/2835-5197/$20.00, 11:u08:Purpose, 13:u00:Biometric, -12:u05:Oncology, 28:u07:10.1200/JCO.2010.31.5382, 21:u11:ctep.nci.nih.gov., 33:u14:0732-183x/10/2835-5197/$20.00, 13:u00:EPN-8129,, 21:u02:ctep.nci.nih.gov., 33:u05:0732-183X/10/2835-5197/$20.00, -12:u04:Oncology, 28:u06:10.1200/JCO.2010.31.5382, 21:u10:ctep.nci.nih.gov., 33:u13:0732-183x/10/2835-5197/$20.00, @@ -989473,7 +1003897,6 @@ 21:u01:ctep.nci.nih.gov., 33:u04:0732-183X/10/2835-5197/$20.00, 11:u07:Purpose, -12:u03:Oncology, 28:u05:10.1200/JCO.2010.31.5382, 33:u12:0732-183x/10/2835-5197/$20.00, 7:u22:073, @@ -989483,19 +1003906,16 @@ 33:u03:0732-183X/10/2835-5197/$20.00, 11:u06:Purpose, 11:u08:accrual, -12:u02:Oncology, 28:u04:10.1200/JCO.2010.31.5382, 33:u11:0732-183x/10/2835-5197/$20.00, 11:uI0:-//-/$., 33:u02:0732-183X/10/2835-5197/$20.00, 11:u05:Purpose, -12:u01:Oncology, 28:u03:10.1200/JCO.2010.31.5382, 33:u10:0732-183x/10/2835-5197/$20.00, 33:u01:0732-183X/10/2835-5197/$20.00, 11:u04:Purpose, 11:u07:accrual, -12:u00:Oncology, 28:u02:10.1200/JCO.2010.31.5382, 8:u23:Purp, 33:u00:0732-183X/10/2835-5197/$20.00, @@ -990297,7 +1004717,6 @@ 9:u14:5,652, 9:u05:5,652, 9:u06:7,198, -12:u08:Prostate, 9:u13:5,652, 9:u14:7,198, 9:u04:5,652, @@ -990307,48 +1004726,34 @@ 8:u23:5,65, 9:u03:5,652, 9:u04:7,198, -12:u07:Prostate, 9:u11:5,652, 9:u12:7,198, 8:u23:7,19, 9:u02:5,652, 9:u03:7,198, -12:u06:Prostate, 9:u08:8,951, 9:u10:5,652, 9:u11:7,198, -12:u14:prostate, 9:u01:5,652, 9:u02:7,198, -12:u05:Prostate, 10:u08:11,204, 9:u10:7,198, -12:u13:prostate, 9:u00:5,652, 9:u01:7,198, -12:u04:Prostate, 9:u07:8,951, -12:u12:prostate, -8:u23:Pros, 9:u00:7,198, -12:u03:Prostate, 9:u06:8,951, 10:u07:11,204, -12:u11:prostate, 9:u14:8,951, -12:u02:Prostate, 9:u05:8,951, 10:u06:11,204, -12:u10:prostate, 9:u13:8,951, 10:u14:11,204, -12:u01:Prostate, 9:u04:8,951, 10:u05:11,204, 9:u12:8,951, 10:u13:11,204, 8:u23:8,95, -12:u00:Prostate, 9:u03:8,951, 10:u04:11,204, 8:u08:34.9, @@ -991920,23 +1006325,18 @@ 15:u01:symmetries., 7:u08:d-,, 15:u00:symmetries., -10:u08:chiral, 7:u07:d-,, 21:u08:tation/relaxation, -10:u07:chiral, 7:u06:d-,, -10:u06:chiral, 11:u08:(µSR),, 7:u14:d-,, 7:u05:d-,, 21:u07:tation/relaxation, -10:u05:chiral, 11:u07:(µSR),, 7:u13:d-,, 14:uI2:-,-,-,-[]., 7:u04:d-,, 21:u06:tation/relaxation, -10:u04:chiral, 11:u06:(µSR),, 7:u12:d-,, 21:u14:tation/relaxation, @@ -991945,7 +1006345,6 @@ 14:uI1:-,-,-,-[]., 7:u03:d-,, 21:u05:tation/relaxation, -10:u03:chiral, 11:u05:(µSR),, 7:u11:d-,, 21:u13:tation/relaxation, @@ -991953,7 +1006352,6 @@ 12:uI2:/(),().-, 7:u02:d-,, 21:u04:tation/relaxation, -10:u02:chiral, 11:u04:(µSR),, 11:u08:denied., 7:u10:d-,, @@ -991962,7 +1006360,6 @@ 12:uI2:,-()/-(:, 7:u01:d-,, 21:u03:tation/relaxation, -10:u01:chiral, 11:u03:(µSR),, 11:u07:denied., 21:u11:tation/relaxation, @@ -991971,7 +1006368,6 @@ 11:uI2:,:)[,],, 7:u00:d-,, 21:u02:tation/relaxation, -10:u00:chiral, 11:u02:(µSR),, 11:u06:denied., 16:u08:observed[8]., @@ -996657,15 +1011053,9 @@ 21:u01:characterization:, 9:u00:-Part, 21:u00:characterization:, -8:u14:-for, -8:u13:-for, 10:uI2:--,///, -8:u12:-for, -8:u23:-For, 10:uI1:--,///, -8:u11:-for, 10:uI0:--,///, -8:u10:-for, 14:u08:Absorbance, 14:u07:Absorbance, 14:u06:Absorbance, @@ -997210,8 +1011600,6 @@ 14:u06:coloration, 15:u11:bbak2282005, 14:u14:coloration, -7:u22:pel, -8:u23:pell, 15:u02:BBaK2282005, 14:u05:coloration, 15:u10:bbak2282005, @@ -997707,7 +1012095,6 @@ 15:u12:(antifreeze, 8:u23:(ant, 15:u03:(antifreeze, -10:u08:Plants, 10:u02:15°C,, 13:u03:proteins), 22:u06:evapotranspiration, @@ -997719,47 +1012106,39 @@ 22:u05:evapotranspiration, 15:u10:(antifreeze, 15:u01:(antifreeze, -10:u07:Plants, 10:u00:15°C,, 13:u01:proteins), 22:u04:evapotranspiration, 10:u08:time"., 10:uI2::--()., 15:u00:(antifreeze, -10:u06:Plants, 12:u07:"thermal, 13:u00:proteins), 22:u03:evapotranspiration, 10:u07:time"., 10:uI1::--()., -10:u05:Plants, 12:u06:"thermal, 22:u02:evapotranspiration, 10:u06:time"., 12:u14:"thermal, 10:uI0::--()., -10:u04:Plants, 12:u05:"thermal, 22:u01:evapotranspiration, 10:u05:time"., 12:u13:"thermal, -10:u03:Plants, 12:u04:"thermal, 22:u00:evapotranspiration, 10:u04:time"., 12:u12:"thermal, 7:u22:"th, 8:u23:"the, -10:u02:Plants, 12:u03:"thermal, 19:u08:retro-calculate, 10:u03:time"., 12:u11:"thermal, -10:u01:Plants, 12:u02:"thermal, 10:u02:time"., 12:u10:"thermal, -10:u00:Plants, 12:u01:"thermal, 19:u07:retro-calculate, 10:u08:colors, @@ -998929,14 +1013308,12 @@ 18:u02:Document-level, 17:u05:science-miner, 35:u07:patrice.lopez@science-miner.com, -6:u08:Du, 18:u10:document-level, 17:u13:science-miner, 18:u01:Document-level, 17:u04:science-miner, 35:u06:patrice.lopez@science-miner.com, 10:u07:Caifan, -6:u07:Du, 10:u08:Cohoon, 17:u12:science-miner, 35:u14:patrice.lopez@science-miner.com, @@ -998944,7 +1013321,6 @@ 17:u03:science-miner, 35:u05:patrice.lopez@science-miner.com, 10:u06:Caifan, -6:u06:Du, 10:u07:Cohoon, 17:u11:science-miner, 35:u13:patrice.lopez@science-miner.com, @@ -998954,7 +1013330,6 @@ 35:u04:patrice.lopez@science-miner.com, 10:u05:Caifan, 11:u08:Karthik, -6:u05:Du, 10:u06:Cohoon, 17:u10:science-miner, 35:u12:patrice.lopez@science-miner.com, @@ -998963,7 +1013338,6 @@ 17:u01:science-miner, 35:u03:patrice.lopez@science-miner.com, 10:u04:Caifan, -6:u04:Du, 10:u05:Cohoon, 7:u08:Ram, 35:u11:patrice.lopez@science-miner.com, @@ -998974,7 +1013348,6 @@ 35:u02:patrice.lopez@science-miner.com, 10:u03:Caifan, 11:u07:Karthik, -6:u03:Du, 10:u04:Cohoon, 7:u07:Ram, 35:u10:patrice.lopez@science-miner.com, @@ -998982,7 +1013355,6 @@ 35:u01:patrice.lopez@science-miner.com, 10:u02:Caifan, 11:u06:Karthik, -6:u02:Du, 10:u03:Cohoon, 7:u06:Ram, 10:u10:caifan, @@ -998990,7 +1013362,6 @@ 35:u00:patrice.lopez@science-miner.com, 10:u01:Caifan, 11:u05:Karthik, -6:u01:Du, 10:u02:Cohoon, 7:u05:Ram, 11:u08:Howison, @@ -998998,7 +1013369,6 @@ 12:u14:berkeley, 10:u00:Caifan, 11:u04:Karthik, -6:u00:Du, 10:u01:Cohoon, 7:u04:Ram, 11:u07:Howison, @@ -1003719,75 +1018089,33 @@ 9:u02:Hints, 10:u07:Demand, 25:uI0:.--.................., -9:u08:3.2.3, 13:u00:Aggregate, 9:u01:Hints, 10:u06:Demand, -9:u08:3.2.4, 9:u00:Hints, 10:u05:Demand, -9:u07:3.2.3, -9:u08:3.2.5, 10:u04:Demand, 12:u08:Vicinity, 28:uI2:..-....................., -9:u06:3.2.3, -9:u07:3.2.4, 10:u03:Demand, 12:u07:Vicinity, -9:u14:3.2.3, 28:uI1:..-....................., -9:u05:3.2.3, -9:u06:3.2.4, -9:u07:3.2.5, 10:u02:Demand, 12:u06:Vicinity, -9:u13:3.2.3, -9:u14:3.2.4, 28:uI0:..-....................., -9:u04:3.2.3, -9:u05:3.2.4, -9:u06:3.2.5, 10:u01:Demand, 12:u05:Vicinity, -9:u12:3.2.3, -9:u13:3.2.4, -9:u14:3.2.5, -9:u03:3.2.3, -9:u04:3.2.4, -9:u05:3.2.5, 10:u00:Demand, 12:u04:Vicinity, -9:u11:3.2.3, -9:u12:3.2.4, -9:u13:3.2.5, -9:u02:3.2.3, -9:u03:3.2.4, -9:u04:3.2.5, 12:u03:Vicinity, -9:u10:3.2.3, -9:u11:3.2.4, -9:u12:3.2.5, 28:uI2:.'......................, -9:u01:3.2.3, -9:u02:3.2.4, -9:u03:3.2.5, 12:u02:Vicinity, -9:u10:3.2.4, -9:u11:3.2.5, 28:uI1:.'......................, -9:u00:3.2.3, -9:u01:3.2.4, -9:u02:3.2.5, 12:u01:Vicinity, 8:u08:Pdfs, -9:u10:3.2.5, 28:uI0:.'......................, -9:u00:3.2.4, -9:u01:3.2.5, 12:u00:Vicinity, 8:u07:Pdfs, -9:u00:3.2.5, 9:u08:A.3.1, 8:u06:Pdfs, 9:u08:A.3.2, @@ -1013663,7 +1027991,6 @@ 6:u04:-k, 11:u07:conduit, 12:u13:misation, -7:u14:met, 11:uI0:'.(),(., 11:uI1:)-(.).-, 12:u02:D'après, @@ -1013673,7 +1028000,6 @@ 6:u03:-k, 11:u06:conduit, 12:u12:misation, -7:u13:met, 11:uI0:)-(.).-, 12:u01:D'après, 12:u03:misation, @@ -1013684,7 +1028010,6 @@ 11:u05:conduit, 17:u08:cyclopropyles, 12:u11:misation, -7:u12:met, 7:u23:met, 12:u00:D'après, 12:u02:misation, @@ -1013694,13 +1028019,11 @@ 11:u04:conduit, 17:u07:cyclopropyles, 12:u10:misation, -7:u11:met, 12:u01:misation, 15:u07:stériques,, 6:u00:-k, 11:u03:conduit, 17:u06:cyclopropyles, -7:u10:met, 12:u00:misation, 15:u06:stériques,, 13:u07:solvolyse, @@ -1016875,16 +1031198,13 @@ 6:u06:RO, 14:u00:decryption, 14:u12:decryption, -6:u14:ro, 6:u05:RO, 10:u07:short), 13:u08:(NIZKPoK,, 14:u11:decryption, -6:u13:ro, 6:u04:RO, 10:u06:short), 14:u10:decryption, -6:u12:ro, 10:u14:short), 6:u22:RO, 6:u23:RO, @@ -1016892,14 +1031212,12 @@ 10:u05:short), 13:u07:(NIZKPoK,, 18:u08:Exponentiation, -6:u11:ro, 10:u13:short), 11:uI2:)[].-[], 6:u02:RO, 10:u04:short), 13:u06:(NIZKPoK,, 10:u08:mixes., -6:u10:ro, 10:u12:short), 13:u14:(nizkpok,, 11:uI1:)[].-[], @@ -1017245,7 +1031563,6 @@ 11:u06:herself, 17:u11:notifications, 12:u12:verifier, -8:u23:Veri, 17:u02:notifications, 12:u03:Verifier, 14:u03:Signatures, @@ -1020621,28 +1034938,23 @@ 8:u03:DDFV, 11:u06:meshes., 8:u11:ddfv, -8:u14:dual, 8:u02:DDFV, 15:u08:"reinforced, 11:u05:meshes., 8:u10:ddfv, -8:u13:dual, 8:u01:DDFV, 11:u04:meshes., 22:u08:incompressibility", -8:u12:dual, 7:u22:dua, 8:u23:dual, 8:u00:DDFV, 15:u07:"reinforced, 11:u03:meshes., 22:u07:incompressibility", -8:u11:dual, 15:u06:"reinforced, 11:u02:meshes., 22:u06:incompressibility", 12:u08:unsteady, -8:u10:dual, 15:u14:"reinforced, 15:u05:"reinforced, 15:u08:barycenters, @@ -1026718,8 +1041030,6 @@ 10:u03:Mothur, 17:u06:"Phylogenetic, 9:u08:biom,, -7:u22:Alp, -8:u23:Alph, 9:u03:Alpha, 14:u06:(PICRUSt)", 10:u07:loseq,, @@ -1026837,7 +1041147,6 @@ 16:u01:Philippines., 14:u04:longitudes, 14:u12:16˚52'00", -8:u14:agno, 8:u22:16˚, 9:u23:16˚5, 11:uI0:""[].'", @@ -1026850,7 +1041159,6 @@ 16:u00:Philippines., 14:u03:longitudes, 14:u11:16˚52'00", -8:u13:agno, 12:u14:formerly, 10:uI0:'"'"'", 14:u02:16˚52'00", @@ -1026860,7 +1041168,6 @@ 9:u07:Karst, 14:u02:longitudes, 14:u10:16˚52'00", -8:u12:agno, 12:u13:formerly, 14:u14:cacupangan, 7:u22:Agn, @@ -1026871,7 +1041178,6 @@ 14:u05:Cacupangan, 9:u06:Karst, 14:u01:longitudes, -8:u11:agno, 12:u12:formerly, 14:u13:cacupangan, 9:u14:karst, @@ -1026881,7 +1041187,6 @@ 14:u04:Cacupangan, 9:u05:Karst, 14:u00:longitudes, -8:u10:agno, 12:u11:formerly, 14:u12:cacupangan, 9:u13:karst, @@ -1027583,19 +1041888,16 @@ 16:u03:Francisella,, 14:u06:migrations, 14:u11:bacterium,, -10:uI2:[].---, 14:u02:bacterium,, 7:u08:nas, 16:u02:Francisella,, 14:u05:migrations, 14:u10:bacterium,, 8:u14:[17,, -10:uI1:[].---, 14:u01:bacterium,, 16:u01:Francisella,, 14:u04:migrations, 8:u13:[17,, -10:uI0:[].---, 11:uI2:[,,,].-, 14:u00:bacterium,, 7:u07:nas, @@ -1027942,13 +1042244,11 @@ 53:u04:https://doi.org/10.1371/journal.pone.0200095.g005, 53:u12:https://doi.org/10.1371/journal.pone.0200095.g005, 53:u03:https://doi.org/10.1371/journal.pone.0200095.g005, -10:u08:Across, 53:u11:https://doi.org/10.1371/journal.pone.0200095.g005, 53:u02:https://doi.org/10.1371/journal.pone.0200095.g005, 10:u08:phylum, 53:u10:https://doi.org/10.1371/journal.pone.0200095.g005, 53:u01:https://doi.org/10.1371/journal.pone.0200095.g005, -10:u07:Across, 53:u00:https://doi.org/10.1371/journal.pone.0200095.g005, 10:u07:phylum, 17:u08:nutrient-rich, @@ -1029331,7 +1043631,6 @@ 47:u07:https://doi.org/10.1038/cddiscovery.2016.48, 9:u14:sion:, 16:uI1:....://.-./., -13:uI2:.,,,,,.--, 9:u05:sion:, 10:u06:16048., 8:u00:Chao, @@ -1029342,7 +1043641,6 @@ 9:u13:sion:, 10:u14:16048., 16:uI0:....://.-./., -13:uI1:.,,,,,.--, 9:u04:sion:, 10:u05:16048., 17:u07:biodiversity., @@ -1029352,7 +1043650,6 @@ 47:u05:https://doi.org/10.1038/cddiscovery.2016.48, 9:u12:sion:, 10:u13:16048., -13:uI0:.,,,,,.--, 9:u03:sion:, 10:u04:16048., 17:u06:biodiversity., @@ -1030113,17 +1044410,14 @@ 8:u06:CAS,, 11:u07:Russia,, 9:uI0:"(;:,, -8:uI2:,;-,, 11:u01:editor:, 11:u01:Pengfei, 8:u05:CAS,, 11:u06:Russia,, -8:uI1:,;-,, 11:u00:editor:, 11:u00:Pengfei, 8:u04:CAS,, 11:u05:Russia,, -8:uI0:,;-,, 8:u03:CAS,, 11:u04:Russia,, 9:u08:Forum, @@ -1030192,33 +1044486,24 @@ 8:u00:ZR's, 12:u02:promoted, 8:u04:paid, -15:u08:manuscripts, 12:u01:promoted, 8:u03:paid, 10:u14:seeing, 12:u00:promoted, 8:u02:paid, 10:u13:seeing, -15:u07:manuscripts, 8:u01:paid, 10:u12:seeing, 8:u23:seei, -15:u06:manuscripts, 8:u00:paid, 10:u11:seeing, 15:u14:manuscripts, -15:u05:manuscripts, 10:u10:seeing, 15:u13:manuscripts, -15:u04:manuscripts, 15:u12:manuscripts, -15:u03:manuscripts, 15:u11:manuscripts, -15:u02:manuscripts, 15:u10:manuscripts, -15:u01:manuscripts, 13:u08:encourage, -15:u00:manuscripts, 12:u08:scholars, 13:u07:encourage, 12:u07:scholars, @@ -1033086,7 +1047371,6 @@ 8:u13:jury, 8:u04:jury, 8:u12:jury, -7:u22:jur, 8:u23:jury, 8:u03:jury, 13:u08:sequelae., @@ -1037218,7 +1051502,6 @@ 14:u12:myelinated, 10:u01:tinues, 14:u03:myelinated, -16:u08:neuroimaging, 13:u02:saltatory, 10:u07:myelin, 14:u11:myelinated, @@ -1037228,22 +1051511,14 @@ 10:u06:myelin, 14:u10:myelinated, 14:u01:myelinated, -16:u07:neuroimaging, 13:u00:saltatory, 10:u05:myelin, 14:u00:myelinated, -16:u06:neuroimaging, 10:u04:myelin, -16:u05:neuroimaging, 10:u03:myelin, -16:u04:neuroimaging, 10:u02:myelin, -16:u03:neuroimaging, 10:u01:myelin, -16:u02:neuroimaging, 10:u00:myelin, -16:u01:neuroimaging, -16:u00:neuroimaging, 15:u14:myelination, 15:u13:myelination, 13:u08:(PDGFRα), @@ -1039253,21 +1053528,16 @@ 9:u07:Olig2, 9:u06:Olig2, 10:u08:(CTX),, -9:u14:olig2, 9:u05:Olig2, 10:u07:(CTX),, -9:u13:olig2, 9:u04:Olig2, 10:u06:(CTX),, -9:u12:olig2, 9:u03:Olig2, 10:u05:(CTX),, -9:u11:olig2, 13:uI2:(),()..,-, 9:u02:Olig2, 10:u04:(CTX),, 12:u08:miR-219,, -9:u10:olig2, 13:uI1:(),()..,-, 9:u01:Olig2, 10:u03:(CTX),, @@ -1040317,7 +1054587,6 @@ 7:u04:42,, 13:u05:Genovese,, 21:u11:deformation-based, -14:uI2:.,..,,..,., 12:u00:diseased, 21:u02:deformation-based, 14:u03:NeuroImage, @@ -1040329,7 +1054598,6 @@ 13:u04:Genovese,, 21:u10:deformation-based, 11:u14:870-878, -14:uI1:.,..,,..,., 21:u01:deformation-based, 14:u02:NeuroImage, 11:u05:870-878, @@ -1040338,7 +1054606,6 @@ 7:u02:42,, 13:u03:Genovese,, 11:u13:870-878, -14:uI0:.,..,,..,., 21:u00:deformation-based, 14:u01:NeuroImage, 11:u04:870-878, @@ -1040692,18 +1054959,15 @@ 20:u06:differentiation:, 11:u07:155-164, 13:u08:Galloway,, -16:uI2:.,.,,..,,.,., 19:u05:oligodendrocyte, 20:u05:differentiation:, 11:u06:155-164, 13:u07:Galloway,, 7:u14:29,, -16:uI1:.,.,,..,,.,., 19:u04:oligodendrocyte, 11:u05:155-164, 13:u06:Galloway,, 7:u13:29,, -16:uI0:.,.,,..,,.,., 19:u03:oligodendrocyte, 11:u04:155-164, 13:u05:Galloway,, @@ -1040718,17 +1054982,14 @@ 13:u03:Galloway,, 15:u08:Barca-Mayo,, 7:u10:29,, -16:uI2:.,.,,.,,.,.-, 19:u00:oligodendrocyte, 11:u01:155-164, 13:u02:Galloway,, 15:u07:Barca-Mayo,, -16:uI1:.,.,,.,,.,.-, 11:u00:155-164, 13:u01:Galloway,, 15:u06:Barca-Mayo,, 10:u08:Dugas,, -16:uI0:.,.,,.,,.,.-, 13:u00:Galloway,, 15:u05:Barca-Mayo,, 10:u07:Dugas,, @@ -1040983,7 +1055244,6 @@ 19:u11:neuroanatomical, 11:u00:118-125, 19:u02:Neuroanatomical, -12:u08:socially, 11:u05:Fenlon,, 15:u08:Sforazzini,, 19:u10:neuroanatomical, @@ -1040991,42 +1055251,34 @@ 11:u04:Fenlon,, 15:u07:Sforazzini,, 19:u00:Neuroanatomical, -12:u07:socially, 11:u03:Fenlon,, 15:u06:Sforazzini,, 14:u08:Squillace,, -12:u06:socially, 11:u02:Fenlon,, 15:u05:Sforazzini,, 14:u07:Squillace,, 12:u14:socially, -12:u05:socially, 11:u01:Fenlon,, 15:u04:Sforazzini,, 14:u06:Squillace,, 12:u13:socially, -12:u04:socially, 11:u08:212-223, 11:u00:Fenlon,, 15:u03:Sforazzini,, 14:u05:Squillace,, 12:u12:socially, -12:u03:socially, 15:u02:Sforazzini,, 14:u04:Squillace,, 12:u11:socially, -12:u02:socially, 11:u07:212-223, 14:u08:overgrowth, 15:u01:Sforazzini,, 14:u03:Squillace,, 12:u10:socially, -12:u01:socially, 11:u06:212-223, 15:u00:Sforazzini,, 14:u02:Squillace,, 11:u14:212-223, -12:u00:socially, 11:u05:212-223, 14:u07:overgrowth, 14:u01:Squillace,, @@ -1041570,12 +1055822,9 @@ 15:u02:rigorously,, 15:u10:rigorously,, 14:uI1:./,,,[,].,, -9:uI2:./[]., 15:u01:rigorously,, 14:uI0:./,,,[,].,, -9:uI1:./[]., 15:u00:rigorously,, -9:uI0:./[]., 14:u08:alchemical, 8:u23:alch, 15:u14:free-energy, @@ -1041650,42 +1055899,33 @@ 7:u00:MUE, 10:u07:ployed, 10:u06:ployed, -6:u08:1b, 10:u14:ployed, 11:uI2:[,-].--, 10:u05:ployed, -6:u07:1b, 10:u13:ployed, 11:uI1:[,-].--, 10:u04:ployed, 18:u08:protein:ligand, -6:u06:1b, 10:u12:ployed, 8:u23:ploy, 11:uI0:[,-].--, 10:u03:ployed, -6:u05:1b, 10:u11:ployed, 10:u02:ployed, 18:u07:protein:ligand, -6:u04:1b, 10:u10:ployed, 10:u01:ployed, 18:u06:protein:ligand, -6:u03:1b, 18:u14:protein:ligand, 8:uI2:.,-:, 10:u00:ployed, 18:u05:protein:ligand, -6:u02:1b, 18:u13:protein:ligand, 8:uI1:.,-:, 18:u04:protein:ligand, -6:u01:1b, 18:u12:protein:ligand, 8:uI0:.,-:, 18:u03:protein:ligand, -6:u00:1b, 14:u08:co-crystal, 18:u11:protein:ligand, 18:u02:protein:ligand, @@ -1042476,19 +1056716,14 @@ 15:u02:Specificity, 15:u01:Specificity, 15:u00:Specificity, -10:u14:panel:, 11:uI2:()():-., 12:u08:ten-fold, -10:u13:panel:, 11:uI1:()():-., 12:u07:ten-fold, -10:u12:panel:, 11:uI0:()():-., 12:u06:ten-fold, -10:u11:panel:, 9:u08:Truth, 12:u05:ten-fold, -10:u10:panel:, 12:u04:ten-fold, 9:u07:Truth, 12:u03:ten-fold, @@ -1043479,29 +1057714,20 @@ 12:u02:further,, 12:u01:further,, 12:u00:further,, -13:u08:oncology., 19:u08:mechanism-based, 19:u07:mechanism-based, -13:u07:oncology., 19:u06:mechanism-based, -13:u06:oncology., 19:u05:mechanism-based, 13:u14:oncology., -13:u05:oncology., 19:u04:mechanism-based, 13:u13:oncology., -13:u04:oncology., 19:u03:mechanism-based, 13:u12:oncology., -13:u03:oncology., 19:u02:mechanism-based, 13:u11:oncology., -13:u02:oncology., 19:u01:mechanism-based, 13:u10:oncology., -13:u01:oncology., 19:u00:mechanism-based, -13:u00:oncology., 11:u08:UniProt, 14:u08:gatekeeper, 11:u07:UniProt, @@ -1044698,7 +1058924,6 @@ 12:u06:Cancers., 9:u07:Zehir, 14:u10:10(2):130., -13:u14:overview., 14:uI2:[],,,,,,.:, 14:u01:10(2):130., 13:u05:Overview., @@ -1044707,7 +1058932,6 @@ 11:u04:Housman, 12:u05:Cancers., 9:u06:Zehir, -13:u13:overview., 14:uI1:[],,,,,,.:, 14:u00:10(2):130., 13:u04:Overview., @@ -1044716,7 +1058940,6 @@ 12:u04:Cancers., 9:u05:Zehir, 18:u08:23(6):703-713., -13:u12:overview., 10:u14:barron, 14:uI0:[],,,,,,.:, 17:uI2:[],,,,,,,,,,,, @@ -1044728,9 +1058951,7 @@ 9:u04:Zehir, 18:u07:23(6):703-713., 9:u08:Redig, -13:u11:overview., 10:u13:barron, -13:u14:landscape, 17:uI1:[],,,,,,,,,,,, 14:uI2:,,,,,,,,,., 13:u02:Overview., @@ -1044741,9 +1058962,7 @@ 9:u03:Zehir, 18:u06:23(6):703-713., 9:u07:Redig, -13:u10:overview., 10:u12:barron, -13:u13:landscape, 8:u14:may;, 17:uI0:[],,,,,,,,,,,, 14:uI1:,,,,,,,,,., @@ -1044758,7 +1058977,6 @@ 9:u06:Redig, 9:u08:Hyman, 10:u11:barron, -13:u12:landscape, 8:u13:may;, 14:uI0:,,,,,,,,,., 15:uI2:;():-.:./.., @@ -1044771,7 +1058989,6 @@ 9:u05:Redig, 9:u07:Hyman, 10:u10:barron, -13:u11:landscape, 8:u12:may;, 8:u23:May;, 15:uI1:;():-.:./.., @@ -1044783,7 +1059000,6 @@ 9:u04:Redig, 9:u06:Hyman, 11:u08:Pesesky, -13:u10:landscape, 8:u11:may;, 15:uI0:;():-.:./.., 10:u00:Barron, @@ -1045646,7 +1059862,6 @@ 13:u07:Bosutinib, 7:u11:jw,, 11:u12:bcr-abl, -7:u22:BCR, 8:u23:BCR-, 16:uI0:,,,,,,,,,.,-, 20:uI2:..;():-.:./....., @@ -1045773,7 +1059988,6 @@ 37:u11:10.1111/j.1747-0285.2010.01054.x., 12:uI0:./.-...., 37:u02:10.1111/j.1747-0285.2010.01054.x., -12:u08:Tyrosine, 9:u04:Funct, 12:u05:Friesner, 37:u10:10.1111/j.1747-0285.2010.01054.x., @@ -1045782,23 +1059996,19 @@ 12:u04:Friesner, 10:uI2:,.:,.., 37:u00:10.1111/j.1747-0285.2010.01054.x., -12:u07:Tyrosine, 24:u08:10.2210/pdb4wkq/pdb., 9:u02:Funct, 12:u03:Friesner, 15:u08:Yosaatmadja, 10:uI1:,.:,.., -12:u06:Tyrosine, 9:u01:Funct, 12:u02:Friesner, 15:u07:Yosaatmadja, 10:uI0:,.:,.., -12:u05:Tyrosine, 24:u07:10.2210/pdb4wkq/pdb., 9:u00:Funct, 12:u01:Friesner, 15:u06:Yosaatmadja, -12:u04:Tyrosine, 24:u06:10.2210/pdb4wkq/pdb., 30:u08:10.1007/s10822-007-9133-z., 12:u00:Friesner, @@ -1045806,13 +1060016,11 @@ 15:u08:Protonation, 24:u14:10.2210/pdb4wkq/pdb., 13:uI2:[],....;:, -12:u03:Tyrosine, 24:u05:10.2210/pdb4wkq/pdb., 15:u04:Yosaatmadja, 15:u07:Protonation, 24:u13:10.2210/pdb4wkq/pdb., 13:uI1:[],....;:, -12:u02:Tyrosine, 24:u04:10.2210/pdb4wkq/pdb., 30:u07:10.1007/s10822-007-9133-z., 14:u08:Hydration., @@ -1045821,7 +1060029,6 @@ 13:u08:Berendsen, 24:u12:10.2210/pdb4wkq/pdb., 13:uI0:[],....;:, -12:u01:Tyrosine, 24:u03:10.2210/pdb4wkq/pdb., 30:u06:10.1007/s10822-007-9133-z., 33:u08:10.1007/978-94-015-7658-1_21., @@ -1045830,7 +1060037,6 @@ 13:u07:Berendsen, 24:u11:10.2210/pdb4wkq/pdb., 30:u14:10.1007/s10822-007-9133-z., -12:u00:Tyrosine, 24:u02:10.2210/pdb4wkq/pdb., 30:u05:10.1007/s10822-007-9133-z., 14:u07:Hydration., @@ -1046281,7 +1060487,6 @@ 12:u05:Branford, 12:u07:(STI571), 11:u14:bcr/abl, -7:u22:ABL, 7:u23:ABL, 19:uI1:?.;():-.:./---., 7:u03:ABL, @@ -1052366,22 +1066571,18 @@ 10:u01:0.05),, 9:u08:DPP4,, 10:u00:0.05),, -16:u08:druggability, 10:u08:SMAD3,, 9:u07:DPP4,, 10:u07:SMAD3,, 9:u06:DPP4,, -16:u07:druggability, 17:u08:Network-based, 10:u06:SMAD3,, 9:u14:dpp4,, 9:u05:DPP4,, -16:u06:druggability, 10:u05:SMAD3,, 9:u13:dpp4,, 16:u14:druggability, 9:u04:DPP4,, -16:u05:druggability, 17:u07:Network-based, 11:u08:notions, 10:u04:SMAD3,, @@ -1052390,30 +1066591,25 @@ 7:u22:DPP, 8:u23:DPP4, 9:u03:DPP4,, -16:u04:druggability, 17:u06:Network-based, 10:u03:SMAD3,, 9:u11:dpp4,, 16:u12:druggability, 17:u14:network-based, 9:u02:DPP4,, -16:u03:druggability, 11:u07:notions, 10:u02:SMAD3,, 9:u10:dpp4,, 16:u11:druggability, 9:u01:DPP4,, -16:u02:druggability, 11:u06:notions, 10:u01:SMAD3,, 16:u10:druggability, 11:u14:notions, 9:u00:DPP4,, -16:u01:druggability, 11:u05:notions, 10:u00:SMAD3,, 11:u13:notions, -16:u00:druggability, 11:u04:notions, 11:u12:notions, 11:u03:notions, @@ -1052880,8 +1067076,6 @@ 18:u11:mercaptopurine, 11:u12:pabpc1,, 21:u13:anti-inflammatory, -7:u22:PAB, -8:u23:PABP, 12:uI1:,,[,]()., 11:u03:PABPC1,, 21:u04:Anti-inflammatory, @@ -1052938,7 +1067132,6 @@ 8:u00:curb, 15:u06:proteinases, 8:u12:jun,, -7:u22:JUN, 8:u23:JUN,, 12:uI1:,.(-.),,, 8:u03:JUN,, @@ -1053599,35 +1067792,27 @@ 8:u01:CCCC, 7:u05:CCC, 7:u13:ccc, -9:u14:1,000, 8:u00:CCCC, 7:u04:CCC, 25:u08:(https://gephi.org/)., 13:u08:drug-HCoV, 7:u12:ccc, -9:u13:1,000, 7:u23:CCC, 7:u03:CCC, 13:u07:drug-HCoV, 7:u11:ccc, -9:u12:1,000, 7:u02:CCC, 25:u07:(https://gephi.org/)., 13:u06:drug-HCoV, 7:u10:ccc, -9:u11:1,000, -9:uI2:.--.., 7:u01:CCC, 25:u06:(https://gephi.org/)., 13:u05:drug-HCoV, -9:u10:1,000, 25:u14:(https://gephi.org/)., -9:uI1:.--.., 7:u00:CCC, 25:u05:(https://gephi.org/)., 13:u04:drug-HCoV, 25:u13:(https://gephi.org/)., -9:uI0:.--.., 25:u04:(https://gephi.org/)., 13:u03:drug-HCoV, 25:u12:(https://gephi.org/)., @@ -1055281,7 +1069466,6 @@ 14:u14:srinivasan, 13:u02:Silvestri, 31:u07:10.2174/187221412799015317., -7:u08:Tan, 11:u06:sepsis:, 13:u10:silvestri, 14:u13:srinivasan, @@ -1055294,41 +1069478,35 @@ 8:u23:Srin, 13:u00:Silvestri, 31:u05:10.2174/187221412799015317., -7:u07:Tan, 11:u04:sepsis:, 7:u07:DX,, 14:u11:srinivasan, 31:u13:10.2174/187221412799015317., 31:u04:10.2174/187221412799015317., -7:u06:Tan, 11:u03:sepsis:, 7:u06:DX,, 14:u10:srinivasan, 31:u12:10.2174/187221412799015317., 7:u14:tan, 31:u03:10.2174/187221412799015317., -7:u05:Tan, 16:u08:derivatives:, 11:u02:sepsis:, 7:u05:DX,, 31:u11:10.2174/187221412799015317., 7:u13:tan, 31:u02:10.2174/187221412799015317., -7:u04:Tan, 11:u01:sepsis:, 7:u04:DX,, 31:u10:10.2174/187221412799015317., 7:u12:tan, 7:u23:Tan, 31:u01:10.2174/187221412799015317., -7:u03:Tan, 16:u07:derivatives:, 11:u00:sepsis:, 7:u03:DX,, 10:u08:Pineal, 7:u11:tan, 31:u00:10.2174/187221412799015317., -7:u02:Tan, 16:u06:derivatives:, 10:u08:Galano, 7:u02:DX,, @@ -1057994,42 +1072172,33 @@ 8:u10:ibv,, 8:u01:IBV,, 8:u00:IBV,, -8:u08:(NA), -8:u07:(NA), -8:u06:(NA), 21:u08:immunosuppressant, -8:u05:(NA), 13:u08:blocker),, 23:u14:mechanism-of-action, 13:u08:circadian, -8:u04:(NA), 13:u07:blocker),, 16:u08:properties),, 23:u13:mechanism-of-action, 10:uI2:--:()(, 21:u07:immunosuppressant, -8:u03:(NA), 13:u06:blocker),, 16:u07:properties),, 23:u12:mechanism-of-action, 10:uI1:--:()(, 21:u06:immunosuppressant, 13:u07:circadian, -8:u02:(NA), 13:u05:blocker),, 16:u06:properties),, 23:u11:mechanism-of-action, 10:uI0:--:()(, 21:u05:immunosuppressant, 13:u06:circadian, -8:u01:(NA), 13:u04:blocker),, 16:u05:properties),, 23:u10:mechanism-of-action, 13:u14:circadian, 21:u04:immunosuppressant, 13:u05:circadian, -8:u00:(NA), 13:u03:blocker),, 16:u04:properties),, 13:u13:circadian, @@ -1058183,21 +1072352,16 @@ 14:u07:Targetable, 7:u08:2+3, 14:u06:Targetable, -14:u14:targetable, 14:u05:Targetable, 7:u07:2+3, -14:u13:targetable, 14:u04:Targetable, 7:u06:2+3, -14:u12:targetable, 7:u14:2+3, 14:u03:Targetable, 7:u05:2+3, -14:u11:targetable, 7:u13:2+3, 14:u02:Targetable, 7:u04:2+3, -14:u10:targetable, 7:u12:2+3, 7:u22:2+3, 7:u23:2+3, @@ -1058416,7 +1072580,6 @@ 12:u12:pan-hcov, 11:u13:camphor, 14:u14:carvedilol, -8:u23:Pan-, 12:u03:Pan-HCoV, 14:u10:paroxetine, 12:u11:pan-hcov, @@ -1059271,18 +1073434,15 @@ 10:u06:(Difco, 8:u07:(0.1, 14:u08:absorbance, -21:u08:spectrophotometer, 10:u14:(difco, 10:u05:(Difco, 8:u06:(0.1, 7:u08:mL,, -21:u07:spectrophotometer, 10:u13:(difco, 8:u14:(0.1, 10:u04:(Difco, 8:u05:(0.1, 14:u07:absorbance, -21:u06:spectrophotometer, 10:u12:(difco, 8:u13:(0.1, 8:u23:(Dif, @@ -1059291,7 +1073451,6 @@ 14:u06:absorbance, 7:u07:mL,, 10:u08:Wizard, -21:u05:spectrophotometer, 10:u11:(difco, 8:u12:(0.1, 14:u14:absorbance, @@ -1059300,7 +1073459,6 @@ 14:u05:absorbance, 7:u06:mL,, 10:u08:purify, -21:u04:spectrophotometer, 10:u10:(difco, 8:u11:(0.1, 14:u13:absorbance, @@ -1059310,7 +1073468,6 @@ 7:u05:mL,, 10:u07:Wizard, 8:u08:LAMP, -21:u03:spectrophotometer, 8:u10:(0.1, 14:u12:absorbance, 10:uI2:,./,)., @@ -1059320,7 +1073477,6 @@ 7:u04:mL,, 10:u06:Wizard, 10:u07:purify, -21:u02:spectrophotometer, 14:u11:absorbance, 10:u14:wizard, 6:u21:mL, @@ -1059333,7 +1073489,6 @@ 10:u05:Wizard, 10:u06:purify, 8:u07:LAMP, -21:u01:spectrophotometer, 14:u10:absorbance, 10:u13:wizard, 10:u14:purify, @@ -1059343,7 +1073498,6 @@ 10:u04:Wizard, 10:u05:purify, 8:u06:LAMP, -21:u00:spectrophotometer, 10:u12:wizard, 10:u13:purify, 8:u14:lamp, @@ -1059431,7 +1073585,6 @@ 14:u03:1402-9100,, 16:u04:(StepOnePlus, 14:u06:"threshold, -12:u08:Reported, 14:u11:1402-9100,, 16:u12:(steponeplus, 14:u14:"threshold, @@ -1059446,26 +1073599,18 @@ 14:u01:1402-9100,, 16:u02:(StepOnePlus, 14:u04:"threshold, -12:u07:Reported, 16:u10:(steponeplus, 14:u12:"threshold, 8:u23:"thr, 14:u00:1402-9100,, 16:u01:(StepOnePlus, 14:u03:"threshold, -12:u06:Reported, 14:u11:"threshold, 16:u00:(StepOnePlus, 14:u02:"threshold, -12:u05:Reported, 14:u10:"threshold, 14:u01:"threshold, -12:u04:Reported, 14:u00:"threshold, -12:u03:Reported, -12:u02:Reported, -12:u01:Reported, -12:u00:Reported, 9:u08:1.0%), 9:u08:phate, 11:uI2:.,,,)(,, @@ -1060116,41 +1074261,25 @@ 17:u05:electrolysis,, 17:u13:electrolysis,, 17:u04:electrolysis,, -8:u08:NaOH, 17:u12:electrolysis,, 17:u03:electrolysis,, 17:u11:electrolysis,, 17:u02:electrolysis,, -8:u07:NaOH, 17:u10:electrolysis,, 17:u01:electrolysis,, -8:u06:NaOH, -8:u14:naoh, 17:u00:electrolysis,, -8:u05:NaOH, 10:u08:13.694, -8:u13:naoh, -8:u04:NaOH, 9:u08:5.848, -8:u12:naoh, -7:u22:NaO, -8:u23:NaOH, -8:u03:NaOH, 10:u07:13.694, 10:u08:11.064, -8:u11:naoh, -8:u02:NaOH, 10:u06:13.694, 9:u07:5.848, -8:u10:naoh, 10:u14:13.694, -8:u01:NaOH, 10:u05:13.694, 9:u06:5.848, 10:u07:11.064, 10:u13:13.694, 9:u14:5.848, -8:u00:NaOH, 10:u04:13.694, 9:u05:5.848, 10:u06:11.064, @@ -1063626,51 +1077755,42 @@ 14:u01:addition)., 13:u00:cyanoDMNG, 14:u00:addition)., -15:u08:dimensions,, 13:u08:diverging, 9:u08:CDNB,, -15:u07:dimensions,, 9:u07:CDNB,, 16:u08:subdivisions, -15:u06:dimensions,, 13:u07:diverging, 9:u06:CDNB,, 16:u07:subdivisions, 15:u14:dimensions,, -15:u05:dimensions,, 13:u06:diverging, 9:u05:CDNB,, 16:u06:subdivisions, 15:u13:dimensions,, 13:u14:diverging, -15:u04:dimensions,, 13:u05:diverging, 9:u04:CDNB,, 16:u05:subdivisions, 15:u12:dimensions,, 13:u13:diverging, 13:u14:pair-wise, -15:u03:dimensions,, 13:u04:diverging, 9:u03:CDNB,, 16:u04:subdivisions, 15:u11:dimensions,, 13:u12:diverging, 13:u13:pair-wise, -15:u02:dimensions,, 13:u03:diverging, 9:u02:CDNB,, 16:u03:subdivisions, 15:u10:dimensions,, 13:u11:diverging, 13:u12:pair-wise, -15:u01:dimensions,, 13:u02:diverging, 9:u01:CDNB,, 16:u02:subdivisions, 13:u10:diverging, 13:u11:pair-wise, -15:u00:dimensions,, 13:u01:diverging, 9:u00:CDNB,, 16:u01:subdivisions, @@ -1063905,14 +1078025,9 @@ 11:u05:PC1-PC2, 11:u04:PC1-PC2, 11:u03:PC1-PC2, -13:u14:groupings, 11:u02:PC1-PC2, -13:u13:groupings, 11:u01:PC1-PC2, -13:u12:groupings, 11:u00:PC1-PC2, -13:u11:groupings, -13:u10:groupings, 11:u08:(brown), 11:u07:(brown), 11:u06:(brown), @@ -1065527,7 +1079642,6 @@ 11:u05:1.4+0.2, 12:u06:0.6+0.05, 11:u07:2.3+0.4, -6:u08:mg, 12:u11:1.2+0.03, 11:u12:5.0+0.5, 11:u13:1.4+0.2, @@ -1065550,7 +1079664,6 @@ 11:u03:1.4+0.2, 12:u04:0.6+0.05, 11:u05:2.3+0.4, -6:u07:mg, 9:u08:3)+SD, 11:u10:5.0+0.5, 11:u11:1.4+0.2, @@ -1065561,7 +1079674,6 @@ 11:u02:1.4+0.2, 12:u03:0.6+0.05, 11:u04:2.3+0.4, -6:u06:mg, 11:u10:1.4+0.2, 12:u11:0.6+0.05, 11:u12:2.3+0.4, @@ -1065570,14 +1079682,12 @@ 11:u01:1.4+0.2, 12:u02:0.6+0.05, 11:u03:2.3+0.4, -6:u05:mg, 9:u07:3)+SD, 12:u10:0.6+0.05, 11:u11:2.3+0.4, 11:u00:1.4+0.2, 12:u01:0.6+0.05, 11:u02:2.3+0.4, -6:u04:mg, 9:u06:3)+SD, 11:u10:2.3+0.4, 9:u14:3)+sd, @@ -1065585,19 +1079695,15 @@ 6:u23:mg, 12:u00:0.6+0.05, 11:u01:2.3+0.4, -6:u03:mg, 9:u05:3)+SD, 9:u13:3)+sd, 11:u00:2.3+0.4, -6:u02:mg, 9:u04:3)+SD, 9:u12:3)+sd, 7:u22:3)+, 8:u23:3)+S, -6:u01:mg, 9:u03:3)+SD, 9:u11:3)+sd, -6:u00:mg, 9:u02:3)+SD, 9:u10:3)+sd, 9:u01:3)+SD, @@ -1079173,7 +1093279,6 @@ 8:u04:612., 8:u03:Comp, 8:u12:612., -8:u23:612., 9:u00:eds),, 8:u03:612., 10:u08:alba):, @@ -1081717,31 +1095822,22 @@ 12:u01:authors), 12:u00:authors), 8:u08:IAC,, -7:u08:MAX, 8:u07:IAC,, -7:u07:MAX, 8:u06:IAC,, -7:u06:MAX, 8:u14:iac,, 8:u05:IAC,, -7:u05:MAX, 8:u13:iac,, 8:u04:IAC,, -7:u04:MAX, 8:u12:iac,, 8:u23:IAC,, 8:u03:IAC,, -7:u03:MAX, 8:u11:iac,, 8:u02:IAC,, 8:u08:DOM,, -7:u02:MAX, 8:u10:iac,, 8:u01:IAC,, -7:u01:MAX, 8:u00:IAC,, 8:u07:DOM,, -7:u00:MAX, 8:u06:DOM,, 8:u05:DOM,, 11:u08:(SM(t),, @@ -1084426,8 +1098522,6 @@ 7:uI2:::), 7:uI1:::), 7:uI0:::), -7:u22:MAX, -7:u23:MAX, 9:u08:0.115, 9:u07:0.115, 9:u08:0.105, @@ -1084993,7 +1099087,6 @@ 22:u10:infected/diagnosed, 17:u12:jurisdictions, 12:u13:columbia, -8:u23:juri, 11:uI0:-(..-)., 14:uI2:()[],[],[], 22:u01:infected/diagnosed, @@ -1085355,7 +1099448,6 @@ 15:u02:(numerator), 15:u03:Denominator, 13:u07:Diagnosed, -13:u08:Confirmed, 15:u10:(numerator), 15:u01:(numerator), 15:u02:Denominator, @@ -1085363,33 +1099455,25 @@ 15:u00:(numerator), 15:u01:Denominator, 13:u05:Diagnosed, -13:u07:Confirmed, 15:u00:Denominator, 13:u04:Diagnosed, -13:u06:Confirmed, 10:u08:16,110, 13:u03:Diagnosed, -13:u05:Confirmed, 13:u02:Diagnosed, -13:u04:Confirmed, 10:u07:16,110, 13:u01:Diagnosed, -13:u03:Confirmed, 10:u06:16,110, 16:u08:HIV-positive, 10:u14:16,110, 13:u00:Diagnosed, -13:u02:Confirmed, 10:u05:16,110, 16:u07:HIV-positive, 8:u08:�1, 10:u13:16,110, -13:u01:Confirmed, 10:u04:16,110, 16:u06:HIV-positive, 8:u07:�1, 10:u12:16,110, -13:u00:Confirmed, 10:u03:16,110, 10:u08:17,423, 16:u05:HIV-positive, @@ -1085809,7 +1099893,6 @@ 16:u07:suppressed"., 10:u10:biases, 10:u14:inator, -8:u23:elig, 10:u05:inator, 16:u06:suppressed"., 10:u13:inator, @@ -1085928,20 +1100011,11 @@ 10:u03:nicity, 10:u11:nicity, 10:u02:nicity, -9:u08:[48]., 10:u10:nicity, 10:u01:nicity, -9:u07:[48]., 10:u00:nicity, -9:u06:[48]., -9:u05:[48]., -9:u04:[48]., -9:u03:[48]., -9:u02:[48]., -9:u01:[48]., 15:u08:(1985-2015), 17:u08:non-nominally, -9:u00:[48]., 15:u07:(1985-2015), 15:u06:(1985-2015), 17:u07:non-nominally, @@ -1088807,7 +1102881,6 @@ 12:u08:HIV/AIDS, 8:uI0:.:,., 19:uI1:..://..//-----., -13:uI2:.,,,,,,.,, 15:u03:Initiative., 14:u06:2009/2010:, 72:u08:health.gov.on.ca/en/pro/programs/hivaids/docs/oach_strategy_2026.pdf, @@ -1088816,13 +1102889,11 @@ 12:u07:HIV/AIDS, 14:u14:2009/2010:, 19:uI0:..://..//-----., -13:uI1:.,,,,,,.,, 15:u02:Initiative., 14:u05:2009/2010:, 12:u03:Antoniou, 12:u06:HIV/AIDS, 14:u13:2009/2010:, -13:uI0:.,,,,,,.,, 17:uI2:/:-.--.;():-., 15:u01:Initiative., 14:u04:2009/2010:, @@ -1089984,15 +1104055,10 @@ 16:u02:proapoptotic, 16:u01:proapoptotic, 16:u00:proapoptotic, -8:u14:mtor, -8:u13:mtor, 7:u08:TWO, -8:u12:mtor, 13:u08:DIFFERENT, -8:u11:mtor, 7:u07:TWO, 13:u07:DIFFERENT, -8:u10:mtor, 7:u06:TWO, 13:u06:DIFFERENT, 7:u05:TWO, @@ -1090019,7 +1104085,6 @@ 12:u06:Ceramide, 12:u05:Ceramide, 12:u04:Ceramide, -8:u23:Cera, 12:u03:Ceramide, 9:u08:mTOR,, 12:u02:Ceramide, @@ -1092525,18 +1106590,9 @@ 10:u11:alone,, 11:uI0:,.−)., 10:u10:alone,, -9:u08:Atlas, -9:u07:Atlas, -9:u06:Atlas, -9:u05:Atlas, 13:uI2:[](,//).,, -9:u04:Atlas, 13:uI1:[](,//).,, -9:u03:Atlas, 13:uI0:[](,//).,, -9:u02:Atlas, -9:u01:Atlas, -9:u00:Atlas, 10:u08:usage,, 10:u07:usage,, 10:u06:usage,, @@ -1096118,7 +1110174,6 @@ 10:u10:hclcy", 8:u12:cicy, 6:u13:kd, -7:u22:CIC, 8:u23:CICy, 10:u01:HClCy", 8:u03:CICy, @@ -1102540,7 +1116595,6 @@ 12:u04:on-slide, 24:u00:chromosomal-location, 12:u12:on-slide, -7:u22:on-, 8:u23:on-s, 8:uI1:-''-, 12:u03:on-slide, @@ -1102998,151 +1117052,74 @@ 7:u08:MYC, 9:u06:RUNX3, 8:u07:MLH1, -9:u08:BRCA2, 9:u14:runx3, 9:u05:RUNX3, 8:u06:MLH1, 7:u07:MYC, -8:u08:KRAS, 9:u13:runx3, 8:u14:mlh1, 9:u04:RUNX3, 8:u05:MLH1, 7:u06:MYC, -9:u07:BRCA2, -8:u08:CDH1, 9:u12:runx3, 8:u13:mlh1, 7:u14:myc, 9:u03:RUNX3, 8:u04:MLH1, 7:u05:MYC, -9:u06:BRCA2, -8:u07:KRAS, -8:u08:TP53, 9:u11:runx3, 8:u12:mlh1, 7:u13:myc, -9:u14:brca2, 7:u22:MLH, 8:u23:MLH1, 9:u02:RUNX3, 8:u03:MLH1, 7:u04:MYC, -9:u05:BRCA2, -8:u06:KRAS, -8:u07:CDH1, 9:u10:runx3, 8:u11:mlh1, 7:u12:myc, -9:u13:brca2, -8:u14:kras, 7:u22:MYC, 7:u23:MYC, 9:u01:RUNX3, 8:u02:MLH1, 7:u03:MYC, -9:u04:BRCA2, -8:u05:KRAS, -8:u06:CDH1, -8:u07:TP53, -10:u08:MAP2K4, 8:u10:mlh1, 7:u11:myc, -9:u12:brca2, -8:u13:kras, -8:u14:cdh1, -7:u22:BRC, -8:u23:BRCA, 9:u00:RUNX3, 8:u01:MLH1, 7:u02:MYC, -9:u03:BRCA2, -8:u04:KRAS, -8:u05:CDH1, -8:u06:TP53, 9:u08:NCOA3, 7:u10:myc, -9:u11:brca2, -8:u12:kras, -8:u13:cdh1, -8:u14:tp53, -7:u22:KRA, -8:u23:KRAS, 8:u00:MLH1, 7:u01:MYC, -9:u02:BRCA2, -8:u03:KRAS, -8:u04:CDH1, -8:u05:TP53, -10:u07:MAP2K4, 9:u08:SCAP2, -9:u10:brca2, -8:u11:kras, -8:u12:cdh1, -8:u13:tp53, -8:u23:CDH1, 7:u00:MYC, -9:u01:BRCA2, -8:u02:KRAS, -8:u03:CDH1, -8:u04:TP53, -10:u06:MAP2K4, 9:u07:NCOA3, 10:u08:BCMP11, -8:u10:kras, -8:u11:cdh1, -8:u12:tp53, -10:u14:map2k4, -7:u22:TP5, -8:u23:TP53, -9:u00:BRCA2, -8:u01:KRAS, -8:u02:CDH1, -8:u03:TP53, -10:u05:MAP2K4, 9:u06:NCOA3, 9:u07:SCAP2, -8:u10:cdh1, -8:u11:tp53, -10:u13:map2k4, 9:u14:ncoa3, -8:u00:KRAS, -8:u01:CDH1, -8:u02:TP53, -10:u04:MAP2K4, 9:u05:NCOA3, 9:u06:SCAP2, 10:u07:BCMP11, -8:u10:tp53, -10:u12:map2k4, 9:u13:ncoa3, 9:u14:scap2, -8:u00:CDH1, -8:u01:TP53, -10:u03:MAP2K4, 9:u04:NCOA3, 9:u05:SCAP2, 10:u06:BCMP11, 7:u08:DCC, -10:u11:map2k4, 9:u12:ncoa3, 9:u13:scap2, 10:u14:bcmp11, -7:u22:NCO, 8:u23:NCOA, -8:u00:TP53, -10:u02:MAP2K4, 9:u03:NCOA3, 9:u04:SCAP2, 10:u05:BCMP11, 10:u08:ATP5A1, -10:u10:map2k4, 9:u11:ncoa3, 9:u12:scap2, 10:u13:bcmp11, 8:u23:SCAP, -10:u01:MAP2K4, 9:u02:NCOA3, 9:u03:SCAP2, 10:u04:BCMP11, @@ -1103152,13 +1117129,11 @@ 10:u12:bcmp11, 7:u22:BCM, 8:u23:BCMP, -10:u00:MAP2K4, 9:u01:NCOA3, 9:u02:SCAP2, 10:u03:BCMP11, 7:u06:DCC, 10:u07:ATP5A1, -9:u08:SMAD4, 9:u10:scap2, 10:u11:bcmp11, 7:u14:dcc, @@ -1103174,7 +1117149,6 @@ 10:u01:BCMP11, 7:u04:DCC, 10:u05:ATP5A1, -9:u07:SMAD4, 7:u12:dcc, 10:u13:atp5a1, 7:u22:DCC, @@ -1103182,31 +1117156,18 @@ 10:u00:BCMP11, 7:u03:DCC, 10:u04:ATP5A1, -9:u06:SMAD4, 7:u11:dcc, 10:u12:atp5a1, -9:u14:smad4, 7:u02:DCC, 10:u03:ATP5A1, -9:u05:SMAD4, 7:u10:dcc, 10:u11:atp5a1, -9:u13:smad4, 7:u01:DCC, 10:u02:ATP5A1, -9:u04:SMAD4, 10:u10:atp5a1, -9:u12:smad4, -8:u23:SMAD, 7:u00:DCC, 10:u01:ATP5A1, -9:u03:SMAD4, -9:u11:smad4, 10:u00:ATP5A1, -9:u02:SMAD4, -9:u10:smad4, -9:u01:SMAD4, -9:u00:SMAD4, 17:u08:Square-shaped, 17:u07:Square-shaped, 16:u08:centromeres., @@ -1109459,23 +1123420,14 @@ 10:u10:p15.1,, 10:u01:p15.1,, 10:u00:p15.1,, -21:u08:receptor-positive, -21:u07:receptor-positive, -21:u06:receptor-positive, -21:u05:receptor-positive, 8:u08:70%), -21:u04:receptor-positive, 8:u07:70%), 11:u08:(PanIN), -21:u03:receptor-positive, 8:u06:70%), -21:u02:receptor-positive, 8:u05:70%), 11:u07:(PanIN), -21:u01:receptor-positive, 8:u04:70%), 11:u06:(PanIN), -21:u00:receptor-positive, 8:u03:70%), 11:u14:(panin), 11:u05:(PanIN), @@ -1109487,15 +1123439,12 @@ 11:u12:(panin), 8:u23:(Pan, 11:uI1:()(-,;-, -9:uI2:,;-,;, 11:u03:(PanIN), 8:u00:70%), 11:u11:(panin), 11:uI0:()(-,;-, -9:uI1:,;-,;, 11:u02:(PanIN), 11:u10:(panin), -9:uI0:,;-,;, 11:u01:(PanIN), 11:u00:(PanIN), 10:u08:(score, @@ -1110620,7 +1124569,6 @@ 7:u04:NR,, 10:u05:Ki-ras, 7:u07:YJ,, -8:u08:Dual, 11:u12:lemoine, 8:u23:Lemo, 9:u00:Karhu, @@ -1110629,13 +1124577,11 @@ 7:u03:NR,, 10:u04:Ki-ras, 7:u06:YJ,, -8:u07:Dual, 11:u11:lemoine, 7:u01:45:, 7:u02:NR,, 10:u03:Ki-ras, 7:u05:YJ,, -8:u06:Dual, 11:u10:lemoine, 17:u07:(p11.2;q11.2), 7:u08:490, @@ -1110643,13 +1124589,11 @@ 7:u01:NR,, 10:u02:Ki-ras, 7:u04:YJ,, -8:u05:Dual, 17:u06:(p11.2;q11.2), 13:u08:Mahlamaki, 7:u00:NR,, 10:u01:Ki-ras, 7:u03:YJ,, -8:u04:Dual, 8:u08:-496, 17:u14:(p11.2;q11.2), 17:u05:(p11.2;q11.2), @@ -1110657,7 +1124601,6 @@ 12:u08:Sandberg, 10:u00:Ki-ras, 7:u02:YJ,, -8:u03:Dual, 8:u07:-496, 17:u13:(p11.2;q11.2), 10:uI2:(.;.):, @@ -1110665,7 +1124608,6 @@ 7:u06:490, 13:u07:Mahlamaki, 7:u01:YJ,, -8:u02:Dual, 8:u06:-496, 17:u12:(p11.2;q11.2), 7:u14:490, @@ -1110677,7 +1124619,6 @@ 13:u06:Mahlamaki, 12:u07:Sandberg, 7:u00:YJ,, -8:u01:Dual, 8:u05:-496, 17:u11:(p11.2;q11.2), 7:u13:490, @@ -1110687,7 +1124628,6 @@ 7:u04:490, 13:u05:Mahlamaki, 12:u06:Sandberg, -8:u00:Dual, 8:u04:-496, 17:u10:(p11.2;q11.2), 7:u12:490, @@ -1110773,12 +1124713,10 @@ 8:u04:Murr, 7:u07:MG,, 10:u08:Olshen, -19:u08:adenocarcinoma., 8:u12:murr, 9:u14:nowak, 8:u03:Murr, 7:u06:MG,, -19:u07:adenocarcinoma., 8:u11:murr, 9:u13:nowak, 7:u14:mg,, @@ -1110786,7 +1124724,6 @@ 7:u05:MG,, 10:u07:Olshen, 17:u08:Biostatistics, -19:u06:adenocarcinoma., 8:u10:murr, 9:u12:nowak, 7:u13:mg,, @@ -1110794,7 +1124731,6 @@ 7:u04:MG,, 10:u06:Olshen, 10:u08:Pinkel, -19:u05:adenocarcinoma., 9:u11:nowak, 7:u12:mg,, 10:u14:olshen, @@ -1110804,7 +1124740,6 @@ 7:u03:MG,, 10:u05:Olshen, 17:u07:Biostatistics, -19:u04:adenocarcinoma., 9:u10:nowak, 7:u11:mg,, 10:u13:olshen, @@ -1110812,7 +1124747,6 @@ 10:u04:Olshen, 17:u06:Biostatistics, 10:u07:Pinkel, -19:u03:adenocarcinoma., 7:u10:mg,, 10:u12:olshen, 17:u14:biostatistics, @@ -1110821,7 +1124755,6 @@ 10:u03:Olshen, 17:u05:Biostatistics, 10:u06:Pinkel, -19:u02:adenocarcinoma., 10:u11:olshen, 17:u13:biostatistics, 10:u14:pinkel, @@ -1110829,7 +1124762,6 @@ 10:u02:Olshen, 17:u04:Biostatistics, 10:u05:Pinkel, -19:u01:adenocarcinoma., 10:u10:olshen, 17:u12:biostatistics, 10:u13:pinkel, @@ -1110837,7 +1124769,6 @@ 17:u03:Biostatistics, 10:u04:Pinkel, 11:u08:Pollack, -19:u00:adenocarcinoma., 8:u08:-211, 17:u11:biostatistics, 10:u12:pinkel, @@ -1113580,37 +1127511,28 @@ 9:u02:APDs., 12:u04:voltages, 12:u07:nonlocal, -12:u08:clearest, 9:u10:apds., 12:u12:voltages, 13:u13:shrinking, 9:u01:APDs., 12:u03:voltages, 12:u06:nonlocal, -12:u07:clearest, 12:u11:voltages, 13:u12:shrinking, 12:u14:nonlocal, 9:u00:APDs., 12:u02:voltages, 12:u05:nonlocal, -12:u06:clearest, 12:u10:voltages, 13:u11:shrinking, 12:u01:voltages, 12:u04:nonlocal, -12:u05:clearest, 13:u10:shrinking, 12:u00:voltages, 12:u03:nonlocal, -12:u04:clearest, 12:u02:nonlocal, -12:u03:clearest, 12:u01:nonlocal, -12:u02:clearest, 12:u00:nonlocal, -12:u01:clearest, -12:u00:clearest, 6:u08:><, 6:u07:><, 6:u06:><, @@ -1113694,7 +1127616,6 @@ 6:u14:uv, 6:u05:UV, 9:u06:230nm, -10:u08:impure, 16:u00:proposition., 11:u02:cavity., 6:u13:uv, @@ -1113704,47 +1127625,38 @@ 11:u01:cavity., 6:u12:uv, 9:u13:230nm, -6:u21:UV, 6:u22:UV, 6:u23:UV, 6:u03:UV, 9:u04:230nm, -10:u07:impure, 11:u00:cavity., 6:u11:uv, 9:u12:230nm, 8:u23:230n, 6:u02:UV, 9:u03:230nm, -10:u06:impure, 6:u10:uv, 9:u11:230nm, 10:u14:impure, 6:u01:UV, 9:u02:230nm, -10:u05:impure, 11:u08:(α/β), 9:u10:230nm, 10:u13:impure, 6:u00:UV, 9:u01:230nm, -10:u04:impure, 10:u12:impure, 12:uI2:"",(/)(/, 9:u00:230nm, -10:u03:impure, 11:u07:(α/β), 10:u11:impure, 12:uI1:"",(/)(/, -10:u02:impure, 11:u06:(α/β), 10:u10:impure, 11:u14:(α/β), 12:uI0:"",(/)(/, -10:u01:impure, 11:u05:(α/β), 11:u13:(α/β), -10:u00:impure, 11:u04:(α/β), 11:u12:(α/β), 8:u22:(α/, @@ -1120317,19 +1134229,16 @@ 8:u06:():,, 16:u12:specications, 9:uI0:...:,, -15:uI2:...,..,...., 16:u03:specications, 9:u01:Erich, 8:u05:():,, 16:u11:specications, -15:uI1:...,..,...., 10:uI2:,():,., 16:u02:specications, 7:u07:jan, 9:u00:Erich, 8:u04:():,, 16:u10:specications, -15:uI0:...,..,...., 10:uI1:,():,., 16:u01:specications, 7:u06:jan, @@ -1127474,7 +1141383,6 @@ 28:u11:2009;29(45):14323-14333., 12:u12:chechik,, 11:u13:nelken,, -8:u23:Chec, 20:uI1:,.,,.,-,.,,.,,.,, 28:u02:2009;29(45):14323-14333., 12:u03:Chechik,, @@ -1130778,7 +1144686,6 @@ 22:uI2:-(/)-(−/−).(,-, 10:u01:(32-35, 10:u07:heart,, -9:u08:Micro, 12:u01:somites), 22:uI1:-(/)-(−/−).(,-, 9:uI2:-)--,, @@ -1130788,35 +1144695,27 @@ 22:uI0:-(/)-(−/−).(,-, 9:uI1:-)--,, 10:u05:heart,, -9:u07:Micro, 9:uI0:-)--,, 10:u04:heart,, -9:u06:Micro, 15:u08:Bioanalyzer, 9:u14:micro, 10:u03:heart,, -9:u05:Micro, 15:u07:Bioanalyzer, 9:u13:micro, 10:u02:heart,, -9:u04:Micro, 15:u06:Bioanalyzer, 9:u12:micro, 10:u01:heart,, -9:u03:Micro, 16:u08:(Heidelberg,, 15:u05:Bioanalyzer, 9:u11:micro, 10:u00:heart,, -9:u02:Micro, 11:u08:TruSeq,, 15:u04:Bioanalyzer, 9:u10:micro, -9:u01:Micro, 16:u07:(Heidelberg,, 14:u08:Sequencer., 15:u03:Bioanalyzer, -9:u00:Micro, 16:u06:(Heidelberg,, 11:u07:TruSeq,, 15:u02:Bioanalyzer, @@ -1132136,7 +1146035,6 @@ 8:u06:Circ, 15:u11:ryckebusch,, 12:u12:zaffran,, -7:u22:Zaf, 8:u23:Zaff, 12:u00:Roberts,, 15:u02:Ryckebusch,, @@ -1133681,7 +1147579,6 @@ 8:u23:E14., 10:u03:E14.5-, 9:u07:(16%), -9:u08:(79%), 10:u11:e14.5-, 9:u12:e15.5, 7:u22:E15, @@ -1133693,34 +1147590,26 @@ 9:u14:(16%), 10:u01:E14.5-, 9:u05:(16%), -9:u07:(79%), 9:u10:e15.5, 9:u13:(16%), 10:u00:E14.5-, 9:u04:(16%), -9:u06:(79%), 9:u12:(16%), 9:u14:(79%), 8:u23:(16%, 9:u03:(16%), -9:u05:(79%), 9:u11:(16%), 9:u13:(79%), 9:u02:(16%), -9:u04:(79%), 9:u10:(16%), 9:u12:(79%), 8:u23:(79%, 9:u01:(16%), -9:u03:(79%), 9:u11:(79%), 9:u00:(16%), -9:u02:(79%), 9:u10:(79%), 9:u14:(74%), -9:u01:(79%), 9:u13:(74%), -9:u00:(79%), 9:u12:(74%), 9:u14:(11%), 8:u23:(74%, @@ -1133760,37 +1147649,22 @@ 9:u10:(22%), 8:u08:(5%), 8:u07:(5%), -9:u08:(47%), 8:u06:(5%), 8:u14:(5%), 8:u05:(5%), -9:u07:(47%), 8:u13:(5%), 8:u04:(5%), -9:u06:(47%), 8:u12:(5%), -9:u14:(47%), 8:u23:(5%), 8:u03:(5%), -9:u05:(47%), 8:u11:(5%), -9:u13:(47%), 8:u02:(5%), -9:u04:(47%), 8:u10:(5%), -9:u12:(47%), -8:u23:(47%, 8:u01:(5%), -9:u03:(47%), 6:u08:6*, -9:u11:(47%), 8:u00:(5%), -9:u02:(47%), 9:u08:(30%), -9:u10:(47%), -9:u01:(47%), 6:u07:6*, -9:u00:(47%), 6:u06:6*, 9:u07:(30%), 6:u14:6*, @@ -1143128,7 +1157002,6 @@ 7:u03:CAS, 8:u04:N45;, 8:u12:n45;, -6:u21:N4, 7:u22:N45, 8:u23:N45;, 7:u02:CAS, @@ -1143621,7 +1157494,6 @@ 10:u07:Che94], 9:u06:disks, 10:u06:Che94], -15:u08:Replication, 9:u05:disks, 10:u14:che94], 8:uI2:,.],, @@ -1143630,32 +1157502,24 @@ 10:u13:che94], 8:uI1:,.],, 10:u04:Che94], -15:u07:Replication, 9:u03:disks, 10:u12:che94], 8:u23:Che9, 8:uI0:,.],, 10:u03:Che94], -15:u06:Replication, 9:u02:disks, 10:u11:che94], 10:u02:Che94], -15:u05:Replication, 9:u01:disks, 10:u10:che94], 10:u14:copies, 10:u01:Che94], -15:u04:Replication, 9:u00:disks, 10:u13:copies, 10:u00:Che94], -15:u03:Replication, 10:u12:copies, -15:u02:Replication, 10:u11:copies, -15:u01:Replication, 10:u10:copies, -15:u00:Replication, 8:uI2:()"(, 8:uI1:()"(, 8:uI0:()"(, @@ -1145449,23 +1159313,18 @@ 14:u13:anticancer, 16:u07:personalized, 14:u12:anticancer, -9:u14:imply, 16:u06:personalized, 14:u11:anticancer, -9:u13:imply, 16:u14:personalized, 16:u05:personalized, 12:u08:ACSL/SCD, 14:u10:anticancer, -9:u12:imply, 16:u13:personalized, 16:u04:personalized, 12:u07:ACSL/SCD, -9:u11:imply, 16:u12:personalized, 16:u03:personalized, 12:u06:ACSL/SCD, -9:u10:imply, 16:u11:personalized, 16:u02:personalized, 13:u08:Metformin, @@ -1148265,8 +1162124,6 @@ 7:u02:Ran, 7:u05:Qiu, 9:u12:pten., -7:u22:PTE, -8:u23:PTEN, 9:u03:PTEN., 9:u06:Assoc, 11:u00:2016;6:, @@ -1148475,26 +1162332,22 @@ 11:u08:328.e1., 13:u01:2012;131:, 11:u06:Miranda, -14:u08:Metastatic, 15:uI2:..;:-.:./.., 14:u07:Refractory, 13:u00:2012;131:, 11:u05:Miranda, -14:u07:Metastatic, 34:u08:doi:10.1016/j.clcc.2016.04.011, 15:uI1:..;:-.:./.., 14:u06:Refractory, 11:u07:328.e1., 15:u08:oxaliplatin, 11:u04:Miranda, -14:u06:Metastatic, 34:u07:doi:10.1016/j.clcc.2016.04.011, 14:u14:refractory, 15:uI0:..;:-.:./.., 14:u05:Refractory, 11:u06:328.e1., 11:u03:Miranda, -14:u05:Metastatic, 34:u06:doi:10.1016/j.clcc.2016.04.011, 14:u13:refractory, 11:u14:328.e1., @@ -1148503,7 +1162356,6 @@ 15:u07:oxaliplatin, 67:u08:http://ascopubs.org/doi/abs/10.1200/jco.2011.29.15_suppl.e13041, 11:u02:Miranda, -14:u04:Metastatic, 34:u05:doi:10.1016/j.clcc.2016.04.011, 13:u08:Oncology:, 14:u12:refractory, @@ -1148513,7 +1162365,6 @@ 11:u04:328.e1., 15:u06:oxaliplatin, 11:u01:Miranda, -14:u03:Metastatic, 34:u04:doi:10.1016/j.clcc.2016.04.011, 13:u07:Oncology:, 14:u11:refractory, @@ -1148526,7 +1162377,6 @@ 67:u07:http://ascopubs.org/doi/abs/10.1200/jco.2011.29.15_suppl.e13041, 15:u08:Antagonizes, 11:u00:Miranda, -14:u02:Metastatic, 34:u03:doi:10.1016/j.clcc.2016.04.011, 13:u06:Oncology:, 9:u08:Griss, @@ -1148540,7 +1162390,6 @@ 15:u04:oxaliplatin, 67:u06:http://ascopubs.org/doi/abs/10.1200/jco.2011.29.15_suppl.e13041, 17:u08:Biosynthesis., -14:u01:Metastatic, 34:u02:doi:10.1016/j.clcc.2016.04.011, 13:u05:Oncology:, 9:u07:Griss, @@ -1148555,7 +1162404,6 @@ 15:u03:oxaliplatin, 67:u05:http://ascopubs.org/doi/abs/10.1200/jco.2011.29.15_suppl.e13041, 15:u07:Antagonizes, -14:u00:Metastatic, 34:u01:doi:10.1016/j.clcc.2016.04.011, 13:u04:Oncology:, 9:u06:Griss, @@ -1150528,31 +1164376,23 @@ 13:u01:(cycling), 13:u00:(cycling), 9:u08:50-59, -11:u08:Uterine, 9:u07:50-59, 12:u08:SU+CH+RA, 9:u06:50-59, -11:u07:Uterine, 9:u14:50-59, 9:u05:50-59, -11:u06:Uterine, 12:u07:SU+CH+RA, 9:u13:50-59, 9:u04:50-59, -11:u05:Uterine, 12:u06:SU+CH+RA, 9:u12:50-59, 12:u14:su+ch+ra, 9:u03:50-59, -11:u04:Uterine, 12:u05:SU+CH+RA, 13:u08:VivoSmart, 9:u11:50-59, 12:u13:su+ch+ra, -7:u22:Ute, -8:u23:Uter, 9:u02:50-59, -11:u03:Uterine, 12:u04:SU+CH+RA, 13:u07:VivoSmart, 9:u10:50-59, @@ -1150560,17 +1164400,14 @@ 7:u22:SU+, 8:u23:SU+C, 9:u01:50-59, -11:u02:Uterine, 12:u03:SU+CH+RA, 13:u06:VivoSmart, 12:u11:su+ch+ra, 9:u00:50-59, -11:u01:Uterine, 12:u02:SU+CH+RA, 9:u08:SU+CH, 13:u05:VivoSmart, 12:u10:su+ch+ra, -11:u00:Uterine, 12:u01:SU+CH+RA, 13:u04:VivoSmart, 12:u00:SU+CH+RA, @@ -1150623,8 +1164460,6 @@ 11:u13:ovarian, 11:u04:Ovarian, 11:u12:ovarian, -7:u22:Ova, -8:u23:Ovar, 11:u03:Ovarian, 11:u11:ovarian, 11:u02:Ovarian, @@ -1150670,15 +1164505,10 @@ 15:u08:Endometrial, 15:u07:Endometrial, 15:u06:Endometrial, -15:u14:endometrial, 15:u05:Endometrial, -15:u13:endometrial, 15:u04:Endometrial, -15:u12:endometrial, 15:u03:Endometrial, -15:u11:endometrial, 15:u02:Endometrial, -15:u10:endometrial, 15:u01:Endometrial, 9:u08:SU+RA, 15:u00:Endometrial, @@ -1151213,14 +1165043,12 @@ 11:u07:(Garmin, 8:u11:"all, 8:u13:"but, -11:u14:thought, 12:uI0:""(,-);", 8:u02:"All, 8:u04:"But, 11:u06:(Garmin, 8:u10:"all, 8:u12:"but, -11:u13:thought, 7:u22:"Bu, 8:u23:"But, 11:uI2:"(,-);", @@ -1151229,7 +1165057,6 @@ 9:u07:"With, 11:u05:(Garmin, 8:u11:"but, -11:u12:thought, 11:uI1:"(,-);", 11:uI2:()()"(,, 8:u00:"All, @@ -1151237,7 +1165064,6 @@ 9:u06:"With, 11:u04:(Garmin, 8:u10:"but, -11:u11:thought, 9:u14:"with, 11:uI0:"(,-);", 11:uI1:()()"(,, @@ -1151246,7 +1165072,6 @@ 53:u08:https://doi.org/10.1371/journal.pone.0210039.t004, 11:u03:(Garmin, 10:u08:60-67), -11:u10:thought, 9:u13:"with, 11:uI0:()()"(,, 9:uI2:",',', @@ -1155648,27 +1169473,22 @@ 9:u01:Chin,, 10:u07:Quick,, 10:u08:minion, -13:u14:long-read, 13:uI0:.,...-,-., 9:u00:Chin,, 10:u06:Quick,, 10:u07:minion, -13:u13:long-read, 10:u05:Quick,, 10:u06:minion, 12:u08:Goodwin,, -13:u12:long-read, 10:u04:Quick,, 10:u05:minion, 12:u07:Goodwin,, 10:u08:013490, -13:u11:long-read, 10:u03:Quick,, 10:u04:minion, 12:u06:Goodwin,, 10:u07:013490, 10:u08:Loman,, -13:u10:long-read, 10:u02:Quick,, 10:u03:minion, 12:u05:Goodwin,, @@ -1155862,64 +1169682,51 @@ 18:u00:collaborations, 9:uI0::.-.-, 10:u08:500000, -11:u08:1000000, 10:u07:500000, 11:u08:1500000, 10:u06:500000, -11:u07:1000000, 11:u08:2000000, 10:u14:500000, 10:u05:500000, -11:u06:1000000, 11:u07:1500000, 11:u08:2500000, 10:u13:500000, -11:u14:1000000, 10:u04:500000, -11:u05:1000000, 11:u06:1500000, 11:u07:2000000, 11:u08:3000000, 10:u12:500000, -11:u13:1000000, 11:u14:1500000, 10:u03:500000, -11:u04:1000000, 11:u05:1500000, 11:u06:2000000, 11:u07:2500000, 11:u08:3500000, 10:u11:500000, -11:u12:1000000, 11:u13:1500000, 11:u14:2000000, 10:u02:500000, -11:u03:1000000, 11:u04:1500000, 11:u05:2000000, 11:u06:2500000, 11:u07:3000000, 11:u08:4000000, 10:u10:500000, -11:u11:1000000, 11:u12:1500000, 11:u13:2000000, 11:u14:2500000, 10:u01:500000, -11:u02:1000000, 11:u03:1500000, 11:u04:2000000, 11:u05:2500000, 11:u06:3000000, 11:u07:3500000, 11:u08:4500000, -11:u10:1000000, 11:u11:1500000, 11:u12:2000000, 11:u13:2500000, 11:u14:3000000, 10:u00:500000, -11:u01:1000000, 11:u02:1500000, 11:u03:2000000, 11:u04:2500000, @@ -1155931,7 +1169738,6 @@ 11:u12:2500000, 11:u13:3000000, 11:u14:3500000, -11:u00:1000000, 11:u01:1500000, 11:u02:2000000, 11:u03:2500000, @@ -1158733,19 +1172539,16 @@ 12:u04:antigens, 8:u05:Kinn, 12:u12:antigens, -12:uI2:.,,,.()-, 12:u03:antigens, 10:u08:(CDC)., 8:u04:Kinn, 12:u11:antigens, 10:u14:assay., -12:uI1:.,,,.()-, 12:u02:antigens, 16:u08:Immunization, 8:u03:Kinn, 12:u10:antigens, 10:u13:assay., -12:uI0:.,,,.()-, 12:u01:antigens, 10:u07:(CDC)., 8:u02:Kinn, @@ -1159746,7 +1173549,6 @@ 10:u03:-Wrote, 16:u04:-Contributed, 15:u05:ABBREVIATED, -13:u08:undergone, 18:u00:CONTRIBUTIONS:, 12:u05:SUMMARY:, 12:u10:-carried, @@ -1159766,50 +1173568,42 @@ 10:u01:-Wrote, 16:u02:-Contributed, 15:u03:ABBREVIATED, -13:u07:undergone, 12:u03:SUMMARY:, 16:u10:-contributed, 10:u00:-Wrote, 16:u01:-Contributed, 15:u02:ABBREVIATED, -13:u06:undergone, 17:u07:Findlay-Black, 12:u02:SUMMARY:, 24:u08:competence-regulated, 13:u14:undergone, 16:u00:-Contributed, 15:u01:ABBREVIATED, -13:u05:undergone, 17:u06:Findlay-Black, 12:u01:SUMMARY:, 24:u07:competence-regulated, 13:u13:undergone, 17:u14:findlay-black, 15:u00:ABBREVIATED, -13:u04:undergone, 17:u05:Findlay-Black, 12:u00:SUMMARY:, 24:u06:competence-regulated, 13:u12:undergone, 17:u13:findlay-black, -13:u03:undergone, 17:u04:Findlay-Black, 24:u05:competence-regulated, 13:u11:undergone, 17:u12:findlay-black, -13:u02:undergone, 17:u03:Findlay-Black, 24:u04:competence-regulated, 17:u08:surroundings,, 13:u10:undergone, 17:u11:findlay-black, -13:u01:undergone, 17:u02:Findlay-Black, 24:u03:competence-regulated, 17:u07:surroundings,, 15:u08:Haemophilus, 17:u10:findlay-black, -13:u00:undergone, 17:u01:Findlay-Black, 24:u02:competence-regulated, 17:u06:surroundings,, @@ -1164036,7 +1177830,6 @@ 9:u08:HMG-I, 9:u12:traf2, 7:u13:ggp, -8:u23:TRAF, 9:u03:TRAF2, 7:u04:GGP, 7:u06:PDR, @@ -1165812,7 +1179605,6 @@ 17:u11:svm(svmlight), 8:u12:pikb, 9:u14:5c+2b, -7:u22:PIK, 8:u23:PIKB, 17:u02:SVM(SVMlight), 8:u03:PIKB, @@ -1166127,7 +1179919,6 @@ 9:u10:49.75, 9:u12:55.75, 9:u14:54.48, -8:u23:55.7, 9:u01:49.75, 9:u03:55.75, 9:u05:54.48, @@ -1167283,7 +1181074,6 @@ 19:u10:marie-catherine, 13:u00:ceedings., 19:u01:Marie-Catherine, -13:u08:overview., 10:u03:Parses, 12:u08:Roberts., 19:u00:Marie-Catherine, @@ -1167291,27 +1181081,23 @@ 10:u02:Parses, 12:u07:Roberts., 10:u06:Phoebe, -13:u07:overview., 11:u08:Lynette, 10:u01:Parses, 12:u06:Roberts., 10:u14:phoebe, 10:u05:Phoebe, -13:u06:overview., 11:u08:lencia,, 10:u00:Parses, 12:u05:Roberts., 14:u08:Hirschman,, 10:u13:phoebe, 10:u04:Phoebe, -13:u05:overview., 11:u07:Lynette, 12:u04:Roberts., 14:u07:Hirschman,, 10:u12:phoebe, 8:u23:Phoe, 10:u03:Phoebe, -13:u04:overview., 11:u06:Lynette, 11:u07:lencia,, 12:u03:Roberts., @@ -1167319,7 +1181105,6 @@ 10:u11:phoebe, 11:u14:lynette, 10:u02:Phoebe, -13:u03:overview., 11:u05:Lynette, 11:u06:lencia,, 13:u08:Yoshinobu, @@ -1167330,7 +1181115,6 @@ 11:u13:lynette, 11:u14:lencia,, 10:u01:Phoebe, -13:u02:overview., 11:u04:Lynette, 11:u05:lencia,, 8:u08:hon,, @@ -1167341,7 +1181125,6 @@ 11:u13:lencia,, 8:u23:Lyne, 10:u00:Phoebe, -13:u01:overview., 11:u03:Lynette, 11:u04:lencia,, 13:u07:Yoshinobu, @@ -1167350,7 +1181133,6 @@ 12:u06:Nacional, 11:u11:lynette, 11:u12:lencia,, -13:u00:overview., 11:u02:Lynette, 11:u03:lencia,, 13:u06:Yoshinobu, @@ -1167797,24 +1181579,19 @@ 13:u06:accepting, 15:u08:fullerenes., 16:u10:termolecular, -13:u14:accepting, 15:u00:encapsulate, 16:u01:termolecular, 13:u05:accepting, 15:u07:fullerenes., -13:u13:accepting, 16:u00:termolecular, 13:u04:accepting, 15:u06:fullerenes., -13:u12:accepting, 13:u03:accepting, 15:u05:fullerenes., 12:u08:adaption, -13:u11:accepting, 13:u02:accepting, 15:u04:fullerenes., 12:u07:adaption, -13:u10:accepting, 13:u01:accepting, 15:u03:fullerenes., 12:u06:adaption, @@ -1168028,7 +1181805,6 @@ 10:u04:C-H/π, 10:u12:c-h/π, 11:u13:strands, -7:u22:C-H, 8:u23:C-H/, 10:uI1:-/-()., 10:u03:C-H/π, @@ -1168460,7 +1182236,6 @@ 11:u06:(0.7103, 7:u12:axs, 10:u14:mokα,, -6:u21:AX, 7:u22:AXS, 7:u23:AXS, 9:u00:2.472, @@ -1174385,7 +1188160,6 @@ 6:u03:vi, 12:u04:Seedling, 10:u13:16,656, -8:u23:Seed, 6:u02:vi, 12:u03:Seedling, 7:u07:vii, @@ -1174477,7 +1188251,6 @@ 11:u13:zenodo., 11:u04:Zenodo., 11:u12:zenodo., -8:u23:Zeno, 11:u03:Zenodo., 11:u11:zenodo., 11:u02:Zenodo., @@ -1174884,7 +1188657,6 @@ 11:u08:Removed, 7:u06:FG,, 8:u14:fgb,, -6:u21:XC, 6:u22:XC, 6:u23:XC, 6:u03:XC, @@ -1176576,46 +1190348,37 @@ 9:uI0:-,.)., 11:uI1:(,-,),,, 12:u05:surveys;, -10:u08:clonal, 12:u13:surveys;, 11:uI0:(,-,),,, 12:u04:surveys;, 18:u08:identifiable),, -10:u07:clonal, 12:u12:surveys;, 12:u03:surveys;, -10:u06:clonal, 12:u11:surveys;, 12:u02:surveys;, 18:u07:identifiable),, -10:u05:clonal, 10:u08:(vii):, 12:u10:surveys;, 12:u01:surveys;, 18:u06:identifiable),, -10:u04:clonal, 10:u07:(vii):, 18:u14:identifiable),, 12:u00:surveys;, 18:u05:identifiable),, -10:u03:clonal, 10:u06:(vii):, 18:u13:identifiable),, 12:uI2:),/(.,)., 18:u04:identifiable),, -10:u02:clonal, 10:u05:(vii):, 18:u12:identifiable),, 10:u14:fluxes, 12:uI1:),/(.,)., 18:u03:identifiable),, -10:u01:clonal, 10:u04:(vii):, 18:u11:identifiable),, 10:u13:fluxes, 12:uI0:),/(.,)., 18:u02:identifiable),, -10:u00:clonal, 10:u03:(vii):, 18:u10:identifiable),, 10:u12:fluxes, @@ -1180054,7 +1193817,6 @@ 10:u04:Tajiri, 24:u05:Conflict-of-interest, 16:u07:Open-Access:, -14:u08:reviewers., 12:u01:Shimizu,, 10:u02:Toyama, 10:u12:tajiri, @@ -1180071,7 +1193833,6 @@ 10:u02:Tajiri, 24:u03:Conflict-of-interest, 16:u05:Open-Access:, -14:u07:reviewers., 10:u00:Toyama, 10:u10:tajiri, 24:u11:conflict-of-interest, @@ -1180079,43 +1193840,31 @@ 10:u01:Tajiri, 24:u02:Conflict-of-interest, 16:u04:Open-Access:, -14:u06:reviewers., 14:u02:statement:, 24:u10:conflict-of-interest, 16:u12:open-access:, -14:u14:reviewers., 10:u00:Tajiri, 24:u01:Conflict-of-interest, 16:u03:Open-Access:, -14:u05:reviewers., 14:u01:statement:, 21:u08:non-commercially,, 16:u11:open-access:, -14:u13:reviewers., 24:u00:Conflict-of-interest, 16:u02:Open-Access:, -14:u04:reviewers., 14:u00:statement:, 21:u07:non-commercially,, 16:u10:open-access:, -14:u12:reviewers., 9:uI2:(-.),, 16:u01:Open-Access:, -14:u03:reviewers., 23:u08:licenses/by-nc/4.0/, 21:u06:non-commercially,, -14:u11:reviewers., 9:uI1:(-.),, 16:u00:Open-Access:, -14:u02:reviewers., 21:u05:non-commercially,, -14:u10:reviewers., 9:uI0:(-.),, -14:u01:reviewers., 23:u07:licenses/by-nc/4.0/, 21:u04:non-commercially,, 11:u08:source:, -14:u00:reviewers., 23:u06:licenses/by-nc/4.0/, 21:u03:non-commercially,, 11:u07:source:, @@ -1181432,7 +1195181,6 @@ 7:u06:LPC, 13:u13:histamine, 7:u14:lpc, -8:u23:Bile, 13:u01:Substance, 13:u04:Histamine, 7:u05:LPC, @@ -1184094,7 +1197842,6 @@ 10:u01:Sakata, 14:u11:dermatitis, 12:u12:18754035, -8:u23:1875, 14:u02:dermatitis, 12:u03:18754035, 8:u06:3424, @@ -1187345,8 +1201092,6 @@ 13:u01:Flk-1/KDR, 18:u02:antiapoptosis,, 8:u12:vegf, -7:u22:VEG, -8:u23:VEGF, 13:u00:Flk-1/KDR, 18:u01:antiapoptosis,, 8:u11:vegf, @@ -1194985,7 +1208730,6 @@ 10:u02:Lecerf, 10:u10:lecerf, 10:u12:ledger, -7:u22:Led, 8:u23:Ledg, 18:uI1:..,..,..,...(), 10:u01:Lecerf, @@ -1198469,7 +1212213,6 @@ 44:u10:org/10.1146/annurev-vision-082114-035518, 34:u12:annurev.neuro.30.051606.094238, 22:uI0:.,..,...,-,://././, -16:uI2:.,..,,..,..., 44:u01:org/10.1146/annurev-vision-082114-035518, 34:u03:annurev.neuro.30.051606.094238, 13:u00:Duchaine,, @@ -1198477,14 +1212220,12 @@ 10:u04:Haxby,, 11:u05:223-233, 34:u11:annurev.neuro.30.051606.094238, -16:uI1:.,..,,..,..., 44:u00:org/10.1146/annurev-vision-082114-035518, 34:u02:annurev.neuro.30.051606.094238, 9:u01:Tsao,, 10:u03:Haxby,, 11:u04:223-233, 34:u10:annurev.neuro.30.051606.094238, -16:uI0:.,..,,..,..., 34:u01:annurev.neuro.30.051606.094238, 9:u00:Tsao,, 10:u02:Haxby,, @@ -1199033,7 +1212774,6 @@ 20:u01:Neuropsychologia, 14:u03:1914-1924,, 42:u05:doi.org/10.1523/JNEUROSCI.3493-16.2017, -7:u08:70,, 10:u00:Parra,, 45:u03:https://doi.org/10.3758/s13414-013-0541-y, 15:u04:Schneegans,, @@ -1199056,7 +1212796,6 @@ 14:uI1:././.-.()., 14:u01:1914-1924,, 42:u03:doi.org/10.1523/JNEUROSCI.3493-16.2017, -7:u07:70,, 20:u08:tics.2017.11.007, 45:u01:https://doi.org/10.3758/s13414-013-0541-y, 15:u02:Schneegans,, @@ -1199067,7 +1212806,6 @@ 23:uI2:.,-,://././.-...()., 14:u00:1914-1924,, 42:u02:doi.org/10.1523/JNEUROSCI.3493-16.2017, -7:u06:70,, 45:u00:https://doi.org/10.3758/s13414-013-0541-y, 15:u01:Schneegans,, 12:u03:Alvarez,, @@ -1199076,7 +1212814,6 @@ 7:u14:70,, 23:uI1:.,-,://././.-...()., 42:u01:doi.org/10.1523/JNEUROSCI.3493-16.2017, -7:u05:70,, 20:u07:tics.2017.11.007, 33:u08:org/10.1080/02699930903485076, 15:u00:Schneegans,, @@ -1199087,7 +1212824,6 @@ 23:uI0:.,-,://././.-...()., 20:uI2:,-,://././...()., 42:u00:doi.org/10.1523/JNEUROSCI.3493-16.2017, -7:u04:70,, 20:u06:tics.2017.11.007, 12:u01:Alvarez,, 14:u04:1581-1591,, @@ -1199097,7 +1212833,6 @@ 7:u23:70,, 20:uI1:,-,://././...()., 23:uI2:.,..,..?,-,://././., -7:u03:70,, 20:u05:tics.2017.11.007, 33:u07:org/10.1080/02699930903485076, 12:u00:Alvarez,, @@ -1199108,7 +1212843,6 @@ 20:u13:tics.2017.11.007, 20:uI0:,-,://././...()., 23:uI1:.,..,..?,-,://././., -7:u02:70,, 20:u04:tics.2017.11.007, 33:u06:org/10.1080/02699930903485076, 14:u02:1581-1591,, @@ -1199119,7 +1212853,6 @@ 33:u14:org/10.1080/02699930903485076, 23:uI0:.,..,..?,-,://././., 16:uI2:.,...,-,://., -7:u01:70,, 20:u03:tics.2017.11.007, 33:u05:org/10.1080/02699930903485076, 14:u01:1581-1591,, @@ -1199129,7 +1212862,6 @@ 20:u11:tics.2017.11.007, 33:u13:org/10.1080/02699930903485076, 16:uI1:.,...,-,://., -7:u00:70,, 20:u02:tics.2017.11.007, 33:u04:org/10.1080/02699930903485076, 14:u00:1581-1591,, @@ -1202397,17 +1216129,12 @@ 17:u01:α-1,4-linked, 24:u01:D-(+)-glucopyranosyl, 7:u06:BCD, -12:u14:removal., 17:u00:α-1,4-linked, 24:u00:D-(+)-glucopyranosyl, 7:u05:BCD, -12:u13:removal., 7:u04:BCD, -12:u12:removal., 7:u03:BCD, -12:u11:removal., 7:u02:BCD, -12:u10:removal., 7:u01:BCD, 7:u00:BCD, 12:u08:flavors,, @@ -1203213,7 +1216940,6 @@ 14:u05:"Copyright, 9:u12:cnter, 23:u14:[n,d]=size(tnspec);, -7:u22:CNT, 8:u23:CNTE, 9:u03:CNTER, 23:u05:[N,D]=size(TNSPEC);, @@ -1205587,26 +1219313,21 @@ 12:u03:reactant, 13:u10:cavitands, 17:u12:cyclodextrins, -12:u14:hydroxyl, 13:u01:cavitands, 17:u03:Cyclodextrins, 12:u05:hydroxyl, 12:u02:reactant, 17:u11:cyclodextrins, -12:u13:hydroxyl, 13:u00:cavitands, 17:u02:Cyclodextrins, 12:u04:hydroxyl, 12:u01:reactant, 17:u10:cyclodextrins, -12:u12:hydroxyl, 17:u01:Cyclodextrins, 12:u03:hydroxyl, 12:u00:reactant, -12:u11:hydroxyl, 17:u00:Cyclodextrins, 12:u02:hydroxyl, -12:u10:hydroxyl, 11:uI2:.,,---., 12:u01:hydroxyl, 9:u08:17832, @@ -1214821,17 +1228542,14 @@ 14:uI0:......,.//, 7:u06:CH., 8:u07:-CH0, -12:uI2:.'(,---), 7:u05:CH., 8:u06:-CH0, 8:u14:-ch0, -12:uI1:.'(,---), 7:u04:CH., 8:u05:-CH0, 8:u13:-ch0, 7:u22:CH., 7:u23:CH., -12:uI0:.'(,---), 7:u03:CH., 8:u04:-CH0, 8:u08:-2,1, @@ -1216770,7 +1230488,6 @@ 11:u00:n'avoir, 13:u02:Acétone., 15:u06:l'acétone,, -7:u08:C-H, 21:u03:propionaldéhyde., 13:u04:n-propyle, 14:u07:impliquant, @@ -1216785,7 +1230502,6 @@ 8:uI2:','', 13:u00:Acétone., 15:u04:l'acétone,, -7:u07:C-H, 21:u01:propionaldéhyde., 13:u02:n-propyle, 14:u05:impliquant, @@ -1216793,51 +1230509,38 @@ 11:u14:premier, 8:uI1:','', 15:u03:l'acétone,, -7:u06:C-H, 7:u08:R'O, 21:u00:propionaldéhyde., 13:u01:n-propyle, 14:u04:impliquant, 15:u11:l'acétone,, 11:u13:premier, -7:u14:c-h, 8:uI0:','', 15:u02:l'acétone,, -7:u05:C-H, 13:u00:n-propyle, 14:u03:impliquant, 15:u10:l'acétone,, 11:u12:premier, -7:u13:c-h, 10:uI2:-,(.),, 15:u01:l'acétone,, -7:u04:C-H, 7:u07:R'O, 14:u02:impliquant, 11:u11:premier, -7:u12:c-h, -7:u23:C-H, 10:uI1:-,(.),, 15:u00:l'acétone,, -7:u03:C-H, 7:u06:R'O, 14:u01:impliquant, 11:u10:premier, -7:u11:c-h, 7:u14:r'o, 10:uI0:-,(.),, -7:u02:C-H, 7:u05:R'O, 14:u00:impliquant, -7:u10:c-h, 7:u13:r'o, 8:uI2:':--, -7:u01:C-H, 7:u04:R'O, 7:u12:r'o, 7:u23:R'O, 8:uI1:':--, -7:u00:C-H, 7:u03:R'O, 7:u11:r'o, 8:uI0:':--, @@ -1219262,7 +1232965,6 @@ 11:u10:benson., 10:u12:flame,, 7:u14:33,, -8:u23:Flam, 14:uI0:...,...'.., 11:u01:BENSON., 10:u03:Flame,, @@ -1222552,7 +1236254,6 @@ 26:u08:doi:10.1038/ncomms5723, 15:u11:ito-ishida,, 27:u12:somatostatin-expressing, -8:u23:Soma, 21:uI0:-,.,,.,,.,,..,..-, 31:u00:doi:10.1073/pnas.1506499112, 15:u02:Ito-Ishida,, @@ -1222846,25 +1236547,20 @@ 21:u03:7006.2010.01611.x, 19:u10:htert-inhibited, 21:u11:7006.2010.01611.x, -12:u14:squamous, 19:u01:hTERT-inhibited, 21:u02:7006.2010.01611.x, 21:u10:7006.2010.01611.x, -12:u13:squamous, 11:uI2:.,-,:./, 19:u00:hTERT-inhibited, 21:u01:7006.2010.01611.x, 12:u08:197-204,, -12:u12:squamous, 11:uI1:.,-,:./, 21:u00:7006.2010.01611.x, 14:u08:Osterwald,, 12:u07:197-204,, -12:u11:squamous, 11:uI0:.,-,:./, 13:u08:telomeres, 12:u06:197-204,, -12:u10:squamous, 14:u07:Osterwald,, 26:u08:doi:10.1242/jcs.148296, 12:u05:197-204,, @@ -1226664,31 +1240360,25 @@ 11:u08:Paired:, 7:u00:Mux, 8:u08:Mux:, -9:u08:Check, 11:u07:Paired:, -9:u07:Check, 11:u06:Paired:, 8:u07:Mux:, 10:u08:F/R/IO, -9:u06:Check, 11:u14:paired:, 11:u05:Paired:, 8:u06:Mux:, -9:u05:Check, 11:u13:paired:, 8:u14:mux:, 8:uI2::,/-, 11:u04:Paired:, 8:u05:Mux:, 10:u07:F/R/IO, -9:u04:Check, 11:u12:paired:, 8:u13:mux:, 8:uI1::,/-, 11:u03:Paired:, 8:u04:Mux:, 10:u06:F/R/IO, -9:u03:Check, 11:u11:paired:, 8:u12:mux:, 10:u14:f/r/io, @@ -1226697,7 +1240387,6 @@ 11:u02:Paired:, 8:u03:Mux:, 10:u05:F/R/IO, -9:u02:Check, 7:u08:mux, 11:u10:paired:, 8:u11:mux:, @@ -1226705,7 +1240394,6 @@ 11:u01:Paired:, 8:u02:Mux:, 10:u04:F/R/IO, -9:u01:Check, 7:u07:mux, 8:u10:mux:, 10:u12:f/r/io, @@ -1226714,7 +1240402,6 @@ 11:u00:Paired:, 8:u01:Mux:, 10:u03:F/R/IO, -9:u00:Check, 7:u06:mux, 10:u11:f/r/io, 8:u00:Mux:, @@ -1234962,7 +1248649,6 @@ 7:u22:FR3, 8:u23:FR32, 19:uI0::,,,,;.://.////, -14:uI2:.,,,,,,.,-, 11:u01:Malaria, 14:u03:FR321.pdf., 47:u06:https://doi.org/10.1183/13993003.00182-2017, @@ -1234972,7 +1248658,6 @@ 8:u10:usa:, 14:u11:fr321.pdf., 47:u14:https://doi.org/10.1183/13993003.00182-2017, -14:uI1:.,,,,,,.,-, 11:u00:Malaria, 14:u02:FR321.pdf., 47:u05:https://doi.org/10.1183/13993003.00182-2017, @@ -1234980,7 +1248665,6 @@ 12:u06:Shimwela, 14:u10:fr321.pdf., 47:u13:https://doi.org/10.1183/13993003.00182-2017, -14:uI0:.,,,,,,.,-, 14:uI2:://././.-:, 14:u01:FR321.pdf., 47:u04:https://doi.org/10.1183/13993003.00182-2017, @@ -1237070,42 +1250754,33 @@ 10:u00:ABHD12, 11:u05:Colec12, 13:u08:dismutase, -8:u08:NCF1, 11:u13:colec12, 11:u04:Colec12, -8:u07:NCF1, 11:u12:colec12, 11:u03:Colec12, 13:u07:dismutase, -8:u06:NCF1, 11:u11:colec12, 11:u02:Colec12, 13:u06:dismutase, -8:u05:NCF1, 11:u10:colec12, 13:u14:dismutase, 15:uI2:(-),(-),(-), 11:u01:Colec12, 13:u05:dismutase, -8:u04:NCF1, 13:u13:dismutase, 15:uI1:(-),(-),(-), 11:u00:Colec12, 13:u04:dismutase, -8:u03:NCF1, 13:u12:dismutase, 15:uI0:(-),(-),(-), 13:u03:dismutase, -8:u02:NCF1, 16:u08:carbohydrate, 13:u11:dismutase, 13:u02:dismutase, -8:u01:NCF1, 16:u07:carbohydrate, 13:u10:dismutase, 13:u01:dismutase, 32:u08:phosphatidylinositol-binding, -8:u00:NCF1, 16:u06:carbohydrate, 13:u00:dismutase, 16:u05:carbohydrate, @@ -1238745,7 +1252420,6 @@ 14:u12:bootstraps, 9:uI2:-'',,, 14:u03:bootstraps, -13:u08:Cytoscape, 14:u11:bootstraps, 9:uI1:-'',,, 14:u02:bootstraps, @@ -1238754,39 +1252428,31 @@ 14:u10:bootstraps, 9:uI0:-'',,, 14:u01:bootstraps, -13:u07:Cytoscape, 8:u07:v3.3, 14:u00:bootstraps, -13:u06:Cytoscape, 16:u07:Immunonoblot, 8:u06:v3.3, 13:u14:cytoscape, -13:u05:Cytoscape, 16:u06:Immunonoblot, 8:u05:v3.3, 13:u13:cytoscape, 16:u14:immunonoblot, -13:u04:Cytoscape, 16:u05:Immunonoblot, 8:u04:v3.3, 13:u12:cytoscape, 16:u13:immunonoblot, -13:u03:Cytoscape, 16:u04:Immunonoblot, 8:u03:v3.3, 13:u11:cytoscape, 16:u12:immunonoblot, -13:u02:Cytoscape, 16:u03:Immunonoblot, 8:u02:v3.3, 13:u10:cytoscape, 16:u11:immunonoblot, -13:u01:Cytoscape, 16:u02:Immunonoblot, 8:u01:v3.3, 16:u10:immunonoblot, 11:uI2:(/).(/), -13:u00:Cytoscape, 16:u01:Immunonoblot, 8:u00:v3.3, 11:uI1:(/).(/), @@ -1238943,7 +1252609,6 @@ 19:u03:(Perkin-Elmer)., 7:u07:1mM, 13:u12:tube-pull, -7:u22:TUB, 8:u23:TUBE, 13:u03:TUBE-pull, 14:u04:Phagosomes, @@ -1243089,7 +1256754,6 @@ 8:u07:ATP,, 15:u14:byproducts,, 15:u05:byproducts,, -9:u08:fruit, 8:u06:ATP,, 15:u13:byproducts,, 15:u04:byproducts,, @@ -1243097,37 +1256761,29 @@ 15:u12:byproducts,, 8:u23:bypr, 15:u03:byproducts,, -9:u07:fruit, 8:u04:ATP,, 16:u08:prototrophic, 15:u11:byproducts,, 15:u02:byproducts,, -9:u06:fruit, 8:u03:ATP,, 16:u07:prototrophic, 15:u10:byproducts,, 9:u14:fruit, 15:u01:byproducts,, -9:u05:fruit, 8:u02:ATP,, 16:u06:prototrophic, 9:u13:fruit, 15:u00:byproducts,, -9:u04:fruit, 8:u01:ATP,, 16:u05:prototrophic, 9:u12:fruit, -9:u03:fruit, 8:u00:ATP,, 16:u04:prototrophic, 9:u11:fruit, -9:u02:fruit, 16:u03:prototrophic, 9:u10:fruit, -9:u01:fruit, 16:u02:prototrophic, 17:u08:fermentations, -9:u00:fruit, 7:u08:SC), 16:u01:prototrophic, 17:u07:fermentations, @@ -1244291,7 +1257947,6 @@ 17:u08:Supplement")., 9:u04:280C., 11:u07:parsed,, -11:u08:Aerobic, 9:u03:280C., 11:u06:parsed,, 17:u07:Supplement")., @@ -1244299,14 +1257954,12 @@ 11:u14:parsed,, 11:u05:parsed,, 17:u06:Supplement")., -11:u07:Aerobic, 9:u01:280C., 11:u13:parsed,, 17:u14:supplement")., 7:uI2:,(", 11:u04:parsed,, 17:u05:Supplement")., -11:u06:Aerobic, 9:u00:280C., 11:u08:(stored, 11:u12:parsed,, @@ -1244314,30 +1257967,24 @@ 7:uI1:,(", 11:u03:parsed,, 17:u04:Supplement")., -11:u05:Aerobic, 11:u07:(stored, 11:u11:parsed,, 17:u12:supplement")., 7:uI0:,(", 11:u02:parsed,, 17:u03:Supplement")., -11:u04:Aerobic, 11:u06:(stored, 11:u10:parsed,, 17:u11:supplement")., 11:u01:parsed,, 17:u02:Supplement")., -11:u03:Aerobic, 11:u05:(stored, 17:u10:supplement")., 11:u00:parsed,, 17:u01:Supplement")., -11:u02:Aerobic, 11:u04:(stored, 17:u00:Supplement")., -11:u01:Aerobic, 11:u03:(stored, -11:u00:Aerobic, 11:u02:(stored, 8:u14:o.d., 11:u01:(stored, @@ -1251472,8 +1265119,6 @@ 16:u11:19--mutation, 12:u12:oligo#1:, 15:u13:j_01_c2879t, -7:u22:OLI, -8:u23:OLIG, 45:u00:ACGTATACGGCGGAATtTtTGCCGAATGCCGTGTGGACGTA, 16:u02:19--mutation, 12:u03:OLIGO#1:, @@ -1253966,8 +1267611,6 @@ 6:u08:4b, 10:u10:(rest,, 10:u12:tcf12,, -7:u22:TCF, -8:u23:TCF1, 12:uI1:,,,,,,,(, 9:u00:3,705, 10:u01:(REST,, @@ -1254421,23 +1268064,17 @@ 11:u05:H3K4me3, 21:u02:(GRCh37.p13/hg19), 11:u13:h3k4me3, -8:u14:ctcf, 11:u04:H3K4me3, 21:u01:(GRCh37.p13/hg19), 11:u12:h3k4me3, -8:u13:ctcf, 7:u22:H3K, 8:u23:H3K4, 11:u03:H3K4me3, 21:u00:(GRCh37.p13/hg19), 11:u11:h3k4me3, -8:u12:ctcf, -8:u23:CTCF, 11:u02:H3K4me3, 11:u10:h3k4me3, -8:u11:ctcf, 11:u01:H3K4me3, -8:u10:ctcf, 11:u00:H3K4me3, 9:u08:HOMER, 9:u07:HOMER, @@ -1254666,12 +1268303,9 @@ 59:u06:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, 50:u01:https://www.ebi.ac.uk/gwas/docs/file-downloads, 59:u05:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, -16:uI2:(://..///.)., 50:u00:https://www.ebi.ac.uk/gwas/docs/file-downloads, 59:u04:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, -16:uI1:(://..///.)., 59:u03:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, -16:uI0:(://..///.)., 59:u02:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, 30:u08:https://www.r-project.org/, 59:u01:http://archive.broadinstitute.org/mpg/snap/ldsearch.php, @@ -1255081,7 +1268715,6 @@ 9:u03:Yagi,, 18:u12:gata3-mediated, 11:u13:415-420, -8:u23:GATA, 18:u03:GATA3-mediated, 11:u04:415-420, 15:u06:E-cadherin,, @@ -1256814,23 +1270447,16 @@ 7:u23:36%, 6:u07:7%, 7:u11:36%, -7:u14:13%, 6:u06:7%, 7:u10:36%, -7:u13:13%, 6:u14:7%, 6:u05:7%, -7:u12:13%, 6:u13:7%, -7:u22:13%, -7:u23:13%, 6:u04:7%, -7:u11:13%, 6:u12:7%, 6:u22:7%, 6:u23:7%, 6:u03:7%, -7:u10:13%, 6:u11:7%, 6:u02:7%, 6:u10:7%, @@ -1257136,7 +1270762,6 @@ 8:u05:FRA1, 8:u06:MITF, 8:u07:ATF3, -7:u08:JUN, 8:u10:usf1, 8:u11:batf, 9:u12:bach2, @@ -1257162,7 +1270787,6 @@ 8:u04:MITF, 8:u05:ATF3, 9:u06:FOSL2, -7:u07:JUN, 9:u08:BACH1, 9:u10:bach2, 8:u11:fra1, @@ -1257174,7 +1270798,6 @@ 8:u03:MITF, 8:u04:ATF3, 9:u05:FOSL2, -7:u06:JUN, 8:u07:MAFA, 8:u08:NFE2, 8:u10:fra1, @@ -1257186,7 +1270809,6 @@ 8:u02:MITF, 8:u03:ATF3, 9:u04:FOSL2, -7:u05:JUN, 8:u06:MAFA, 9:u07:BACH1, 8:u08:NRF2, @@ -1257198,18 +1270820,15 @@ 8:u01:MITF, 8:u02:ATF3, 9:u03:FOSL2, -7:u04:JUN, 8:u05:MAFA, 9:u06:BACH1, 8:u07:NFE2, 8:u08:SPI1, 9:u11:fosl2, 8:u13:mafa, -7:u23:JUN, 8:u00:MITF, 8:u01:ATF3, 9:u02:FOSL2, -7:u03:JUN, 8:u04:MAFA, 9:u05:BACH1, 8:u06:NFE2, @@ -1257221,7 +1270840,6 @@ 8:u23:MAFA, 8:u00:ATF3, 9:u01:FOSL2, -7:u02:JUN, 8:u03:MAFA, 9:u04:BACH1, 8:u05:NFE2, @@ -1257232,7 +1270850,6 @@ 8:u13:nfe2, 8:u14:nrf2, 9:u00:FOSL2, -7:u01:JUN, 8:u02:MAFA, 9:u03:BACH1, 8:u04:NFE2, @@ -1257244,9 +1270861,6 @@ 8:u12:nfe2, 8:u13:nrf2, 8:u14:spi1, -7:u22:NFE, -8:u23:NFE2, -7:u00:JUN, 8:u01:MAFA, 9:u02:BACH1, 8:u03:NFE2, @@ -1257339,9 +1270953,6 @@ 8:u11:elf5, 10:u12:zbtb33, 7:u13:yy1, -6:u21:ZB, -7:u22:ZBT, -8:u23:ZBTB, 8:u00:RFX2, 8:u01:RFX5, 8:u02:ELF5, @@ -1257429,140 +1271040,65 @@ 10:u02:(RPKM), 10:u01:(RPKM), 10:u00:(RPKM), -8:u08:KLF4, -8:u07:KLF4, 8:u08:FLI1, -8:u06:KLF4, -9:u08:SMAD3, -8:u14:klf4, -8:u05:KLF4, 8:u07:FLI1, -9:u08:TCF12, -8:u13:klf4, -8:u04:KLF4, 8:u06:FLI1, -9:u07:SMAD3, 11:u08:BACH1,2, -8:u12:klf4, 8:u14:fli1, -7:u22:KLF, -8:u23:KLF4, -8:u03:KLF4, 8:u05:FLI1, -9:u06:SMAD3, -9:u07:TCF12, -9:u08:GATA3, -8:u11:klf4, 8:u13:fli1, -9:u14:smad3, -8:u02:KLF4, 8:u04:FLI1, -9:u05:SMAD3, -9:u06:TCF12, 11:u07:BACH1,2, 13:u08:GATA1,2,4, -8:u10:klf4, 8:u12:fli1, -9:u13:smad3, -9:u14:tcf12, 7:u22:FLI, 8:u23:FLI1, -8:u01:KLF4, 8:u03:FLI1, -9:u04:SMAD3, -9:u05:TCF12, 11:u06:BACH1,2, -9:u07:GATA3, 9:u08:SUZ12, 8:u11:fli1, -9:u12:smad3, -9:u13:tcf12, 11:u14:bach1,2, -8:u00:KLF4, 8:u02:FLI1, -9:u03:SMAD3, -9:u04:TCF12, 11:u05:BACH1,2, -9:u06:GATA3, 13:u07:GATA1,2,4, -8:u08:EZH2, 8:u10:fli1, -9:u11:smad3, -9:u12:tcf12, 11:u13:bach1,2, -9:u14:gata3, 8:u01:FLI1, -9:u02:SMAD3, -9:u03:TCF12, 11:u04:BACH1,2, -9:u05:GATA3, 13:u06:GATA1,2,4, 9:u07:SUZ12, -9:u10:smad3, -9:u11:tcf12, 11:u12:bach1,2, -9:u13:gata3, 13:u14:gata1,2,4, 8:u00:FLI1, -9:u01:SMAD3, -9:u02:TCF12, 11:u03:BACH1,2, -9:u04:GATA3, 13:u05:GATA1,2,4, 9:u06:SUZ12, -8:u07:EZH2, -9:u10:tcf12, 11:u11:bach1,2, -9:u12:gata3, 13:u13:gata1,2,4, 9:u14:suz12, -9:u00:SMAD3, -9:u01:TCF12, 11:u02:BACH1,2, -9:u03:GATA3, 13:u04:GATA1,2,4, 9:u05:SUZ12, -8:u06:EZH2, 11:u10:bach1,2, -9:u11:gata3, 13:u12:gata1,2,4, 9:u13:suz12, -8:u14:ezh2, -9:u00:TCF12, 11:u01:BACH1,2, -9:u02:GATA3, 13:u03:GATA1,2,4, 9:u04:SUZ12, -8:u05:EZH2, -9:u10:gata3, 13:u11:gata1,2,4, 9:u12:suz12, -8:u13:ezh2, 8:u23:SUZ1, 11:u00:BACH1,2, -9:u01:GATA3, 13:u02:GATA1,2,4, 9:u03:SUZ12, -8:u04:EZH2, 13:u10:gata1,2,4, 9:u11:suz12, -8:u12:ezh2, -6:u21:EZ, -7:u22:EZH, -8:u23:EZH2, -9:u00:GATA3, 13:u01:GATA1,2,4, 9:u02:SUZ12, -8:u03:EZH2, 9:u10:suz12, -8:u11:ezh2, 13:u00:GATA1,2,4, 9:u01:SUZ12, -8:u02:EZH2, -8:u10:ezh2, 9:u00:SUZ12, -8:u01:EZH2, -8:u00:EZH2, 10:u08:1e-285, 10:u08:1e-110, 10:u07:1e-285, @@ -1259435,21 +1272971,18 @@ 13:u12:λ(bscco), 8:u22:λ(B, 9:u23:λ(BS, -8:uI2::,;,, 13:u01:cuprates., 13:u03:λ(BSCCO), 8:u08:A/K,, 14:u02:BSCCO-2212, 14:u04:reversible, 13:u11:λ(bscco), -8:uI1::,;,, 13:u00:cuprates., 13:u02:λ(BSCCO), 11:u08:crowave, 14:u01:BSCCO-2212, 14:u03:reversible, 13:u10:λ(bscco), -8:uI0::,;,, 13:u01:λ(BSCCO), 8:u07:A/K,, 14:u00:BSCCO-2212, @@ -1260953,32 +1274486,27 @@ 13:u04:invasion., 14:u12:perineural, 12:u13:axillary, -12:u14:invasive, 14:u03:perineural, 12:u04:axillary, 13:u03:invasion., 14:u11:perineural, 12:u12:axillary, -12:u13:invasive, 8:u23:axil, 14:u02:perineural, 12:u03:axillary, 13:u02:invasion., 14:u10:perineural, 12:u11:axillary, -12:u12:invasive, 14:u01:perineural, 12:u02:axillary, 13:u01:invasion., 15:u08:positivity;, 12:u10:axillary, -12:u11:invasive, 14:u00:perineural, 12:u01:axillary, 11:u08:staging, 13:u00:invasion., 15:u07:positivity;, -12:u10:invasive, 12:u00:axillary, 15:u06:positivity;, 11:u07:staging, @@ -1261130,7 +1274658,6 @@ 8:u23:19-4, 9:uI0:(),/(, 8:uI1:-/)., -9:uI2:,.-(), 9:u03:19-40, 15:u07:harvard.edu, 10:u00:roots,, @@ -1261138,14 +1274665,12 @@ 13:u06:Oncology,, 9:u11:19-40, 8:uI0:-/)., -9:uI1:,.-(), 9:u02:19-40, 15:u06:harvard.edu, 11:u02:mg/dL)., 13:u05:Oncology,, 9:u10:19-40, 15:u14:harvard.edu, -9:uI0:,.-(), 19:uI2:,-,,,.,',,,.*:., 9:u01:19-40, 15:u05:harvard.edu, @@ -1261688,19 +1275213,13 @@ 16:u00:liberalizing, 23:u08:Clinicopathological, 23:u07:Clinicopathological, -9:u14:figs., 23:u06:Clinicopathological, -9:u13:figs., 23:u05:Clinicopathological, 11:u08:record:, -9:u12:figs., -8:u23:Figs, 23:u04:Clinicopathological, 11:u07:record:, -9:u11:figs., 23:u03:Clinicopathological, 11:u06:record:, -9:u10:figs., 23:u02:Clinicopathological, 11:u05:record:, 11:u08:Kesari,, @@ -1262139,7 +1275658,6 @@ 10:u13:tosis., 8:u02:(>15, 10:u04:tosis., -9:u08:BRCA1, 11:u02:months), 14:u04:Oncologist, 11:u05:Dhruva,, @@ -1262155,7 +1275673,6 @@ 10:u11:tosis., 8:u00:(>15, 10:u02:tosis., -9:u07:BRCA1, 11:u00:months), 14:u02:Oncologist, 11:u03:Dhruva,, @@ -1262163,55 +1275680,43 @@ 8:u08:376,, 10:u10:tosis., 10:u01:tosis., -9:u06:BRCA1, 14:u01:Oncologist, 11:u02:Dhruva,, 9:u05:Tutt,, 8:u07:376,, 12:u08:Kaufman,, -9:u14:brca1, 11:uI2:.,..(-), 10:u00:tosis., -9:u05:BRCA1, 14:u00:Oncologist, 11:u01:Dhruva,, 9:u04:Tutt,, 8:u06:376,, 12:u07:Kaufman,, -9:u13:brca1, 10:u14:lancet, 11:uI1:.,..(-), -9:u04:BRCA1, 11:u00:Dhruva,, 9:u03:Tutt,, 8:u05:376,, 12:u06:Kaufman,, 14:u08:Karginova,, -9:u12:brca1, 10:u13:lancet, 11:uI0:.,..(-), -9:u03:BRCA1, 9:u02:Tutt,, 8:u04:376,, 12:u05:Kaufman,, 14:u07:Karginova,, -9:u11:brca1, 10:u12:lancet, -9:u02:BRCA1, 9:u01:Tutt,, 8:u03:376,, 12:u04:Kaufman,, 14:u06:Karginova,, -9:u10:brca1, 10:u11:lancet, -9:u01:BRCA1, 9:u00:Tutt,, 8:u02:376,, 12:u03:Kaufman,, 14:u05:Karginova,, 15:u08:Montagnoli,, 10:u10:lancet, -9:u00:BRCA1, 8:u01:376,, 12:u02:Kaufman,, 14:u04:Karginova,, @@ -1262721,48 +1276226,33 @@ 15:u01:(neuregulin, 8:u00:NRG1, 10:u07:10-25%, -9:u08:FGFR1, 15:u00:(neuregulin, 10:u06:10-25%, 15:u08:(Fibroblast, 10:u14:10-25%, 10:u05:10-25%, -9:u07:FGFR1, 15:u07:(Fibroblast, 10:u13:10-25%, 9:uI2:-,[,-, 10:u04:10-25%, -9:u06:FGFR1, 15:u06:(Fibroblast, 10:u12:10-25%, -9:u14:fgfr1, 9:uI1:-,[,-, 10:u03:10-25%, -9:u05:FGFR1, 15:u05:(Fibroblast, 10:u11:10-25%, -9:u13:fgfr1, 9:uI0:-,[,-, 10:u02:10-25%, -9:u04:FGFR1, 15:u04:(Fibroblast, 10:u10:10-25%, -9:u12:fgfr1, -8:u23:FGFR, 10:u01:10-25%, -9:u03:FGFR1, 15:u03:(Fibroblast, -9:u11:fgfr1, 10:u00:10-25%, -9:u02:FGFR1, 15:u02:(Fibroblast, 21:u08:[11,13-15,17,18]., -9:u10:fgfr1, -9:u01:FGFR1, 15:u08:sub-regions, 15:u01:(Fibroblast, 21:u07:[11,13-15,17,18]., -9:u00:FGFR1, 15:u00:(Fibroblast, 21:u06:[11,13-15,17,18]., 15:u07:sub-regions, @@ -1263585,7 +1277075,6 @@ 12:u11:alpha-2), 8:u12:xpo7, 12:u13:oplasmin, -7:u22:XPO, 8:u23:XPO7, 16:uI0:-)(.),()(.),, 13:uI1:()(.),(/-, @@ -1265474,8 +1278963,6 @@ 13:u04:ARHGEF10., 9:u01:loss;, 13:u12:arhgef10., -7:u22:ARH, -8:u23:ARHG, 13:u03:ARHGEF10., 9:u00:loss;, 13:u11:arhgef10., @@ -1265613,8 +1279100,6 @@ 9:u12:csmd1, 11:u13:c8orf42, 8:u14:cln8, -7:u22:CSM, -8:u23:CSMD, 10:u00:ERICH1, 9:u01:MYOM2, 11:u02:KBTBD11, @@ -1275158,7 +1288643,6 @@ 13:u13:1,117,954, 13:u04:1,117,954, 13:u12:1,117,954, -8:u23:1,11, 13:u03:1,117,954, 13:u08:1,490,686, 13:u11:1,117,954, @@ -1292452,32 +1305936,18 @@ 16:u10:plerocercoid, 16:u01:plerocercoid, 16:u00:plerocercoid, -9:u08:many), 15:u08:structions., -9:u07:many), -9:u06:many), 15:u07:structions., -9:u14:many), -9:u05:many), 15:u06:structions., -9:u13:many), 15:u14:structions., -9:u04:many), 15:u05:structions., -9:u12:many), 15:u13:structions., -9:u03:many), 15:u04:structions., -9:u11:many), 15:u12:structions., -9:u02:many), 15:u03:structions., -9:u10:many), 15:u11:structions., -9:u01:many), 15:u02:structions., 15:u10:structions., -9:u00:many), 15:u01:structions., 15:u00:structions., 10:u08:Kawsar, @@ -1293558,30 +1307028,21 @@ 11:u12:cestoda, 8:u23:Cest, 11:u03:Cestoda, -16:u08:transitional, 11:u11:cestoda, 11:u02:Cestoda, 11:u10:cestoda, 11:u01:Cestoda, -16:u07:transitional, 11:u00:Cestoda, -16:u06:transitional, 16:u14:transitional, -16:u05:transitional, 16:u13:transitional, -16:u04:transitional, 12:u08:morphism, 16:u12:transitional, -16:u03:transitional, 16:u11:transitional, -16:u02:transitional, 12:u07:morphism, 16:u10:transitional, -16:u01:transitional, 12:u06:morphism, 8:u08:row,, 12:u14:morphism, -16:u00:transitional, 12:u05:morphism, 8:u07:row,, 8:u08:carp, @@ -1293788,47 +1307249,38 @@ 7:u14:luo, 13:u07:(Cestoda:, 7:u13:luo, -9:u08:Chubb, 13:u06:(Cestoda:, 7:u12:luo, 7:u23:Luo, 13:u05:(Cestoda:, 7:u11:luo, 8:uI2:(:)?, -9:u07:Chubb, 13:u04:(Cestoda:, 7:u10:luo, 8:uI1:(:)?, -9:u06:Chubb, 13:u03:(Cestoda:, 9:u14:chubb, 8:uI0:(:)?, -9:u05:Chubb, 13:u02:(Cestoda:, 15:u08:31:517-543., 9:u13:chubb, -9:u04:Chubb, 10:u08:Jalali, 13:u01:(Cestoda:, 15:u07:31:517-543., 9:u12:chubb, 8:u23:Chub, -9:u03:Chubb, 9:u08:Lake., 13:u00:(Cestoda:, 15:u06:31:517-543., 9:u11:chubb, -9:u02:Chubb, 10:u07:Jalali, 15:u05:31:517-543., 9:u10:chubb, -9:u01:Chubb, 10:u06:Jalali, 9:u07:Lake., 17:u08:Hajirostamloo, 15:u04:31:517-543., 10:u14:jalali, -9:u00:Chubb, 10:u05:Jalali, 9:u06:Lake., 15:u03:31:517-543., @@ -1294834,7 +1308286,6 @@ 13:u06:THRESHOLD, 13:u05:THRESHOLD, 13:u04:THRESHOLD, -7:u22:THR, 8:u23:THRE, 13:u03:THRESHOLD, 20:u08:precision/recall, @@ -1295125,16 +1308576,13 @@ 59:u14:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 59:u05:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 59:u13:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., -14:uI2:://..///.., 59:u04:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 14:u08:Brockwell,, 59:u12:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 11:u14:brazma,, -14:uI1:://..///.., 59:u03:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 59:u11:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 11:u13:brazma,, -14:uI0:://..///.., 59:u02:http://paul.rutgers.edu/~gweiss/thesis/timeweaver.html., 14:u07:Brockwell,, 16:u08:Forecasting., @@ -1295264,7 +1308712,6 @@ 12:uI1:,.,,..:-, 11:u02:Mining,, 11:u03:Murata,, -10:u08:Mateo,, 12:u02:210-215,, 11:u11:murata,, 12:uI0:,.,,..:-, @@ -1295276,18 +1308723,15 @@ 11:u10:murata,, 11:u00:Mining,, 11:u01:Murata,, -10:u07:Mateo,, 12:u00:210-215,, 7:u07:CA:, 11:u00:Murata,, -10:u06:Mateo,, 17:u07:Sasisekharan,, 11:u08:Expert,, 7:u06:CA:, 15:u08:forecasting, 10:u14:mateo,, 11:uI2:,....:., -10:u05:Mateo,, 17:u06:Sasisekharan,, 7:u05:CA:, 15:u07:forecasting, @@ -1295295,7 +1308739,6 @@ 10:u13:mateo,, 17:u14:sasisekharan,, 11:uI1:,....:., -10:u04:Mateo,, 17:u05:Sasisekharan,, 11:u07:Expert,, 7:u04:CA:, @@ -1295304,7 +1308747,6 @@ 10:u12:mateo,, 17:u13:sasisekharan,, 11:uI0:,....:., -10:u03:Mateo,, 17:u04:Sasisekharan,, 11:u06:Expert,, 7:u03:CA:, @@ -1295314,7 +1308756,6 @@ 17:u12:sasisekharan,, 11:u14:expert,, 8:u23:Sasi, -10:u02:Mateo,, 17:u03:Sasisekharan,, 11:u05:Expert,, 7:u02:CA:, @@ -1295324,7 +1308765,6 @@ 17:u11:sasisekharan,, 11:u13:expert,, 10:u14:weiss,, -10:u01:Mateo,, 17:u02:Sasisekharan,, 11:u04:Expert,, 7:u01:CA:, @@ -1295333,7 +1308773,6 @@ 17:u10:sasisekharan,, 11:u12:expert,, 10:u13:weiss,, -10:u00:Mateo,, 17:u01:Sasisekharan,, 11:u03:Expert,, 7:u00:CA:, @@ -1299833,7 +1313272,6 @@ 16:u11:431x20143754, 51:u13:https://doi.org/10.1152/japplphysiol.00706.2007, 15:uI1:.,...-:?,-,, -16:uI2:://././..()., 16:u02:431x20143754, 51:u04:https://doi.org/10.1152/japplphysiol.00706.2007, 15:u07:R1321-R1329, @@ -1299842,7 +1313280,6 @@ 16:u10:431x20143754, 51:u12:https://doi.org/10.1152/japplphysiol.00706.2007, 15:uI0:.,...-:?,-,, -16:uI1:://././..()., 19:uI2:.,.,,.,,..,,.,., 16:u01:431x20143754, 51:u03:https://doi.org/10.1152/japplphysiol.00706.2007, @@ -1299852,7 +1313289,6 @@ 10:u07:Arida,, 51:u11:https://doi.org/10.1152/japplphysiol.00706.2007, 15:u14:r1321-r1329, -16:uI0:://././..()., 19:uI1:.,.,,.,,..,,.,., 16:u00:431x20143754, 51:u02:https://doi.org/10.1152/japplphysiol.00706.2007, @@ -1302356,18 +1315792,9 @@ 6:u23:cr, 8:u01:H(z), 8:u00:H(z), -7:u08:med, -7:u07:med, -7:u06:med, -7:u05:med, -7:u04:med, 9:u08:0.753, -7:u03:med, -7:u02:med, 9:u07:0.753, -7:u01:med, 9:u06:0.753, -7:u00:med, 9:u14:0.753, 9:u05:0.753, 9:u13:0.753, @@ -1304638,7 +1318065,6 @@ 14:u05:antiporter, 12:u12:slc37a3,, 14:u13:antiporter, -8:u23:SLC3, 12:u03:SLC37A3,, 14:u04:antiporter, 11:u08:SLC37A3, @@ -1306603,7 +1320029,6 @@ 18:u12:rplp1_reverse:, 27:u13:tcagactcctcggattcttcttt, 25:u14:human_atraid_forward:, -8:u23:RPLP, 24:u00:human_RPLP1_forward:, 25:u01:AGCCTCATCTGCAATGTAGGG, 10:u02:human_, @@ -1307053,48 +1320478,39 @@ 15:u11:slowfade™, 15:u02:SlowFade™, 24:u00:Alexa-647-conjugated, -9:u08:100×, 15:u10:slowfade™, 15:u01:SlowFade™, 12:u07:Plan-APO, -9:u07:100×, 13:u08:splitter,, 15:u00:SlowFade™, 12:u06:Plan-APO, -9:u06:100×, 13:u07:splitter,, 12:u14:plan-apo, 12:u05:Plan-APO, -9:u05:100×, 13:u06:splitter,, 12:u13:plan-apo, 10:uI2:-(.)-,, 12:u04:Plan-APO, -9:u04:100×, 13:u05:splitter,, 12:u12:plan-apo, 10:uI1:-(.)-,, 12:u03:Plan-APO, -9:u03:100×, 13:u04:splitter,, 9:u08:(EW),, 12:u11:plan-apo, 10:uI0:-(.)-,, 12:u02:Plan-APO, 12:u08:channel,, -9:u02:100×, 13:u03:splitter,, 9:u07:(EW),, 12:u10:plan-apo, 11:uI2:.-///--, 12:u01:Plan-APO, -9:u01:100×, 13:u02:splitter,, 9:u06:(EW),, 11:uI1:.-///--, 12:u00:Plan-APO, 12:u07:channel,, -9:u00:100×, 13:u01:splitter,, 9:u05:(EW),, 7:u08:ExF, @@ -1308674,15 +1322090,12 @@ 14:u06:lysosomes,, 15:u14:precipitate, 14:uI0:.:.:.:.(-), -12:uI2:(),()()-, 15:u05:precipitate, 14:u05:lysosomes,, 15:u13:precipitate, -12:uI1:(),()()-, 15:u04:precipitate, 14:u04:lysosomes,, 15:u12:precipitate, -12:uI0:(),()()-, 15:u03:precipitate, 14:u03:lysosomes,, 15:u11:precipitate, @@ -1315341,7 +1328754,6 @@ 11:u02:(1µM),, 10:u03:MRGPRD, 9:u12:htr1f, -7:u22:HTR, 8:u23:HTR1, 17:uI0:,()(),,()(.),, 18:uI1:,()-(),()(,),., @@ -1315952,7 +1329364,6 @@ 13:u01:co-speech, 9:u10:aims:, 10:u12:(nhp)., -7:u22:(NH, 8:u23:(NHP, 9:u01:Aims:, 10:u03:(NHP)., @@ -1321551,20 +1334962,11 @@ 11:u03:In-situ, 9:u03:(LCIS, 11:u02:In-situ, -12:u08:Invasive, 9:u02:(LCIS, 11:u01:In-situ, 9:u01:(LCIS, 11:u00:In-situ, -12:u07:Invasive, 9:u00:(LCIS, -12:u06:Invasive, -12:u05:Invasive, -12:u04:Invasive, -12:u03:Invasive, -12:u02:Invasive, -12:u01:Invasive, -12:u00:Invasive, 8:u08:54.2, 8:u07:54.2, 8:u06:54.2, @@ -1323523,7 +1336925,6 @@ 17:u06:neuroinvasion, 17:u08:Corroborating, 8:u12:csf,, -7:u22:CSF, 8:u23:CSF,, 12:u07:sampled., 17:u08:brain-barrier, @@ -1325374,12 +1338775,9 @@ 13:u03:half-open, 17:u00:"nNucleiBin"., 13:u02:half-open, -9:uI2:,-,-., 13:u01:half-open, -9:uI1:,-,-., 17:u08:aggregateData, 13:u00:half-open, -9:uI0:,-,-., 17:u07:aggregateData, 17:u08:eigenvectors., 17:u06:aggregateData, @@ -1330149,15 +1343547,6 @@ 11:u00:Hinxton, 8:u01:CB10, 8:u00:CB10, -9:u08:Lists, -9:u07:Lists, -9:u06:Lists, -9:u05:Lists, -9:u04:Lists, -9:u03:Lists, -9:u02:Lists, -9:u01:Lists, -9:u00:Lists, 19:u08:Notwithstanding, 19:u07:Notwithstanding, 19:u06:Notwithstanding, @@ -1330198,20 +1343587,15 @@ 13:u12:epigenome, 13:u03:Epigenome, 13:u11:epigenome, -12:u14:eligible, 13:u02:Epigenome, 9:u08:Forge, 13:u10:epigenome, -12:u13:eligible, 13:u01:Epigenome, 9:u08:FORGE, -12:u12:eligible, 13:u00:Epigenome, 9:u07:Forge, -12:u11:eligible, 9:u06:Forge, 9:u07:FORGE, -12:u10:eligible, 9:u14:forge, 9:u05:Forge, 9:u06:FORGE, @@ -1330581,7 +1343965,6 @@ 79:u12:ftp://ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/b, 51:u13:ydatatype/openchrom/jan2011/combined_hotspots/., 16:uI1:://...//////, -9:uI2:////., 79:u03:ftp://ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/b, 51:u04:yDataType/openchrom/jan2011/combined_hotspots/., 10:u05:DNAse1, @@ -1330594,7 +1343977,6 @@ 7:u22:yDa, 8:u23:yDat, 16:uI0:://...//////, -9:uI1:////., 79:u02:ftp://ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/b, 51:u03:yDataType/openchrom/jan2011/combined_hotspots/., 10:u04:DNAse1, @@ -1330606,7 +1343988,6 @@ 51:u11:ydatatype/openchrom/jan2011/combined_hotspots/., 36:u14:sample/chromatin_accessibility/., 8:u23:DNAs, -9:uI0:////., 14:uI2:://..//-/-, 79:u01:ftp://ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/b, 51:u02:yDataType/openchrom/jan2011/combined_hotspots/., @@ -1330931,7 +1344312,6 @@ 20:u06:closest-features, 77:u12:ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/bydat, 69:u13:atype/gencode/jan2011/gencodev7_cage_tss_clusters_june2011.gff.gz, -10:u14:bedops, 8:u23:ftp., 13:uI1:...//////, 9:uI2:///.., @@ -1330942,7 +1344322,6 @@ 20:u05:closest-features, 77:u11:ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/bydat, 69:u12:atype/gencode/jan2011/gencodev7_cage_tss_clusters_june2011.gff.gz, -10:u13:bedops, 6:u21:aT, 7:u22:aTy, 8:u23:aTyp, @@ -1330955,7 +1344334,6 @@ 20:u04:closest-features, 77:u10:ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/bydat, 69:u11:atype/gencode/jan2011/gencodev7_cage_tss_clusters_june2011.gff.gz, -10:u12:bedops, 11:u14:deciles, 8:u23:Bedo, 9:uI0:///.., @@ -1330965,14 +1344343,12 @@ 11:u05:deciles, 20:u03:closest-features, 69:u10:atype/gencode/jan2011/gencodev7_cage_tss_clusters_june2011.gff.gz, -10:u11:bedops, 11:u13:deciles, 77:u00:ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/byDat, 69:u01:aType/gencode/jan2011/Gencodev7_CAGE_TSS_clusters_June2011.gff.gz, 10:u02:Bedops, 11:u04:deciles, 20:u02:closest-features, -10:u10:bedops, 11:u12:deciles, 69:u00:aType/gencode/jan2011/Gencodev7_CAGE_TSS_clusters_June2011.gff.gz, 10:u01:Bedops, @@ -1332153,7 +1345529,6 @@ 8:u11:iida, 13:u12:mushiroda, 11:u13:znf512b, -8:u23:Mush, 8:u02:Iida, 13:u03:Mushiroda, 11:u04:ZNF512B, @@ -1335119,7 +1348494,6 @@ 12:u06:sensing:, 12:u12:671-680., 8:u23:671-, -12:uI2:.,,,,,.., 36:u00:doi:10.1016/j.celrep.2018.08.023, 12:u03:671-680., 33:u08:doi:10.1038/nmicrobiol.2015.5, @@ -1335128,14 +1348502,12 @@ 11:u04:Trovato, 12:u05:sensing:, 12:u11:671-680., -12:uI1:.,,,,,.., 12:u02:671-680., 15:u00:Mitrophanov, 33:u02:doi:10.1016/j.jmb.2010.06.051, 11:u03:Trovato, 12:u04:sensing:, 12:u10:671-680., -12:uI0:.,,,,,.., 15:uI2:..;:-.:./-., 12:u01:671-680., 33:u07:doi:10.1038/nmicrobiol.2015.5, @@ -1338173,12 +1351545,10 @@ 25:u02:transmission-blocking, 14:u05:Gholizadeh, 13:u08:sorensis., -14:u08:candidate,, 25:u10:transmission-blocking, 14:u13:gholizadeh, 25:u01:transmission-blocking, 14:u04:Gholizadeh, -14:u07:candidate,, 9:u08:Malar, 14:u12:gholizadeh, 8:u23:Ghol, @@ -1338186,12 +1351556,10 @@ 14:u03:Gholizadeh, 13:u07:sorensis., 11:u08:Bousema, -14:u06:candidate,, 9:u07:Malar, 14:u11:gholizadeh, 14:u02:Gholizadeh, 13:u06:sorensis., -14:u05:candidate,, 9:u06:Malar, 14:u10:gholizadeh, 13:u14:sorensis., @@ -1338199,13 +1351567,11 @@ 13:u05:sorensis., 11:u07:Bousema, 10:u08:modium, -14:u04:candidate,, 9:u05:Malar, 13:u13:sorensis., 14:u00:Gholizadeh, 13:u04:sorensis., 11:u06:Bousema, -14:u03:candidate,, 9:u04:Malar, 9:u08:vivax, 13:u12:sorensis., @@ -1338214,7 +1351580,6 @@ 13:u03:sorensis., 11:u05:Bousema, 10:u07:modium, -14:u02:candidate,, 9:u03:Malar, 9:u07:vivax, 13:u11:sorensis., @@ -1338222,7 +1351587,6 @@ 13:u02:sorensis., 11:u04:Bousema, 10:u06:modium, -14:u01:candidate,, 9:u02:Malar, 9:u06:vivax, 13:u10:sorensis., @@ -1338231,7 +1351595,6 @@ 13:u01:sorensis., 11:u03:Bousema, 10:u05:modium, -14:u00:candidate,, 9:u01:Malar, 9:u05:vivax, 11:u11:bousema, @@ -1340358,29 +1353721,20 @@ 21:u02:multi-dimensional, 21:u01:multi-dimensional, 21:u00:multi-dimensional, -14:u08:landscapes, -14:u07:landscapes, 7:u08:iad, -14:u06:landscapes, -14:u05:landscapes, 7:u07:iad, -14:u04:landscapes, 7:u06:iad, -14:u03:landscapes, 7:u14:iad, 7:u05:iad, -14:u02:landscapes, 9:u08:10-14, 7:u13:iad, 7:u04:iad, 11:u08:scapes,, -14:u01:landscapes, 9:u07:10-14, 7:u12:iad, 7:u22:iad, 7:u23:iad, 7:u03:iad, -14:u00:landscapes, 9:u06:10-14, 7:u11:iad, 7:u02:iad, @@ -1341531,15 +1354885,10 @@ 7:u04:Å,, 7:u03:Å,, 7:u02:Å,, -14:u14:landscapes, 7:u01:Å,, -14:u13:landscapes, 31:u08:pearce/learning-dynamical)., 7:u00:Å,, -14:u12:landscapes, -14:u11:landscapes, 31:u07:pearce/learning-dynamical)., -14:u10:landscapes, 31:u06:pearce/learning-dynamical)., 31:u14:pearce/learning-dynamical)., 11:uI2:(://./-, @@ -1344824,31 +1358173,22 @@ 15:u01:Angioplasty, 15:u00:Angioplasty, 12:u08:dergoing, -9:u08:2,000, -9:u07:2,000, 12:u07:dergoing, -9:u06:2,000, 12:u06:dergoing, -9:u05:2,000, 12:u14:dergoing, 12:u05:dergoing, -9:u04:2,000, 12:u13:dergoing, 12:u04:dergoing, -9:u03:2,000, 12:u12:dergoing, 8:u23:derg, 12:u03:dergoing, -9:u02:2,000, 12:u11:dergoing, 151:uI2:•••••••••••••••••••••••••••••••••••••••••••••••••, 12:u02:dergoing, -9:u01:2,000, 12:u10:dergoing, 151:uI1:•••••••••••••••••••••••••••••••••••••••••••••••••, 12:u01:dergoing, 16:u08:Albuquerque,, -9:u00:2,000, 151:uI0:•••••••••••••••••••••••••••••••••••••••••••••••••, 10:uI2:,,;-'-, 12:u00:dergoing, @@ -1348774,19 +1362114,14 @@ 8:u06:,000, 9:u02:(MSE), 8:u05:,000, -9:u14:2,000, 9:u01:(MSE), 8:u04:,000, -9:u13:2,000, 9:u00:(MSE), 8:u03:,000, -9:u12:2,000, 8:u02:,000, -9:u11:2,000, 6:u22:km, 6:u23:km, 8:u01:,000, -9:u10:2,000, 8:u00:,000, 9:u08:-0.75, 9:u07:-0.75, @@ -1365213,30 +1378548,25 @@ 20:u05:eScholarship.org, 11:u06:Powered, 20:u13:escholarship.org, -11:u14:powered, 32:u00:10.1016/0038-1098(88)90669-2, 20:u04:eScholarship.org, 11:u05:Powered, 20:u12:escholarship.org, -11:u13:powered, 8:u23:eSch, 20:u03:eScholarship.org, 11:u04:Powered, 16:u08:0038-I098/88, 20:u11:escholarship.org, -11:u12:powered, 20:u02:eScholarship.org, 11:u03:Powered, 9:u08:$3.00, 20:u10:escholarship.org, -11:u11:powered, 20:u01:eScholarship.org, 11:u02:Powered, 16:u07:0038-I098/88, 9:u08:NOVEL, 9:u07:$3.00, 12:u08:Journals, -11:u10:powered, 20:u00:eScholarship.org, 11:u01:Powered, 16:u06:0038-I098/88, @@ -1367813,6 +1381143,4075 @@ 46:u10:creativecommons.org/licenses/by-nc-nd/4.0/, 46:u01:creativecommons.org/licenses/by-nc-nd/4.0/, 14:u02:Instincts:, +46:u05:https://doi.org/10.1038/s41467-024-52091-1, +11:u08:Kaitlyn, +7:u06:LEA, +10:u08:plunge, +46:u13:https://doi.org/10.1038/s41467-024-52091-1, +46:u04:https://doi.org/10.1038/s41467-024-52091-1, +13:u08:Air-water, +7:u05:LEA, +10:u07:plunge, +46:u12:https://doi.org/10.1038/s41467-024-52091-1, +46:u03:https://doi.org/10.1038/s41467-024-52091-1, +11:u07:Kaitlyn, +7:u08:EM), +7:u04:LEA, +10:u06:plunge, +46:u11:https://doi.org/10.1038/s41467-024-52091-1, +46:u02:https://doi.org/10.1038/s41467-024-52091-1, +11:u06:Kaitlyn, +13:u07:Air-water, +7:u03:LEA, +10:u05:plunge, +46:u10:https://doi.org/10.1038/s41467-024-52091-1, +11:u14:kaitlyn, +46:u01:https://doi.org/10.1038/s41467-024-52091-1, +11:u05:Kaitlyn, +13:u06:Air-water, +7:u07:EM), +17:u08:Embryogenesis, +7:u02:LEA, +10:u04:plunge, +11:u13:kaitlyn, +13:u14:air-water, +46:u00:https://doi.org/10.1038/s41467-024-52091-1, +11:u04:Kaitlyn, +13:u05:Air-water, +7:u06:EM), +7:u01:LEA, +10:u03:plunge, +12:u08:Abundant, +11:u12:kaitlyn, +13:u13:air-water, +7:u14:em), +8:u23:Kait, +10:uI2:-()-(-, +11:u03:Kaitlyn, +13:u04:Air-water, +7:u05:EM), +17:u07:Embryogenesis, +13:u08:freezing,, +7:u00:LEA, +10:u02:plunge, +12:u07:Abundant, +11:u11:kaitlyn, +13:u12:air-water, +7:u13:em), +10:uI1:-()-(-, +11:u02:Kaitlyn, +13:u03:Air-water, +7:u04:EM), +17:u06:Embryogenesis, +10:u01:plunge, +12:u06:Abundant, +11:u10:kaitlyn, +13:u11:air-water, +7:u12:em), +7:u22:EM), +7:u23:EM), +10:uI0:-()-(-, +11:u01:Kaitlyn, +13:u02:Air-water, +7:u03:EM), +17:u05:Embryogenesis, +13:u07:freezing,, +10:u00:plunge, +12:u05:Abundant, +13:u10:air-water, +7:u11:em), +11:u00:Kaitlyn, +13:u01:Air-water, +7:u02:EM), +17:u04:Embryogenesis, +13:u06:freezing,, +13:u08:Cryogenic, +12:u04:Abundant, +7:u10:em), +13:u14:freezing,, +13:u00:Air-water, +7:u01:EM), +17:u03:Embryogenesis, +13:u05:freezing,, +15:u08:interfaces,, +12:u03:Abundant, +13:u13:freezing,, +7:u00:EM), +17:u02:Embryogenesis, +13:u04:freezing,, +13:u07:Cryogenic, +12:u02:Abundant, +13:u12:freezing,, +17:u01:Embryogenesis, +13:u03:freezing,, +13:u06:Cryogenic, +15:u07:interfaces,, +12:u01:Abundant, +13:u11:freezing,, +17:u00:Embryogenesis, +13:u02:freezing,, +13:u05:Cryogenic, +15:u06:interfaces,, +11:u08:cryo-EM, +12:u00:Abundant, +7:u08:LEA, +13:u10:freezing,, +15:u14:interfaces,, +13:u01:freezing,, +13:u04:Cryogenic, +15:u05:interfaces,, +7:u07:LEA, +15:u13:interfaces,, +13:u00:freezing,, +13:u03:Cryogenic, +15:u04:interfaces,, +11:u07:cryo-EM, +16:u08:revitalizing, +15:u12:interfaces,, +13:u02:Cryogenic, +15:u03:interfaces,, +11:u06:cryo-EM, +16:u07:revitalizing, +15:u11:interfaces,, +11:u14:cryo-em, +13:u01:Cryogenic, +15:u02:interfaces,, +11:u05:cryo-EM, +16:u06:revitalizing, +15:u08:"resolution, +15:u10:interfaces,, +11:u13:cryo-em, +13:u00:Cryogenic, +15:u01:interfaces,, +11:u04:cryo-EM, +16:u05:revitalizing, +15:u07:"resolution, +11:u12:cryo-em, +15:u00:interfaces,, +11:u03:cryo-EM, +16:u04:revitalizing, +15:u06:"resolution, +11:u11:cryo-em, +11:u02:cryo-EM, +16:u03:revitalizing, +15:u05:"resolution, +11:u10:cryo-em, +9:uI2:""-(-, +11:u01:cryo-EM, +16:u02:revitalizing, +15:u04:"resolution, +7:u08:2-9, +9:uI1:""-(-, +11:u00:cryo-EM, +16:u01:revitalizing, +15:u03:"resolution, +7:u07:2-9, +9:uI0:""-(-, +16:u00:revitalizing, +15:u02:"resolution, +7:u06:2-9, +15:u01:"resolution, +7:u05:2-9, +11:u08:plunged, +8:u08:eous, +15:u00:"resolution, +7:u04:2-9, +11:u07:plunged, +7:u03:2-9, +11:u06:plunged, +8:u07:eous, +7:u02:2-9, +11:u05:plunged, +8:u06:eous, +7:u01:2-9, +11:u04:plunged, +8:u14:eous, +10:uI2:(-),--, +8:u05:eous, +7:u00:2-9, +11:u03:plunged, +8:u13:eous, +10:uI1:(-),--, +8:u04:eous, +11:u02:plunged, +8:u12:eous, +7:u22:eou, +8:u23:eous, +10:uI0:(-),--, +8:u03:eous, +11:u01:plunged, +8:u11:eous, +8:u02:eous, +14:u08:integrity,, +11:u00:plunged, +8:u10:eous, +8:u01:eous, +8:u00:eous, +14:u07:integrity,, +14:u06:integrity,, +14:u14:integrity,, +14:u05:integrity,, +12:u08:sotropic, +14:u13:integrity,, +13:uI2:,,,,,(.)., +14:u04:integrity,, +14:u12:integrity,, +13:uI1:,,,,,(.)., +14:u03:integrity,, +12:u07:sotropic, +14:u11:integrity,, +13:uI0:,,,,,(.)., +14:u02:integrity,, +12:u06:sotropic, +14:u10:integrity,, +12:u14:sotropic, +14:u01:integrity,, +12:u05:sotropic, +16:u08:crosslinking, +12:u13:sotropic, +14:u00:integrity,, +12:u04:sotropic, +16:u07:crosslinking, +12:u12:sotropic, +7:u22:sot, +8:u23:sotr, +12:u03:sotropic, +16:u06:crosslinking, +12:u11:sotropic, +12:u02:sotropic, +16:u05:crosslinking, +12:u10:sotropic, +12:u01:sotropic, +16:u04:crosslinking, +20:u08:cost-prohibitive, +12:u00:sotropic, +14:u08:effective,, +16:u03:crosslinking, +20:u07:cost-prohibitive, +16:u02:crosslinking, +20:u06:cost-prohibitive, +14:u07:effective,, +16:u01:crosslinking, +20:u05:cost-prohibitive, +14:u06:effective,, +11:u08:AavLEA1, +16:u00:crosslinking, +20:u04:cost-prohibitive, +14:u14:effective,, +14:u05:effective,, +20:u03:cost-prohibitive, +13:u08:mitigates, +14:u13:effective,, +14:u04:effective,, +11:u07:AavLEA1, +20:u02:cost-prohibitive, +13:u07:mitigates, +14:u12:effective,, +14:u03:effective,, +11:u06:AavLEA1, +20:u01:cost-prohibitive, +13:u06:mitigates, +14:u11:effective,, +11:u14:aavlea1, +14:u02:effective,, +11:u05:AavLEA1, +15:u08:desiccation, +20:u00:cost-prohibitive, +13:u05:mitigates, +10:u08:world,, +14:u10:effective,, +11:u13:aavlea1, +14:u01:effective,, +11:u04:AavLEA1, +13:u04:mitigates, +10:u07:world,, +11:u12:aavlea1, +7:u22:Aav, +8:u23:AavL, +14:u00:effective,, +11:u03:AavLEA1, +15:u07:desiccation, +13:u03:mitigates, +10:u06:world,, +11:u11:aavlea1, +11:u02:AavLEA1, +15:u06:desiccation, +13:u02:mitigates, +10:u05:world,, +11:u10:aavlea1, +15:u14:desiccation, +11:u01:AavLEA1, +15:u05:desiccation, +13:u01:mitigates, +10:u04:world,, +15:u13:desiccation, +11:u00:AavLEA1, +15:u04:desiccation, +13:u00:mitigates, +10:u03:world,, +15:u12:desiccation, +15:u03:desiccation, +10:u02:world,, +15:u11:desiccation, +15:u02:desiccation, +10:u01:world,, +15:u10:desiccation, +15:u01:desiccation, +10:u00:world,, +21:u08:ciji.lim@wisc.edu, +15:u00:desiccation, +21:u07:ciji.lim@wisc.edu, +11:uI2:,-,,,.,, +21:u06:ciji.lim@wisc.edu, +11:uI1:,-,,,.,, +21:u05:ciji.lim@wisc.edu, +11:uI0:,-,,,.,, +21:u04:ciji.lim@wisc.edu, +12:u08:ogenesis, +21:u03:ciji.lim@wisc.edu, +21:u02:ciji.lim@wisc.edu, +12:u07:ogenesis, +21:u01:ciji.lim@wisc.edu, +12:u08:AavLEA1,, +12:u06:ogenesis, +21:u00:ciji.lim@wisc.edu, +12:u07:AavLEA1,, +12:u14:ogenesis, +12:u05:ogenesis, +12:u06:AavLEA1,, +12:u13:ogenesis, +12:u04:ogenesis, +12:u05:AavLEA1,, +12:u12:ogenesis, +7:u22:oge, +8:u23:ogen, +12:u03:ogenesis, +12:u04:AavLEA1,, +12:u11:ogenesis, +12:u02:ogenesis, +12:u03:AavLEA1,, +12:u10:ogenesis, +12:u01:ogenesis, +12:u02:AavLEA1,, +12:u00:ogenesis, +12:u01:AavLEA1,, +12:u00:AavLEA1,, +8:u08:LEA1, +8:u07:LEA1, +8:u06:LEA1, +9:u08:tems:, +8:u14:lea1, +8:u05:LEA1, +14:u08:repressive, +8:u13:lea1, +8:u04:LEA1, +9:u07:tems:, +8:u12:lea1, +8:u23:LEA1, +8:u03:LEA1, +9:u06:tems:, +14:u07:repressive, +8:u11:lea1, +9:u14:tems:, +8:u02:LEA1, +9:u05:tems:, +14:u06:repressive, +8:u10:lea1, +9:u13:tems:, +14:u14:repressive, +10:uI2::--()-, +8:u01:LEA1, +9:u04:tems:, +14:u05:repressive, +9:u12:tems:, +14:u13:repressive, +10:uI1::--()-, +8:u00:LEA1, +9:u03:tems:, +14:u04:repressive, +9:u11:tems:, +14:u12:repressive, +10:uI0::--()-, +9:u02:tems:, +14:u03:repressive, +9:u10:tems:, +14:u11:repressive, +9:u01:tems:, +14:u02:repressive, +12:u08:arguably, +14:u10:repressive, +9:u00:tems:, +14:u01:repressive, +14:u00:repressive, +12:u07:arguably, +12:u06:arguably, +15:u08:crosslinked, +12:u14:arguably, +12:u05:arguably, +12:u13:arguably, +12:u04:arguably, +15:u07:crosslinked, +12:u08:tethered, +12:u12:arguably, +12:u03:arguably, +15:u06:crosslinked, +12:u07:tethered, +12:u11:arguably, +15:u14:crosslinked, +12:u02:arguably, +15:u05:crosslinked, +12:u06:tethered, +12:u10:arguably, +15:u13:crosslinked, +12:u01:arguably, +15:u04:crosslinked, +12:u05:tethered, +15:u12:crosslinked, +12:u00:arguably, +15:u03:crosslinked, +12:u08:1:8-1:40, +12:u04:tethered, +15:u11:crosslinked, +15:u02:crosslinked, +12:u03:tethered, +15:u10:crosslinked, +15:u01:crosslinked, +12:u07:1:8-1:40, +12:u02:tethered, +15:u00:crosslinked, +12:u06:1:8-1:40, +12:u01:tethered, +12:u14:1:8-1:40, +12:u05:1:8-1:40, +12:u00:tethered, +12:u13:1:8-1:40, +8:uI2::-:(, +12:u04:1:8-1:40, +12:u12:1:8-1:40, +8:u23:1:8-, +8:uI1::-:(, +10:uI2:.-).::, +12:u03:1:8-1:40, +12:u11:1:8-1:40, +8:uI0::-:(, +10:uI1:.-).::, +12:u02:1:8-1:40, +12:u10:1:8-1:40, +10:uI0:.-).::, +12:u01:1:8-1:40, +12:uI2:(.).--(), +12:u00:1:8-1:40, +12:uI1:(.).--(), +12:uI0:(.).--(), +7:u08:AWI, +7:u07:AWI, +7:u06:AWI, +7:u05:AWI, +7:u04:AWI, +7:u03:AWI, +7:u02:AWI, +7:u01:AWI, +7:u00:AWI, +17:u08:conformation;, +17:u07:conformation;, +17:u06:conformation;, +17:u14:conformation;, +17:u05:conformation;, +13:u08:apo-state, +17:u13:conformation;, +17:u04:conformation;, +17:u12:conformation;, +17:u03:conformation;, +13:u07:apo-state, +16:u08:PRC2:AavLEA1, +7:u08:saw, +17:u11:conformation;, +9:uI2:-(:)(, +17:u02:conformation;, +13:u06:apo-state, +7:u07:saw, +17:u10:conformation;, +13:u14:apo-state, +9:uI1:-(:)(, +17:u01:conformation;, +13:u05:apo-state, +16:u07:PRC2:AavLEA1, +7:u06:saw, +13:u13:apo-state, +9:uI0:-(:)(, +17:u00:conformation;, +13:u04:apo-state, +16:u06:PRC2:AavLEA1, +14:u08:complexes,, +7:u05:saw, +13:u12:apo-state, +16:u14:prc2:aavlea1, +8:u23:apo-, +13:u03:apo-state, +16:u05:PRC2:AavLEA1, +7:u04:saw, +13:u11:apo-state, +16:u13:prc2:aavlea1, +17:u14:homogeneously, +13:u02:apo-state, +16:u04:PRC2:AavLEA1, +14:u07:complexes,, +7:u03:saw, +13:u10:apo-state, +16:u12:prc2:aavlea1, +17:u13:homogeneously, +8:u23:PRC2, +13:u01:apo-state, +16:u03:PRC2:AavLEA1, +14:u06:complexes,, +7:u02:saw, +16:u11:prc2:aavlea1, +17:u12:homogeneously, +14:u14:complexes,, +13:u00:apo-state, +16:u02:PRC2:AavLEA1, +14:u05:complexes,, +7:u01:saw, +16:u10:prc2:aavlea1, +17:u11:homogeneously, +14:u13:complexes,, +16:u01:PRC2:AavLEA1, +14:u04:complexes,, +7:u00:saw, +17:u10:homogeneously, +14:u12:complexes,, +16:u00:PRC2:AavLEA1, +14:u03:complexes,, +14:u11:complexes,, +14:u02:complexes,, +14:u08:Encouraged, +14:u10:complexes,, +14:u01:complexes,, +14:u00:complexes,, +14:u07:Encouraged, +7:u14:awi, +14:u06:Encouraged, +7:u13:awi, +14:u05:Encouraged, +16:u08:Ramazzottius, +7:u12:awi, +7:u22:AWI, +7:u23:AWI, +14:u04:Encouraged, +16:u08:varieornatus, +7:u11:awi, +14:u03:Encouraged, +16:u07:Ramazzottius, +16:u07:varieornatus, +10:u08:RvLEAM, +7:u10:awi, +14:u02:Encouraged, +16:u06:Ramazzottius, +16:u06:varieornatus, +10:u07:RvLEAM, +16:u14:ramazzottius, +14:u01:Encouraged, +16:u05:Ramazzottius, +16:u05:varieornatus, +10:u06:RvLEAM, +16:u13:ramazzottius, +14:u00:Encouraged, +16:u04:Ramazzottius, +16:u04:varieornatus, +10:u05:RvLEAM, +16:u12:ramazzottius, +16:u03:Ramazzottius, +16:u03:varieornatus, +10:u04:RvLEAM, +16:u11:ramazzottius, +16:u02:Ramazzottius, +16:u02:varieornatus, +10:u03:RvLEAM, +16:u10:ramazzottius, +16:u01:Ramazzottius, +16:u01:varieornatus, +10:u02:RvLEAM, +10:u14:rvleam, +16:u00:Ramazzottius, +16:u00:varieornatus, +10:u01:RvLEAM, +10:u13:rvleam, +10:u00:RvLEAM, +10:u12:rvleam, +9:u14:molar, +6:u21:Rv, +7:u22:RvL, +8:u23:RvLE, +10:u11:rvleam, +9:u13:molar, +10:u10:rvleam, +9:u12:molar, +9:u11:molar, +11:u08:Cryo-EM, +9:u10:molar, +7:u08:SPA, +11:u07:Cryo-EM, +7:u07:SPA, +11:u06:Cryo-EM, +7:u06:SPA, +11:u05:Cryo-EM, +7:u05:SPA, +11:u04:Cryo-EM, +9:u08:holey, +7:u04:SPA, +11:u03:Cryo-EM, +7:u03:SPA, +7:u14:spa, +11:u02:Cryo-EM, +9:u07:holey, +7:u02:SPA, +7:u13:spa, +11:u01:Cryo-EM, +9:u06:holey, +7:u01:SPA, +7:u12:spa, +9:u14:holey, +7:u23:SPA, +11:u00:Cryo-EM, +9:u05:holey, +9:u08:Holey, +7:u00:SPA, +7:u11:spa, +9:u13:holey, +9:u04:holey, +7:u10:spa, +9:u12:holey, +9:u03:holey, +9:u07:Holey, +9:u08:Holes, +9:u11:holey, +9:u02:holey, +9:u06:Holey, +13:u08:vitrified, +9:u10:holey, +9:u01:holey, +9:u05:Holey, +9:u07:Holes, +9:u00:holey, +9:u04:Holey, +9:u06:Holes, +13:u07:vitrified, +9:u03:Holey, +9:u05:Holes, +13:u06:vitrified, +13:u14:vitrified, +9:u02:Holey, +9:u04:Holes, +13:u05:vitrified, +13:u13:vitrified, +9:u01:Holey, +9:u03:Holes, +13:u04:vitrified, +13:u12:vitrified, +9:u00:Holey, +9:u02:Holes, +13:u03:vitrified, +13:u11:vitrified, +9:u01:Holes, +13:u02:vitrified, +13:u10:vitrified, +9:u00:Holes, +13:u01:vitrified, +13:u00:vitrified, +13:u08:Vitrified, +11:u08:Rescued, +13:u07:Vitrified, +13:u06:Vitrified, +11:u07:Rescued, +13:u05:Vitrified, +11:u06:Rescued, +11:u14:rescued, +13:u04:Vitrified, +11:u05:Rescued, +13:u08:LEA-water, +11:u13:rescued, +8:u23:Vitr, +13:u03:Vitrified, +11:u04:Rescued, +11:u12:rescued, +13:u02:Vitrified, +11:u03:Rescued, +13:u07:LEA-water, +11:u11:rescued, +13:u01:Vitrified, +11:u02:Rescued, +13:u06:LEA-water, +11:u10:rescued, +13:u14:lea-water, +13:u00:Vitrified, +11:u01:Rescued, +13:u05:LEA-water, +13:u13:lea-water, +7:u14:lea, +11:u00:Rescued, +13:u04:LEA-water, +13:u12:lea-water, +7:u13:lea, +8:u23:LEA-, +13:u03:LEA-water, +13:u11:lea-water, +7:u12:lea, +7:u23:LEA, +13:u02:LEA-water, +13:u10:lea-water, +7:u11:lea, +13:u01:LEA-water, +7:u10:lea, +13:u00:LEA-water, +16:u08:Demonstrates, +16:u07:Demonstrates, +16:u06:Demonstrates, +46:u08:https://doi.org/10.1038/s41467-024-52091-1, +16:u05:Demonstrates, +16:u04:Demonstrates, +46:u07:https://doi.org/10.1038/s41467-024-52091-1, +16:u03:Demonstrates, +46:u06:https://doi.org/10.1038/s41467-024-52091-1, +16:u02:Demonstrates, +46:u14:https://doi.org/10.1038/s41467-024-52091-1, +16:u01:Demonstrates, +16:u00:Demonstrates, +13:u08:additive,, +13:u07:additive,, +13:u06:additive,, +13:u08:freezing., +13:u05:additive,, +13:u07:freezing., +13:u04:additive,, +13:u06:freezing., +10:u14:plunge, +13:u03:additive,, +13:u05:freezing., +10:u13:plunge, +13:u02:additive,, +13:u04:freezing., +10:u12:plunge, +8:u23:plun, +13:u01:additive,, +13:u03:freezing., +10:u11:plunge, +13:u00:additive,, +13:u02:freezing., +10:u10:plunge, +13:u01:freezing., +13:u00:freezing., +9:u08:(view, +9:u07:(view, +9:u06:(view, +9:u05:(view, +14:u08:sphericity, +9:u04:(view, +9:u03:(view, +14:u07:sphericity, +14:u08:tribution,, +9:u02:(view, +14:u06:sphericity, +9:u01:(view, +14:u14:sphericity, +14:u05:sphericity, +14:u07:tribution,, +9:u00:(view, +14:u13:sphericity, +14:u04:sphericity, +14:u06:tribution,, +14:u12:sphericity, +14:u14:tribution,, +14:u03:sphericity, +14:u05:tribution,, +14:u11:sphericity, +14:u13:tribution,, +14:u02:sphericity, +14:u04:tribution,, +14:u10:sphericity, +14:u12:tribution,, +14:u01:sphericity, +14:u03:tribution,, +14:u11:tribution,, +14:u00:sphericity, +14:u02:tribution,, +17:u08:cryo-electron, +14:u10:tribution,, +14:u01:tribution,, +17:u07:cryo-electron, +14:u00:tribution,, +17:u06:cryo-electron, +17:u05:cryo-electron, +17:u04:cryo-electron, +17:u03:cryo-electron, +10:u14:movies, +10:uI2:(:)(.,, +17:u02:cryo-electron, +10:u13:movies, +10:uI1:(:)(.,, +17:u01:cryo-electron, +10:u12:movies, +10:uI0:(:)(.,, +17:u00:cryo-electron, +10:u11:movies, +10:u10:movies, +9:u08:ples', +9:u07:ples', +9:u06:ples', +9:u14:ples', +9:u05:ples', +9:u13:ples', +9:u04:ples', +7:u08:LWI, +9:u12:ples', +9:u03:ples', +9:u11:ples', +9:u02:ples', +7:u07:LWI, +9:u10:ples', +9:u01:ples', +7:u06:LWI, +7:u14:lwi, +9:u00:ples', +7:u05:LWI, +7:u13:lwi, +7:u04:LWI, +7:u12:lwi, +7:u22:LWI, +7:u23:LWI, +7:u03:LWI, +7:u11:lwi, +7:u02:LWI, +12:u08:"sticky", +7:u10:lwi, +7:u01:LWI, +7:u00:LWI, +12:u07:"sticky", +12:u06:"sticky", +12:u14:"sticky", +12:u05:"sticky", +12:u13:"sticky", +12:u04:"sticky", +9:u08:51,52, +12:u12:"sticky", +8:u23:"sti, +12:u03:"sticky", +9:u07:51,52, +12:u11:"sticky", +12:u02:"sticky", +9:u06:51,52, +12:u10:"sticky", +12:u01:"sticky", +9:u08:90°1, +9:u05:51,52, +12:u00:"sticky", +9:u04:51,52, +9:u07:90°1, +9:u03:51,52, +9:u06:90°1, +9:u02:51,52, +9:u14:90°1, +9:u05:90°1, +9:u01:51,52, +15:u08:micrographs, +9:u13:90°1, +9:u04:90°1, +9:u00:51,52, +15:u07:micrographs, +9:u12:90°1, +9:u23:90°1, +9:u03:90°1, +15:u06:micrographs, +9:u11:90°1, +9:u02:90°1, +15:u05:micrographs, +15:u08:resolution:, +9:u10:90°1, +9:u01:90°1, +15:u04:micrographs, +15:u07:resolution:, +9:u00:90°1, +8:u08:PRC2, +15:u03:micrographs, +15:u06:resolution:, +15:u02:micrographs, +15:u05:resolution:, +8:u07:PRC2, +9:u08:90°G, +15:u01:micrographs, +15:u04:resolution:, +8:u06:PRC2, +9:u08:lobal, +15:u00:micrographs, +15:u03:resolution:, +8:u14:prc2, +8:u05:PRC2, +9:u07:90°G, +15:u02:resolution:, +8:u13:prc2, +8:u04:PRC2, +9:u06:90°G, +9:u07:lobal, +15:u01:resolution:, +8:u12:prc2, +9:u14:90°g, +8:u03:PRC2, +9:u05:90°G, +9:u06:lobal, +15:u00:resolution:, +8:u11:prc2, +9:u13:90°g, +9:u14:lobal, +8:u02:PRC2, +9:u04:90°G, +9:u05:lobal, +8:u10:prc2, +9:u12:90°g, +9:u13:lobal, +9:u23:90°G, +8:u01:PRC2, +9:u03:90°G, +9:u04:lobal, +9:u11:90°g, +9:u12:lobal, +8:u23:loba, +8:u00:PRC2, +9:u02:90°G, +9:u03:lobal, +9:u10:90°g, +9:u11:lobal, +9:u01:90°G, +9:u02:lobal, +9:u10:lobal, +9:u00:90°G, +9:u01:lobal, +9:u00:lobal, +14:u08:Polymerase, +8:u08:tode, +17:u08:alpha-Primase, +14:u07:Polymerase, +17:u07:alpha-Primase, +12:u08:AavLEA1., +14:u06:Polymerase, +8:u07:tode, +17:u06:alpha-Primase, +12:u07:AavLEA1., +9:u08:(PP),, +14:u05:Polymerase, +8:u06:tode, +17:u05:alpha-Primase, +12:u06:AavLEA1., +9:u07:(PP),, +8:u14:tode, +14:u04:Polymerase, +8:u05:tode, +17:u04:alpha-Primase, +12:u05:AavLEA1., +9:u06:(PP),, +16:u08:CTFs-cropped, +8:u13:tode, +14:u03:Polymerase, +8:u04:tode, +17:u03:alpha-Primase, +12:u04:AavLEA1., +9:u05:(PP),, +16:u07:CTFs-cropped, +8:u12:tode, +8:u23:tode, +18:uI2:(),(-),(),(-),, +14:u02:Polymerase, +8:u03:tode, +17:u02:alpha-Primase, +12:u03:AavLEA1., +9:u04:(PP),, +16:u06:CTFs-cropped, +8:u11:tode, +18:uI1:(),(-),(),(-),, +14:u01:Polymerase, +8:u02:tode, +17:u01:alpha-Primase, +12:u02:AavLEA1., +9:u03:(PP),, +16:u05:CTFs-cropped, +8:u10:tode, +18:uI0:(),(-),(),(-),, +14:u00:Polymerase, +8:u01:tode, +17:u00:alpha-Primase, +12:u01:AavLEA1., +9:u02:(PP),, +16:u04:CTFs-cropped, +8:u00:tode, +12:u00:AavLEA1., +9:u01:(PP),, +16:u03:CTFs-cropped, +9:u00:(PP),, +16:u02:CTFs-cropped, +15:uI2:(),(),().,,, +16:u01:CTFs-cropped, +15:uI1:(),(),().,,, +16:u00:CTFs-cropped, +15:uI0:(),(),().,,, +10:u08:ratio;, +10:u07:ratio;, +10:u06:ratio;, +10:u14:ratio;, +10:u05:ratio;, +10:u13:ratio;, +10:u04:ratio;, +10:u12:ratio;, +10:u03:ratio;, +10:u11:ratio;, +10:u02:ratio;, +10:u10:ratio;, +10:u01:ratio;, +10:uI2:.,)..-, +10:u00:ratio;, +10:uI1:.,)..-, +10:uI0:.,)..-, +15:u14:microscope,, +15:u13:microscope,, +15:u12:microscope,, +15:u11:microscope,, +15:u10:microscope,, +9:uI2:.(.,-, +9:uI1:.(.,-, +9:uI0:.(.,-, +11:u08:modest;, +11:u07:modest;, +7:u08:~3%, +11:u06:modest;, +7:u07:~3%, +11:u14:modest;, +11:u05:modest;, +7:u06:~3%, +11:u13:modest;, +11:u04:modest;, +7:u05:~3%, +11:u12:modest;, +11:u03:modest;, +7:u04:~3%, +11:u11:modest;, +11:u02:modest;, +7:u03:~3%, +11:u10:modest;, +11:u01:modest;, +7:u02:~3%, +11:u00:modest;, +7:u01:~3%, +7:u00:~3%, +11:u08:CHAPSO,, +14:u08:mitigation, +14:u07:mitigation, +11:u07:CHAPSO,, +14:u06:mitigation, +11:u06:CHAPSO,, +14:u05:mitigation, +11:u14:chapso,, +11:u05:CHAPSO,, +14:u04:mitigation, +11:u13:chapso,, +11:u04:CHAPSO,, +14:u03:mitigation, +11:u12:chapso,, +8:u23:CHAP, +11:u03:CHAPSO,, +14:u02:mitigation, +11:u08:CHAPSO., +11:u11:chapso,, +11:u02:CHAPSO,, +15:u08:inspection,, +14:u01:mitigation, +11:u07:CHAPSO., +11:u10:chapso,, +11:u01:CHAPSO,, +14:u00:mitigation, +11:u06:CHAPSO., +11:u00:CHAPSO,, +15:u07:inspection,, +11:u05:CHAPSO., +15:u06:inspection,, +11:u04:CHAPSO., +8:u08:map,, +15:u14:inspection,, +15:u05:inspection,, +11:u03:CHAPSO., +8:u07:map,, +15:u13:inspection,, +15:u04:inspection,, +11:u02:CHAPSO., +8:u06:map,, +12:u08:(ppSSNR), +15:u12:inspection,, +15:u03:inspection,, +11:u01:CHAPSO., +8:u05:map,, +12:u07:(ppSSNR), +15:u11:inspection,, +11:uI2:-,.,).,, +15:u02:inspection,, +11:u00:CHAPSO., +8:u04:map,, +12:u06:(ppSSNR), +15:u10:inspection,, +11:uI1:-,.,).,, +15:u01:inspection,, +8:u03:map,, +12:u05:(ppSSNR), +10:u08:CHAPSO, +11:uI0:-,.,).,, +13:uI2:--()(.),-, +15:u00:inspection,, +9:u08:LEA1,, +8:u02:map,, +12:u04:(ppSSNR), +10:u07:CHAPSO, +13:uI1:--()(.),-, +8:u01:map,, +12:u03:(ppSSNR), +10:u06:CHAPSO, +13:uI0:--()(.),-, +9:u07:LEA1,, +8:u00:map,, +12:u02:(ppSSNR), +10:u05:CHAPSO, +9:u06:LEA1,, +15:u08:detergents,, +12:u01:(ppSSNR), +10:u04:CHAPSO, +9:u14:lea1,, +9:u05:LEA1,, +12:u00:(ppSSNR), +10:u03:CHAPSO, +9:u13:lea1,, +9:u04:LEA1,, +15:u07:detergents,, +10:u02:CHAPSO, +9:u12:lea1,, +9:u03:LEA1,, +15:u06:detergents,, +7:u08:~13, +10:u01:CHAPSO, +9:u11:lea1,, +15:u14:detergents,, +9:u02:LEA1,, +15:u05:detergents,, +12:u08:precious, +10:u00:CHAPSO, +9:u10:lea1,, +15:u13:detergents,, +9:u01:LEA1,, +15:u04:detergents,, +7:u07:~13, +15:u12:detergents,, +9:u00:LEA1,, +15:u03:detergents,, +7:u06:~13, +12:u07:precious, +15:u11:detergents,, +7:u14:~13, +15:u02:detergents,, +7:u05:~13, +12:u06:precious, +15:u10:detergents,, +7:u13:~13, +12:u14:precious, +15:u01:detergents,, +7:u04:~13, +12:u05:precious, +7:u12:~13, +12:u13:precious, +7:u22:~13, +7:u23:~13, +15:u00:detergents,, +7:u03:~13, +12:u04:precious, +7:u11:~13, +12:u12:precious, +7:u02:~13, +12:u03:precious, +7:u10:~13, +12:u11:precious, +7:u01:~13, +12:u02:precious, +12:u10:precious, +7:u00:~13, +12:u01:precious, +12:u00:precious, +9:u08:90°9, +8:u08:0°9, +9:u07:90°9, +9:u06:90°9, +8:u07:0°9, +9:u14:90°9, +9:u05:90°9, +8:u06:0°9, +9:u13:90°9, +8:u14:0°9, +9:u04:90°9, +8:u05:0°9, +9:u12:90°9, +8:u13:0°9, +9:u23:90°9, +9:u03:90°9, +8:u04:0°9, +9:u11:90°9, +8:u12:0°9, +7:u21:0°, +8:u22:0°9, +8:u23:0°9, +9:u02:90°9, +8:u03:0°9, +9:u10:90°9, +8:u11:0°9, +9:u01:90°9, +8:u02:0°9, +12:u08:ring-out, +8:u10:0°9, +9:u00:90°9, +8:u01:0°9, +12:u07:ring-out, +8:u08:(PP), +8:u00:0°9, +12:u06:ring-out, +8:u07:(PP), +12:u05:ring-out, +8:u06:(PP), +17:u08:orientations,, +12:u04:ring-out, +8:u05:(PP), +12:u03:ring-out, +8:u04:(PP), +17:u07:orientations,, +12:u02:ring-out, +8:u03:(PP), +17:u06:orientations,, +12:u01:ring-out, +8:u02:(PP), +17:u14:orientations,, +17:u05:orientations,, +12:u00:ring-out, +8:u01:(PP), +17:u13:orientations,, +17:u04:orientations,, +8:u00:(PP), +17:u12:orientations,, +17:u03:orientations,, +17:u11:orientations,, +17:u02:orientations,, +17:u10:orientations,, +17:u01:orientations,, +17:u00:orientations,, +14:u08:apo-state,, +17:u08:multi-subunit, +17:u07:multi-subunit, +14:u07:apo-state,, +17:u06:multi-subunit, +14:u06:apo-state,, +12:u08:parable,, +17:u05:multi-subunit, +14:u14:apo-state,, +14:u05:apo-state,, +17:u04:multi-subunit, +14:u13:apo-state,, +14:u04:apo-state,, +12:u07:parable,, +17:u03:multi-subunit, +14:u12:apo-state,, +14:u03:apo-state,, +12:u06:parable,, +17:u02:multi-subunit, +14:u11:apo-state,, +12:u14:parable,, +14:u02:apo-state,, +12:u05:parable,, +17:u01:multi-subunit, +14:u10:apo-state,, +12:u13:parable,, +14:u01:apo-state,, +12:u04:parable,, +12:u08:anti-AWI, +17:u00:multi-subunit, +12:u12:parable,, +14:u00:apo-state,, +12:u03:parable,, +12:u11:parable,, +12:u02:parable,, +12:u07:anti-AWI, +12:u10:parable,, +12:u01:parable,, +12:u06:anti-AWI, +15:u08:20,42-44,47, +12:u14:anti-awi, +12:u00:parable,, +12:u05:anti-AWI, +15:u07:20,42-44,47, +12:u13:anti-awi, +12:u04:anti-AWI, +15:u06:20,42-44,47, +12:u12:anti-awi, +12:u03:anti-AWI, +15:u05:20,42-44,47, +12:u11:anti-awi, +12:u02:anti-AWI, +15:u04:20,42-44,47, +12:u10:anti-awi, +12:u01:anti-AWI, +15:u03:20,42-44,47, +12:u00:anti-AWI, +15:u02:20,42-44,47, +10:u08:teins,, +15:u01:20,42-44,47, +15:u00:20,42-44,47, +10:u07:teins,, +10:u06:teins,, +14:u08:detergents, +10:u14:teins,, +10:u05:teins,, +12:u08:51,58,59, +10:u13:teins,, +10:u04:teins,, +14:u07:detergents, +12:u07:51,58,59, +10:u12:teins,, +10:u03:teins,, +14:u06:detergents, +12:u06:51,58,59, +10:u11:teins,, +14:u14:detergents, +10:u02:teins,, +14:u05:detergents, +12:u05:51,58,59, +10:u10:teins,, +14:u13:detergents, +10:u01:teins,, +14:u04:detergents, +12:u04:51,58,59, +14:u12:detergents, +10:u00:teins,, +14:u03:detergents, +12:u03:51,58,59, +14:u11:detergents, +14:u02:detergents, +12:u02:51,58,59, +14:u10:detergents, +14:u01:detergents, +12:u01:51,58,59, +14:u00:detergents, +12:u00:51,58,59, +14:u08:Sphericity, +14:u07:Sphericity, +14:u06:Sphericity, +14:u05:Sphericity, +14:u04:Sphericity, +8:u23:Sphe, +14:u03:Sphericity, +14:u02:Sphericity, +14:u01:Sphericity, +14:u00:Sphericity, +12:u08:isotropy, +12:u07:isotropy, +12:u06:isotropy, +12:u14:isotropy, +12:u05:isotropy, +12:u13:isotropy, +12:u04:isotropy, +12:u12:isotropy, +12:u03:isotropy, +12:u11:isotropy, +12:u02:isotropy, +12:u10:isotropy, +12:u01:isotropy, +12:u00:isotropy, +7:u08:Ice, +6:u08:PR, +7:u07:Ice, +7:u08:Vit, +7:u06:Ice, +6:u07:PR, +8:u08:rifi, +7:u05:Ice, +6:u06:PR, +7:u07:Vit, +8:u07:rifi, +7:u04:Ice, +6:u05:PR, +7:u06:Vit, +8:u06:rifi, +7:u14:vit, +7:u23:Ice, +7:u03:Ice, +6:u04:PR, +7:u05:Vit, +8:u05:rifi, +7:u13:vit, +6:u22:PR, +6:u23:PR, +7:u02:Ice, +6:u03:PR, +7:u04:Vit, +8:u04:rifi, +7:u12:vit, +7:u23:Vit, +7:u01:Ice, +6:u02:PR, +7:u03:Vit, +8:u03:rifi, +7:u11:vit, +7:u00:Ice, +6:u01:PR, +7:u02:Vit, +8:u02:rifi, +7:u10:vit, +6:u00:PR, +7:u01:Vit, +8:u01:rifi, +7:u00:Vit, +8:u00:rifi, +12:u08:Vitrifie, +12:u07:Vitrifie, +10:u08:partic, +12:u06:Vitrifie, +10:u07:partic, +12:u14:vitrifie, +12:u05:Vitrifie, +10:u06:partic, +12:u13:vitrifie, +12:u04:Vitrifie, +10:u05:partic, +12:u12:vitrifie, +12:u03:Vitrifie, +10:u04:partic, +12:u11:vitrifie, +12:u02:Vitrifie, +10:u03:partic, +12:u10:vitrifie, +12:u01:Vitrifie, +10:u02:partic, +12:u00:Vitrifie, +10:u01:partic, +10:u00:partic, +12:u08:Polycomb, +12:u07:Polycomb, +12:u06:Polycomb, +12:u14:polycomb, +12:u05:Polycomb, +12:u13:polycomb, +12:uI2:()(:)(:), +12:u04:Polycomb, +12:u12:polycomb, +12:uI1:()(:)(:), +12:u03:Polycomb, +12:u11:polycomb, +12:uI0:()(:)(:), +12:u02:Polycomb, +12:u10:polycomb, +12:u01:Polycomb, +12:u00:Polycomb, +14:u14:mitigation, +14:u13:mitigation, +14:u12:mitigation, +14:u11:mitigation, +14:u10:mitigation, +11:u08:Addgene, +10:u08:Férec, +11:u07:Addgene, +11:u06:Addgene, +10:u07:Férec, +11:u14:addgene, +11:u05:Addgene, +10:u06:Férec, +11:u08:Kunieda, +16:u08:pEThT-RvLEAM, +11:u13:addgene, +10:u14:férec, +11:u04:Addgene, +10:u05:Férec, +16:u07:pEThT-RvLEAM, +11:u12:addgene, +10:u13:férec, +10:uI2:(#)].-, +11:u03:Addgene, +10:u04:Férec, +11:u07:Kunieda, +16:u06:pEThT-RvLEAM, +11:u11:addgene, +10:u12:férec, +7:u21:Fé, +8:u22:Fér, +9:u23:Fére, +10:uI1:(#)].-, +11:u02:Addgene, +10:u03:Férec, +11:u06:Kunieda, +16:u05:pEThT-RvLEAM, +11:u10:addgene, +10:u11:férec, +11:u14:kunieda, +10:uI0:(#)].-, +11:u01:Addgene, +10:u02:Férec, +11:u05:Kunieda, +16:u04:pEThT-RvLEAM, +10:u10:férec, +11:u13:kunieda, +9:uI2:(#)]., +11:u00:Addgene, +10:u01:Férec, +11:u04:Kunieda, +8:u08:tani, +16:u03:pEThT-RvLEAM, +11:u12:kunieda, +8:u23:Kuni, +9:uI1:(#)]., +10:u00:Férec, +11:u03:Kunieda, +16:u02:pEThT-RvLEAM, +9:u08:broth, +11:u11:kunieda, +9:uI0:(#)]., +11:u02:Kunieda, +8:u07:tani, +16:u01:pEThT-RvLEAM, +9:u07:broth, +11:u10:kunieda, +11:u01:Kunieda, +8:u06:tani, +16:u00:pEThT-RvLEAM, +9:u06:broth, +15:u08:antibiotic., +8:u14:tani, +11:u00:Kunieda, +8:u05:tani, +9:u05:broth, +15:u07:antibiotic., +8:u13:tani, +8:u04:tani, +9:u04:broth, +15:u06:antibiotic., +8:u12:tani, +8:u23:tani, +8:u03:tani, +9:u03:broth, +15:u05:antibiotic., +8:u11:tani, +8:u02:tani, +9:u02:broth, +15:u04:antibiotic., +8:u10:tani, +10:uI2:.---(), +8:u01:tani, +9:u01:broth, +15:u03:antibiotic., +10:uI1:.---(), +8:u00:tani, +9:u00:broth, +15:u02:antibiotic., +10:uI0:.---(), +15:u01:antibiotic., +14:u08:nickel-NTA, +15:u00:antibiotic., +14:u07:nickel-NTA, +14:u06:nickel-NTA, +14:u05:nickel-NTA, +8:u08:MWCO, +14:u04:nickel-NTA, +14:u03:nickel-NTA, +8:u07:MWCO, +14:u02:nickel-NTA, +8:u06:MWCO, +14:u01:nickel-NTA, +8:u14:mwco, +8:u05:MWCO, +9:u08:PAGE., +14:u00:nickel-NTA, +8:u13:mwco, +8:u04:MWCO, +8:u08:5-10, +10:u08:Chosen, +8:u12:mwco, +7:u22:MWC, +8:u23:MWCO, +8:u03:MWCO, +9:u07:PAGE., +10:u07:Chosen, +8:u11:mwco, +8:u02:MWCO, +9:u06:PAGE., +8:u07:5-10, +10:u06:Chosen, +8:u10:mwco, +8:u01:MWCO, +9:u05:PAGE., +8:u06:5-10, +10:u05:Chosen, +8:u14:5-10, +8:u00:MWCO, +9:u04:PAGE., +8:u05:5-10, +10:u04:Chosen, +8:u13:5-10, +9:u03:PAGE., +8:u04:5-10, +10:u03:Chosen, +8:u12:5-10, +8:u23:5-10, +9:u02:PAGE., +8:u03:5-10, +10:u02:Chosen, +8:u11:5-10, +9:u01:PAGE., +8:u02:5-10, +10:u01:Chosen, +8:u10:5-10, +9:u00:PAGE., +8:u01:5-10, +10:u00:Chosen, +8:u00:5-10, +10:u08:ResLog, +16:u08:Per-particle, +10:u07:ResLog, +10:u06:ResLog, +16:u07:Per-particle, +10:u14:reslog, +10:u05:ResLog, +16:u06:Per-particle, +10:u13:reslog, +16:u14:per-particle, +10:u04:ResLog, +16:u05:Per-particle, +10:u12:reslog, +16:u13:per-particle, +8:u23:ResL, +10:u03:ResLog, +16:u04:Per-particle, +10:u11:reslog, +16:u12:per-particle, +8:u23:Per-, +10:u02:ResLog, +16:u03:Per-particle, +10:u10:reslog, +16:u11:per-particle, +10:u01:ResLog, +16:u02:Per-particle, +16:u10:per-particle, +10:u00:ResLog, +16:u01:Per-particle, +16:u00:Per-particle, +10:u08:(1:40), +10:u07:(1:40), +10:u06:(1:40), +7:u08:mM), +10:u14:(1:40), +10:u05:(1:40), +7:u07:mM), +10:u13:(1:40), +10:u14:chapso, +10:u04:(1:40), +14:u08:Ln(ppSSNR), +7:u06:mM), +10:u12:(1:40), +10:u13:chapso, +8:u23:(1:4, +10:u03:(1:40), +7:u05:mM), +10:u11:(1:40), +10:u12:chapso, +10:u02:(1:40), +14:u07:Ln(ppSSNR), +7:u04:mM), +10:u10:(1:40), +10:u11:chapso, +10:u01:(1:40), +14:u06:Ln(ppSSNR), +7:u03:mM), +10:u10:chapso, +14:u14:ln(ppssnr), +10:u00:(1:40), +14:u05:Ln(ppSSNR), +7:u02:mM), +14:u13:ln(ppssnr), +14:u04:Ln(ppSSNR), +7:u01:mM), +14:u12:ln(ppssnr), +6:u21:Ln, +7:u22:Ln(, +8:u23:Ln(p, +14:u03:Ln(ppSSNR), +7:u00:mM), +14:u11:ln(ppssnr), +14:u02:Ln(ppSSNR), +14:u10:ln(ppssnr), +14:u01:Ln(ppSSNR), +14:u00:Ln(ppSSNR), +14:u08:α-primase, +14:u07:α-primase, +14:u06:α-primase, +14:u05:α-primase, +14:u04:α-primase, +14:u03:α-primase, +11:u08:ppSSNR,, +14:u02:α-primase, +14:u01:α-primase, +11:u07:ppSSNR,, +14:u00:α-primase, +11:u06:ppSSNR,, +11:u14:ppssnr,, +11:u05:ppSSNR,, +11:u13:ppssnr,, +11:u04:ppSSNR,, +11:u12:ppssnr,, +7:u22:ppS, +8:u23:ppSS, +11:u03:ppSSNR,, +11:u11:ppssnr,, +11:u02:ppSSNR,, +11:u10:ppssnr,, +11:u01:ppSSNR,, +11:u08:primase, +11:u00:ppSSNR,, +11:u07:primase, +11:u06:primase, +11:u08:System), +11:u14:primase, +11:u05:primase, +11:u13:primase, +11:u04:primase, +11:u07:System), +10:u08:PRIM2), +11:u12:primase, +11:u03:primase, +11:u06:System), +10:u07:PRIM2), +8:u08:T.ni, +11:u11:primase, +11:u14:system), +10:uI2:.,(.)(, +11:u02:primase, +11:u05:System), +10:u06:PRIM2), +8:u07:T.ni, +11:u10:primase, +11:u13:system), +10:uI1:.,(.)(, +9:uI2:)(,,,, +11:u01:primase, +11:u04:System), +10:u05:PRIM2), +8:u06:T.ni, +11:u12:system), +10:uI0:.,(.)(, +9:uI1:)(,,,, +9:uI2:)--.-, +11:u00:primase, +11:u03:System), +10:u04:PRIM2), +8:u05:T.ni, +11:u11:system), +9:uI0:)(,,,, +9:uI1:)--.-, +11:u02:System), +8:u08:(IBA, +10:u03:PRIM2), +8:u04:T.ni, +11:u10:system), +9:uI0:)--.-, +11:u01:System), +10:u02:PRIM2), +8:u03:T.ni, +16:u08:LifeScience), +11:u00:System), +8:u07:(IBA, +10:u01:PRIM2), +8:u02:T.ni, +16:u07:LifeScience), +8:u06:(IBA, +10:u00:PRIM2), +8:u01:T.ni, +16:u06:LifeScience), +8:u14:(iba, +8:u05:(IBA, +12:u08:Purified, +8:u00:T.ni, +16:u05:LifeScience), +8:u13:(iba, +8:u04:(IBA, +16:u04:LifeScience), +8:u12:(iba, +8:u23:(IBA, +8:u03:(IBA, +12:u07:Purified, +16:u03:LifeScience), +8:u11:(iba, +8:u02:(IBA, +12:u06:Purified, +16:u02:LifeScience), +8:u10:(iba, +8:u01:(IBA, +12:u05:Purified, +16:u01:LifeScience), +8:u00:(IBA, +12:u04:Purified, +16:u00:LifeScience), +12:u03:Purified, +12:u02:Purified, +12:u01:Purified, +12:u00:Purified, +12:u08:EasiGlow, +10:u08:C-flat, +10:u07:C-flat, +18:u08:glow-discharge, +12:u07:EasiGlow, +10:u06:C-flat, +18:u07:glow-discharge, +12:u06:EasiGlow, +10:u05:C-flat, +18:u06:glow-discharge, +12:u14:easiglow, +9:uI2:-./.,, +12:u05:EasiGlow, +10:u04:C-flat, +18:u05:glow-discharge, +12:u13:easiglow, +9:uI1:-./.,, +12:u04:EasiGlow, +10:u03:C-flat, +18:u04:glow-discharge, +12:u12:easiglow, +8:u23:Easi, +9:uI0:-./.,, +12:u03:EasiGlow, +10:u02:C-flat, +18:u03:glow-discharge, +12:u11:easiglow, +12:u02:EasiGlow, +10:u01:C-flat, +18:u02:glow-discharge, +12:u10:easiglow, +12:u01:EasiGlow, +10:u00:C-flat, +18:u01:glow-discharge, +12:u00:EasiGlow, +11:u08:blotted, +18:u00:glow-discharge, +11:u07:blotted, +11:u06:blotted, +11:u14:blotted, +11:u05:blotted, +11:u13:blotted, +11:u04:blotted, +11:u12:blotted, +11:u03:blotted, +11:u11:blotted, +11:u02:blotted, +11:u10:blotted, +11:u01:blotted, +11:u00:blotted, +14:u08:BioQuantum, +6:u08:kV, +6:u07:kV, +6:u08:K3, +14:u07:BioQuantum, +6:u06:kV, +6:u07:K3, +14:u06:BioQuantum, +9:u08:1.064, +6:u05:kV, +6:u06:K3, +12:u08:SerialEM, +14:u14:bioquantum, +14:u05:BioQuantum, +6:u04:kV, +6:u05:K3, +12:u07:SerialEM, +13:u08:Å/pixel,, +14:u13:bioquantum, +14:u04:BioQuantum, +9:u07:1.064, +6:u03:kV, +6:u04:K3, +12:u06:SerialEM, +13:u07:Å/pixel,, +14:u12:bioquantum, +8:u23:BioQ, +14:u03:BioQuantum, +9:u06:1.064, +6:u02:kV, +6:u03:K3, +12:u05:SerialEM, +13:u06:Å/pixel,, +9:u08:slit., +14:u11:bioquantum, +9:u14:1.064, +14:u02:BioQuantum, +9:u05:1.064, +6:u01:kV, +6:u02:K3, +12:u04:SerialEM, +13:u05:Å/pixel,, +9:u07:slit., +14:u10:bioquantum, +9:u13:1.064, +11:u14:frames., +9:uI2:./,--, +14:u01:BioQuantum, +9:u04:1.064, +6:u00:kV, +6:u01:K3, +12:u03:SerialEM, +13:u04:Å/pixel,, +9:u06:slit., +9:u12:1.064, +11:u13:frames., +9:uI1:./,--, +14:u00:BioQuantum, +9:u03:1.064, +6:u00:K3, +12:u02:SerialEM, +13:u03:Å/pixel,, +9:u05:slit., +9:u11:1.064, +11:u12:frames., +9:uI0:./,--, +10:uI2:.--..-, +9:u02:1.064, +12:u01:SerialEM, +13:u02:Å/pixel,, +9:u04:slit., +9:u10:1.064, +11:u11:frames., +10:uI1:.--..-, +9:u01:1.064, +10:u08:mated., +12:u00:SerialEM, +13:u01:Å/pixel,, +9:u03:slit., +11:u10:frames., +10:uI0:.--..-, +9:u00:1.064, +13:u00:Å/pixel,, +9:u02:slit., +10:u07:mated., +9:u01:slit., +10:u06:mated., +9:u00:slit., +10:u14:mated., +10:u05:mated., +10:u13:mated., +10:u04:mated., +10:u12:mated., +10:u03:mated., +13:u08:1,724,984, +10:u11:mated., +10:u02:mated., +10:u10:mated., +10:u01:mated., +13:u07:1,724,984, +10:uI2:.,(:)., +10:u00:mated., +13:u06:1,724,984, +13:u14:1,724,984, +10:uI1:.,(:)., +13:u05:1,724,984, +13:u13:1,724,984, +10:uI0:.,(:)., +11:uI2:,,(./)., +13:u04:1,724,984, +13:u12:1,724,984, +8:u23:1,72, +11:uI1:,,(./)., +13:u03:1,724,984, +9:u08:cles,, +12:u08:Å/pixel, +13:u11:1,724,984, +11:uI0:,,(./)., +13:u02:1,724,984, +12:u07:Å/pixel, +9:u08:75%)., +13:u10:1,724,984, +13:u01:1,724,984, +9:u07:cles,, +12:u06:Å/pixel, +9:u07:75%)., +13:u00:1,724,984, +9:u06:cles,, +12:u05:Å/pixel, +9:u06:75%)., +9:u14:cles,, +9:uI2:./(,-, +9:u05:cles,, +12:u04:Å/pixel, +9:u05:75%)., +9:u13:cles,, +9:uI1:./(,-, +9:u04:cles,, +12:u03:Å/pixel, +9:u04:75%)., +9:u12:cles,, +9:uI0:./(,-, +9:u03:cles,, +12:u02:Å/pixel, +9:u03:75%)., +9:u11:cles,, +9:u02:cles,, +12:u01:Å/pixel, +9:u02:75%)., +9:u10:cles,, +9:u01:cles,, +12:u00:Å/pixel, +9:u01:75%)., +9:u00:cles,, +9:u00:75%)., +10:u14:initio, +10:u13:initio, +10:u12:initio, +7:u08:4x,, +10:u11:initio, +7:u07:4x,, +10:u10:initio, +7:u06:4x,, +7:u14:ned, +7:u05:4x,, +7:u13:ned, +7:u04:4x,, +7:u12:ned, +7:u23:ned, +8:u08:parc, +7:u03:4x,, +7:u11:ned, +7:u02:4x,, +7:u10:ned, +8:u07:parc, +7:u01:4x,, +14:u08:filtering,, +15:u14:non-uniform, +8:u06:parc, +7:u00:4x,, +14:u07:filtering,, +15:u13:non-uniform, +8:u05:parc, +14:u06:filtering,, +15:u12:non-uniform, +8:u04:parc, +14:u05:filtering,, +15:u11:non-uniform, +8:u03:parc, +14:u04:filtering,, +15:u10:non-uniform, +8:u02:parc, +14:u03:filtering,, +8:u01:parc, +14:u02:filtering,, +8:u00:parc, +14:u01:filtering,, +14:u00:filtering,, +9:uI2:,(:)., +9:uI1:,(:)., +10:u08:74,198, +9:uI0:,(:)., +10:u07:74,198, +13:u08:Å/pixel), +10:u06:74,198, +13:u07:Å/pixel), +10:u05:74,198, +13:u06:Å/pixel), +10:u04:74,198, +13:u05:Å/pixel), +10:u03:74,198, +13:u04:Å/pixel), +10:u02:74,198, +13:u03:Å/pixel), +8:u08:1308, +10:u01:74,198, +13:u02:Å/pixel), +8:u07:1308, +10:u00:74,198, +13:u01:Å/pixel), +8:u06:1308, +13:u00:Å/pixel), +8:u05:1308, +8:u04:1308, +12:u08:ticles)., +8:u03:1308, +8:u02:1308, +13:u08:Extracted, +12:u07:ticles)., +8:u01:1308, +13:u07:Extracted, +12:u06:ticles)., +8:u00:1308, +13:u06:Extracted, +12:u14:ticles)., +10:uI2:-./(,-, +12:u05:ticles)., +13:u05:Extracted, +11:u08:674,793, +12:u13:ticles)., +10:uI1:-./(,-, +12:u04:ticles)., +13:u04:Extracted, +11:u07:674,793, +12:u12:ticles)., +10:uI0:-./(,-, +12:u03:ticles)., +13:u03:Extracted, +11:u06:674,793, +12:u11:ticles)., +12:u02:ticles)., +13:u02:Extracted, +11:u05:674,793, +12:u10:ticles)., +12:u01:ticles)., +13:u01:Extracted, +11:u04:674,793, +12:u00:ticles)., +13:u00:Extracted, +11:u03:674,793, +11:u02:674,793, +11:u01:674,793, +11:u00:674,793, +10:uI2:,./,,-, +10:uI1:,./,,-, +10:uI0:,./,,-, +16:u08:per-particle, +16:u07:per-particle, +16:u06:per-particle, +16:u05:per-particle, +16:u04:per-particle, +14:u08:struction., +16:u03:per-particle, +10:uI2:,.(:)., +16:u02:per-particle, +10:uI1:,.(:)., +14:u07:struction., +16:u01:per-particle, +10:uI0:,.(:)., +14:u06:struction., +16:u00:per-particle, +14:u14:struction., +14:u05:struction., +14:u13:struction., +9:uI2:.,-./, +14:u04:struction., +14:u12:struction., +9:uI1:.,-./, +14:u03:struction., +13:u08:1,755,138, +8:u08:4333, +14:u11:struction., +9:uI0:.,-./, +14:u02:struction., +8:u07:4333, +14:u10:struction., +14:u01:struction., +13:u07:1,755,138, +8:u06:4333, +7:u08:4x., +14:u00:struction., +13:u06:1,755,138, +8:u05:4333, +7:u07:4x., +11:u08:408,373, +13:u14:1,755,138, +13:u05:1,755,138, +8:u04:4333, +7:u06:4x., +11:u07:408,373, +13:u13:1,755,138, +13:u04:1,755,138, +8:u03:4333, +7:u05:4x., +11:u06:408,373, +8:u08:3746, +13:u12:1,755,138, +8:u23:1,75, +13:u03:1,755,138, +8:u02:4333, +7:u04:4x., +11:u05:408,373, +8:u07:3746, +13:u11:1,755,138, +13:u02:1,755,138, +8:u01:4333, +7:u03:4x., +11:u04:408,373, +8:u06:3746, +13:u10:1,755,138, +13:u01:1,755,138, +8:u00:4333, +7:u02:4x., +11:u03:408,373, +8:u05:3746, +9:uI2:(./)-, +13:u00:1,755,138, +7:u01:4x., +11:u02:408,373, +8:u04:3746, +9:uI1:(./)-, +11:u08:982,264, +7:u00:4x., +11:u01:408,373, +8:u03:3746, +9:uI0:(./)-, +11:u00:408,373, +8:u02:3746, +11:u07:982,264, +8:u01:3746, +11:u06:982,264, +8:u00:3746, +11:u14:982,264, +11:u05:982,264, +11:u13:982,264, +11:u04:982,264, +11:u12:982,264, +8:u23:982,, +11:u03:982,264, +11:u11:982,264, +11:u02:982,264, +11:u10:982,264, +11:u01:982,264, +11:u00:982,264, +13:u08:2,084,816, +13:u07:2,084,816, +13:u06:2,084,816, +13:u14:2,084,816, +13:u05:2,084,816, +14:u08:Å/pixel)., +13:u13:2,084,816, +13:u04:2,084,816, +14:u07:Å/pixel)., +13:u12:2,084,816, +13:u03:2,084,816, +11:u08:366,459, +14:u06:Å/pixel)., +13:u11:2,084,816, +13:u02:2,084,816, +14:u05:Å/pixel)., +13:u10:2,084,816, +11:uI2:(./).-,, +13:u01:2,084,816, +11:u07:366,459, +14:u04:Å/pixel)., +11:uI1:(./).-,, +13:u00:2,084,816, +11:u06:366,459, +14:u03:Å/pixel)., +11:u14:366,459, +11:uI0:(./).-,, +11:u05:366,459, +14:u02:Å/pixel)., +11:u13:366,459, +11:u04:366,459, +14:u01:Å/pixel)., +11:u12:366,459, +11:u03:366,459, +14:u00:Å/pixel)., +11:u11:366,459, +11:u02:366,459, +11:u10:366,459, +11:u01:366,459, +11:u00:366,459, +9:uI2:-(./), +9:uI1:-(./), +9:uI0:-(./), +9:u08:8FYH), +9:u08:5EXR), +9:u07:5EXR), +9:u07:8FYH), +9:u06:5EXR), +9:u06:8FYH), +9:u05:5EXR), +9:u14:8fyh), +9:uI2::)(,:, +9:u05:8FYH), +9:u04:5EXR), +9:u13:8fyh), +9:uI1::)(,:, +9:u04:8FYH), +9:u03:5EXR), +9:u12:8fyh), +6:u21:8F, +7:u22:8FY, +8:u23:8FYH, +9:uI0::)(,:, +9:u03:8FYH), +9:u02:5EXR), +9:u11:8fyh), +9:u02:8FYH), +9:u01:5EXR), +9:u10:8fyh), +9:u01:8FYH), +9:u00:5EXR), +9:u00:8FYH), +23:u08:Rosenthal-Henderson, +11:u14:tables., +11:u13:tables., +23:u07:Rosenthal-Henderson, +11:u12:tables., +23:u06:Rosenthal-Henderson, +11:u11:tables., +23:u14:rosenthal-henderson, +23:u05:Rosenthal-Henderson, +11:u10:tables., +23:u13:rosenthal-henderson, +23:u04:Rosenthal-Henderson, +11:u08:30,000,, +23:u12:rosenthal-henderson, +23:u03:Rosenthal-Henderson, +10:u08:ppSSNR, +11:u08:60,000,, +23:u11:rosenthal-henderson, +23:u02:Rosenthal-Henderson, +11:u07:30,000,, +11:u07:60,000,, +23:u10:rosenthal-henderson, +23:u01:Rosenthal-Henderson, +11:u06:30,000,, +10:u07:ppSSNR, +11:u06:60,000,, +11:u14:30,000,, +23:u00:Rosenthal-Henderson, +11:u05:30,000,, +10:u06:ppSSNR, +9:u08:(SCF), +11:u05:60,000,, +7:u08:FSC, +11:u13:30,000,, +10:u14:ppssnr, +11:u04:30,000,, +10:u05:ppSSNR, +15:u08:Tilt-series, +11:u04:60,000,, +7:u07:FSC, +9:u08:56,67, +11:u12:30,000,, +10:u13:ppssnr, +11:u03:30,000,, +10:u04:ppSSNR, +9:u07:(SCF), +8:u08:Tilt, +11:u03:60,000,, +7:u06:FSC, +9:u07:56,67, +11:u11:30,000,, +10:u12:ppssnr, +11:u14:conical, +11:u02:30,000,, +10:u03:ppSSNR, +9:u06:(SCF), +15:u07:Tilt-series, +11:u02:60,000,, +7:u05:FSC, +9:u06:56,67, +11:u10:30,000,, +10:u11:ppssnr, +11:u13:conical, +9:u14:(scf), +11:u01:30,000,, +10:u02:ppSSNR, +9:u05:(SCF), +15:u06:Tilt-series, +8:u07:Tilt, +11:u01:60,000,, +7:u04:FSC, +9:u05:56,67, +10:u10:ppssnr, +11:u12:conical, +9:u13:(scf), +15:u14:tilt-series, +8:u23:coni, +11:u00:30,000,, +10:u01:ppSSNR, +9:u04:(SCF), +15:u05:Tilt-series, +8:u06:Tilt, +11:u00:60,000,, +7:u03:FSC, +9:u04:56,67, +11:u11:conical, +9:u12:(scf), +15:u13:tilt-series, +8:u14:tilt, +7:u22:(SC, +8:u23:(SCF, +10:u00:ppSSNR, +9:u03:(SCF), +15:u04:Tilt-series, +8:u05:Tilt, +7:u02:FSC, +9:u03:56,67, +11:u10:conical, +9:u11:(scf), +15:u12:tilt-series, +8:u13:tilt, +8:u23:Tilt, +9:u02:(SCF), +15:u03:Tilt-series, +8:u04:Tilt, +7:u01:FSC, +9:u02:56,67, +9:u10:(scf), +15:u11:tilt-series, +8:u12:tilt, +9:u01:(SCF), +15:u02:Tilt-series, +8:u03:Tilt, +7:u00:FSC, +9:u01:56,67, +15:u10:tilt-series, +8:u11:tilt, +12:u14:serialem, +9:u00:(SCF), +15:u01:Tilt-series, +8:u02:Tilt, +9:u00:56,67, +8:u08:tilt, +8:u10:tilt, +12:u13:serialem, +8:uI2:.-//, +15:u00:Tilt-series, +8:u01:Tilt, +8:u07:tilt, +11:u08:defocus, +12:u12:serialem, +8:uI1:.-//, +8:u00:Tilt, +8:u06:tilt, +11:u07:defocus, +14:u08:five-frame, +12:u11:serialem, +8:uI0:.-//, +8:u05:tilt, +11:u06:defocus, +14:u07:five-frame, +12:u10:serialem, +8:u04:tilt, +11:u05:defocus, +14:u06:five-frame, +10:u08:cisTEM, +8:u03:tilt, +11:u04:defocus, +14:u05:five-frame, +11:uI2:-,-/,,,, +8:u02:tilt, +11:u03:defocus, +14:u04:five-frame, +11:uI1:-,-/,,,, +10:u07:cisTEM, +8:u01:tilt, +11:u02:defocus, +14:u03:five-frame, +11:uI0:-,-/,,,, +10:u06:cisTEM, +12:u08:denoised, +8:u00:tilt, +11:u01:defocus, +14:u02:five-frame, +10:u14:cistem, +10:u05:cisTEM, +11:u00:defocus, +14:u01:five-frame, +10:u13:cistem, +10:u04:cisTEM, +12:u07:denoised, +8:u08:IMOD, +14:u00:five-frame, +10:u12:cistem, +8:u23:cisT, +10:u03:cisTEM, +12:u06:denoised, +10:u11:cistem, +12:u14:denoised, +10:u02:cisTEM, +12:u05:denoised, +8:u07:IMOD, +10:u10:cistem, +12:u13:denoised, +10:u01:cisTEM, +12:u04:denoised, +8:u06:IMOD, +12:u12:denoised, +8:u14:imod, +10:u00:cisTEM, +12:u03:denoised, +8:u05:IMOD, +12:u11:denoised, +8:u13:imod, +12:u02:denoised, +8:u04:IMOD, +18:u08:contaminations, +12:u10:denoised, +8:u12:imod, +7:u22:IMO, +8:u23:IMOD, +12:u01:denoised, +8:u03:IMOD, +18:u07:contaminations, +8:u11:imod, +12:u00:denoised, +8:u02:IMOD, +18:u06:contaminations, +8:u10:imod, +8:u01:IMOD, +18:u05:contaminations, +8:u00:IMOD, +18:u04:contaminations, +18:u03:contaminations, +18:u02:contaminations, +18:u01:contaminations, +17:u08:(PP)-AavLEA1,, +18:u00:contaminations, +8:u08:1:40, +7:u08:1:8, +17:u07:(PP)-AavLEA1,, +13:u08:PP-RvLEAM, +7:u07:1:8, +17:u06:(PP)-AavLEA1,, +8:u07:1:40, +7:u06:1:8, +17:u14:(pp)-aavlea1,, +17:u05:(PP)-AavLEA1,, +8:u06:1:40, +13:u07:PP-RvLEAM, +7:u05:1:8, +17:u13:(pp)-aavlea1,, +8:u14:1:40, +13:uI2:()-,:-,-,, +17:u04:(PP)-AavLEA1,, +8:u05:1:40, +13:u06:PP-RvLEAM, +15:u08:PRC2-RvLEAM, +7:u04:1:8, +17:u12:(pp)-aavlea1,, +8:u13:1:40, +13:u14:pp-rvleam, +8:u23:(PP), +13:uI1:()-,:-,-,, +8:uI2::--,, +17:u03:(PP)-AavLEA1,, +8:u04:1:40, +13:u05:PP-RvLEAM, +7:u03:1:8, +17:u11:(pp)-aavlea1,, +8:u12:1:40, +13:u13:pp-rvleam, +8:u23:1:40, +13:uI0:()-,:-,-,, +8:uI1::--,, +10:uI2:-,:-,-, +17:u02:(PP)-AavLEA1,, +8:u03:1:40, +13:u04:PP-RvLEAM, +15:u07:PRC2-RvLEAM, +10:u08:43622,, +7:u02:1:8, +17:u10:(pp)-aavlea1,, +8:u11:1:40, +13:u12:pp-rvleam, +7:u22:PP-, +8:u23:PP-R, +8:uI0::--,, +10:uI1:-,:-,-, +17:u01:(PP)-AavLEA1,, +8:u02:1:40, +13:u03:PP-RvLEAM, +15:u06:PRC2-RvLEAM, +14:u08:EMD-43623,, +7:u01:1:8, +8:u10:1:40, +13:u11:pp-rvleam, +15:u14:prc2-rvleam, +10:uI0:-,:-,-, +11:uI2:()-,:-,, +17:u00:(PP)-AavLEA1,, +8:u01:1:40, +13:u02:PP-RvLEAM, +15:u05:PRC2-RvLEAM, +10:u07:43622,, +7:u00:1:8, +13:u10:pp-rvleam, +15:u13:prc2-rvleam, +11:uI1:()-,:-,, +9:uI2:-,:-,, +8:u00:1:40, +13:u01:PP-RvLEAM, +15:u04:PRC2-RvLEAM, +10:u06:43622,, +14:u07:EMD-43623,, +10:u08:PDB-ID, +15:u12:prc2-rvleam, +10:u14:43622,, +11:uI0:()-,:-,, +9:uI1:-,:-,, +9:uI2:-,:,-, +13:u00:PP-RvLEAM, +15:u03:PRC2-RvLEAM, +10:u05:43622,, +14:u06:EMD-43623,, +10:u07:PDB-ID, +13:u08:EMD-45273, +15:u11:prc2-rvleam, +10:u13:43622,, +14:u14:emd-43623,, +9:uI0:-,:-,, +9:uI1:-,:,-, +9:uI2:,-,:,, +15:u02:PRC2-RvLEAM, +10:u04:43622,, +14:u05:EMD-43623,, +10:u06:PDB-ID, +13:u07:EMD-45273, +12:u08:(movies), +15:u10:prc2-rvleam, +10:u12:43622,, +14:u13:emd-43623,, +8:u23:4362, +9:uI0:-,:,-, +9:uI1:,-,:,, +10:uI2:-,-,:,, +15:u01:PRC2-RvLEAM, +10:u03:43622,, +14:u04:EMD-43623,, +15:u08:PP-AavLEA1,, +10:u05:PDB-ID, +13:u06:EMD-45273, +12:u07:(movies), +10:u11:43622,, +14:u12:emd-43623,, +7:u22:EMD, +8:u23:EMD-, +9:uI0:,-,:,, +10:uI1:-,-,:,, +15:u00:PRC2-RvLEAM, +10:u02:43622,, +14:u03:EMD-43623,, +10:u04:PDB-ID, +13:u05:EMD-45273, +12:u06:(movies), +10:u10:43622,, +14:u11:emd-43623,, +10:uI0:-,-,:,, +17:uI2:-[://...//-]., +10:u01:43622,, +14:u02:EMD-43623,, +15:u07:PP-AavLEA1,, +10:u03:PDB-ID, +13:u04:EMD-45273, +12:u05:(movies), +14:u10:emd-43623,, +17:uI1:-[://...//-]., +10:u00:43622,, +14:u01:EMD-43623,, +15:u06:PP-AavLEA1,, +10:u02:PDB-ID, +13:u03:EMD-45273, +12:u04:(movies), +15:u14:pp-aavlea1,, +17:uI0:-[://...//-]., +14:u00:EMD-43623,, +15:u05:PP-AavLEA1,, +10:u01:PDB-ID, +13:u02:EMD-45273, +12:u03:(movies), +15:u13:pp-aavlea1,, +15:u04:PP-AavLEA1,, +10:u00:PDB-ID, +13:u01:EMD-45273, +12:u02:(movies), +15:u12:pp-aavlea1,, +8:u23:PP-A, +15:u03:PP-AavLEA1,, +13:u00:EMD-45273, +12:u01:(movies), +15:u11:pp-aavlea1,, +15:u02:PP-AavLEA1,, +13:u08:PP-CHAPSO, +12:u00:(movies), +15:u10:pp-aavlea1,, +15:u01:PP-AavLEA1,, +17:u08:PRC2-AavLEA1,, +15:u00:PP-AavLEA1,, +13:u07:PP-CHAPSO, +13:u06:PP-CHAPSO, +17:u07:PRC2-AavLEA1,, +10:u08:11976,, +13:u14:pp-chapso, +13:u05:PP-CHAPSO, +17:u06:PRC2-AavLEA1,, +13:u13:pp-chapso, +17:u14:prc2-aavlea1,, +13:u04:PP-CHAPSO, +17:u05:PRC2-AavLEA1,, +10:u07:11976,, +13:u12:pp-chapso, +17:u13:prc2-aavlea1,, +8:u23:PP-C, +13:u03:PP-CHAPSO, +17:u04:PRC2-AavLEA1,, +10:u06:11976,, +13:u11:pp-chapso, +17:u12:prc2-aavlea1,, +10:u14:11976,, +13:u02:PP-CHAPSO, +17:u03:PRC2-AavLEA1,, +10:u05:11976,, +13:u10:pp-chapso, +17:u11:prc2-aavlea1,, +10:u13:11976,, +13:u01:PP-CHAPSO, +17:u02:PRC2-AavLEA1,, +10:u04:11976,, +17:u10:prc2-aavlea1,, +10:u12:11976,, +8:u23:1197, +13:u00:PP-CHAPSO, +17:u01:PRC2-AavLEA1,, +10:u03:11976,, +10:u08:12140., +10:u11:11976,, +17:u00:PRC2-AavLEA1,, +10:u02:11976,, +10:u10:11976,, +10:u01:11976,, +10:u07:12140., +10:u08:43621., +12:u14:uploaded, +10:u00:11976,, +10:u06:12140., +12:u13:uploaded, +10:u14:12140., +10:u05:12140., +10:u07:43621., +12:u12:uploaded, +10:u13:12140., +8:u23:uplo, +10:u04:12140., +10:u06:43621., +12:u11:uploaded, +10:u12:12140., +10:u14:43621., +9:uI2:--,:-, +10:u03:12140., +10:u05:43621., +12:u10:uploaded, +10:u11:12140., +10:u13:43621., +9:uI1:--,:-, +10:u02:12140., +10:u04:43621., +13:u08:1443-1444, +16:u08:Kühlbrandt,, +10:u10:12140., +10:u12:43621., +9:uI0:--,:-, +10:u01:12140., +10:u03:43621., +16:u07:Kühlbrandt,, +10:u11:43621., +10:u00:12140., +10:u02:43621., +13:u07:1443-1444, +16:u06:Kühlbrandt,, +8:u08:Han,, +10:u10:43621., +10:u01:43621., +13:u06:1443-1444, +10:u08:102646, +16:u05:Kühlbrandt,, +8:u07:Han,, +13:u14:1443-1444, +10:u00:43621., +13:u05:1443-1444, +16:u04:Kühlbrandt,, +8:u06:Han,, +13:u13:1443-1444, +13:u04:1443-1444, +10:u07:102646, +16:u03:Kühlbrandt,, +8:u05:Han,, +13:u12:1443-1444, +8:u23:1443, +19:uI2:.,.-.,-,.,,.,.., +13:u03:1443-1444, +10:u06:102646, +16:u02:Kühlbrandt,, +8:u04:Han,, +19:u08:single-particle, +13:u11:1443-1444, +10:u14:102646, +19:uI1:.,.-.,-,.,,.,.., +13:u02:1443-1444, +10:u05:102646, +16:u01:Kühlbrandt,, +8:u03:Han,, +19:u07:single-particle, +14:u08:D'Imprima,, +13:u10:1443-1444, +10:u13:102646, +19:uI0:.,.-.,-,.,,.,.., +13:u01:1443-1444, +10:u04:102646, +16:u00:Kühlbrandt,, +8:u02:Han,, +19:u06:single-particle, +14:u07:D'Imprima,, +10:u12:102646, +13:u00:1443-1444, +10:u03:102646, +13:u08:air-water, +8:u01:Han,, +19:u05:single-particle, +14:u06:D'Imprima,, +10:u08:Noble,, +10:u11:102646, +10:u02:102646, +8:u00:Han,, +19:u04:single-particle, +14:u05:D'Imprima,, +10:u07:Noble,, +10:u10:102646, +10:uI2:.',..-, +10:u01:102646, +13:u07:air-water, +19:u03:single-particle, +14:u04:D'Imprima,, +10:u06:Noble,, +10:uI1:.',..-, +10:u00:102646, +13:u06:air-water, +19:u02:single-particle, +14:u03:D'Imprima,, +10:u05:Noble,, +10:uI0:.',..-, +13:u05:air-water, +19:u01:single-particle, +14:u02:D'Imprima,, +10:u04:Noble,, +12:u08:Glaeser,, +13:uI2:--..,-()., +13:u04:air-water, +19:u00:single-particle, +14:u01:D'Imprima,, +10:u03:Noble,, +12:u07:Glaeser,, +8:u23:air-, +13:uI1:--..,-()., +13:u03:air-water, +14:u00:D'Imprima,, +10:u02:Noble,, +12:u06:Glaeser,, +13:uI0:--..,-()., +13:u02:air-water, +10:u01:Noble,, +12:u05:Glaeser,, +14:uI2:.,..,,-..., +13:u01:air-water, +10:u00:Noble,, +12:u04:Glaeser,, +14:uI1:.,..,,-..., +13:u00:air-water, +12:u03:Glaeser,, +14:uI0:.,..,,-..., +14:uI2:.,..,.-.:-, +12:u02:Glaeser,, +7:u14:1-7, +14:uI1:.,..,.-.:-, +11:u08:214-223, +12:u01:Glaeser,, +7:u13:1-7, +14:uI0:.,..,.-.:-, +12:u00:Glaeser,, +7:u12:1-7, +7:u23:1-7, +11:u07:214-223, +13:u08:workflow., +7:u11:1-7, +11:u06:214-223, +7:u10:1-7, +11:u14:214-223, +11:u05:214-223, +13:u07:workflow., +11:u08:Adrian,, +11:u13:214-223, +11:u04:214-223, +13:u06:workflow., +11:u07:Adrian,, +11:u12:214-223, +13:u14:workflow., +8:u23:214-, +11:u03:214-223, +13:u05:workflow., +11:u06:Adrian,, +13:u08:Dubochet,, +11:u11:214-223, +13:u13:workflow., +11:u02:214-223, +13:u04:workflow., +11:u05:Adrian,, +13:u07:Dubochet,, +11:u10:214-223, +13:u12:workflow., +17:uI2:.,.,,.,,.,..-, +11:u01:214-223, +13:u03:workflow., +10:u08:scopy:, +11:u04:Adrian,, +13:u06:Dubochet,, +13:u11:workflow., +17:uI1:.,.,,.,,.,..-, +11:u00:214-223, +13:u02:workflow., +11:u03:Adrian,, +13:u05:Dubochet,, +13:u10:workflow., +17:uI0:.,.,,.,,.,..-, +21:uI2:.,.,,.-.,,.,,.,.., +13:u01:workflow., +10:u07:scopy:, +11:u02:Adrian,, +13:u04:Dubochet,, +21:uI1:.,.,,.-.,,.,,.,.., +13:u00:workflow., +10:u06:scopy:, +11:u01:Adrian,, +13:u03:Dubochet,, +10:u14:scopy:, +21:uI0:.,.,,.-.,,.,,.,.., +10:u05:scopy:, +11:u00:Adrian,, +13:u02:Dubochet,, +10:u13:scopy:, +10:u04:scopy:, +13:u01:Dubochet,, +14:u08:Naydenova,, +10:u12:scopy:, +10:u03:scopy:, +13:u00:Dubochet,, +14:u07:Naydenova,, +10:u11:scopy:, +10:u02:scopy:, +14:u06:Naydenova,, +10:u10:scopy:, +10:u01:scopy:, +14:u05:Naydenova,, +10:u00:scopy:, +26:u08:1016/j.jmb.2022.167926, +14:u04:Naydenova,, +14:u03:Naydenova,, +26:u07:1016/j.jmb.2022.167926, +14:u02:Naydenova,, +13:uI2:.,.,.-.-:, +26:u06:1016/j.jmb.2022.167926, +14:u01:Naydenova,, +26:u14:1016/j.jmb.2022.167926, +13:uI1:.,.,.-.-:, +15:uI2:-?...://./., +26:u05:1016/j.jmb.2022.167926, +14:u00:Naydenova,, +15:u08:microscopy:, +26:u13:1016/j.jmb.2022.167926, +13:uI0:.,.,.-.-:, +15:uI1:-?...://./., +11:uI2:/...()., +26:u04:1016/j.jmb.2022.167926, +15:u07:microscopy:, +26:u12:1016/j.jmb.2022.167926, +15:uI0:-?...://./., +11:uI1:/...()., +26:u03:1016/j.jmb.2022.167926, +15:u06:microscopy:, +26:u11:1016/j.jmb.2022.167926, +11:uI0:/...()., +26:u02:1016/j.jmb.2022.167926, +11:u08:109-126, +15:u05:microscopy:, +26:u10:1016/j.jmb.2022.167926, +26:u01:1016/j.jmb.2022.167926, +15:u04:microscopy:, +26:u00:1016/j.jmb.2022.167926, +11:u07:109-126, +15:u03:microscopy:, +11:u06:109-126, +15:u02:microscopy:, +19:u08:cryomicroscopy., +11:u14:109-126, +11:u05:109-126, +9:u08:AEBP2, +15:u01:microscopy:, +19:u07:cryomicroscopy., +13:u08:Kasinath,, +11:u13:109-126, +11:u04:109-126, +15:u00:microscopy:, +19:u06:cryomicroscopy., +13:u07:Kasinath,, +11:u12:109-126, +11:u03:109-126, +9:u07:AEBP2, +19:u05:cryomicroscopy., +13:u06:Kasinath,, +11:u08:Adamus,, +11:u11:109-126, +11:u02:109-126, +9:u06:AEBP2, +19:u04:cryomicroscopy., +13:u05:Kasinath,, +11:u07:Adamus,, +11:u10:109-126, +9:u14:aebp2, +11:u01:109-126, +9:u05:AEBP2, +19:u03:cryomicroscopy., +13:u04:Kasinath,, +11:u06:Adamus,, +9:u13:aebp2, +11:u00:109-126, +9:u04:AEBP2, +19:u02:cryomicroscopy., +13:u03:Kasinath,, +11:u05:Adamus,, +9:u12:aebp2, +8:u23:AEBP, +20:uI2:.,.,,..,,.,,.,.:, +9:u03:AEBP2, +19:u01:cryomicroscopy., +13:u02:Kasinath,, +11:u04:Adamus,, +9:u11:aebp2, +20:uI1:.,.,,..,,.,,.,.:, +9:u02:AEBP2, +8:u08:117,, +19:u00:cryomicroscopy., +13:u01:Kasinath,, +11:u03:Adamus,, +9:u10:aebp2, +20:uI0:.,.,,..,,.,,.,.:, +9:u01:AEBP2, +13:u00:Kasinath,, +11:u02:Adamus,, +15:u08:24269-24273, +9:u00:AEBP2, +8:u07:117,, +11:u01:Adamus,, +15:u07:24269-24273, +8:u06:117,, +11:u00:Adamus,, +15:u06:24269-24273, +8:u14:117,, +8:u05:117,, +15:u05:24269-24273, +8:u13:117,, +8:u04:117,, +15:u04:24269-24273, +8:u12:117,, +8:u03:117,, +13:u08:4016-4025, +15:u03:24269-24273, +8:u11:117,, +8:u02:117,, +15:u02:24269-24273, +8:u10:117,, +8:u01:117,, +13:u07:4016-4025, +15:u01:24269-24273, +8:u00:117,, +13:u06:4016-4025, +15:u00:24269-24273, +12:u08:cryo-EM., +13:u14:4016-4025, +13:u05:4016-4025, +18:u08:graphene-oxide, +12:u07:cryo-EM., +13:u08:Palovcak,, +13:u13:4016-4025, +13:u04:4016-4025, +12:u06:cryo-EM., +13:u07:Palovcak,, +13:u12:4016-4025, +13:uI2:.,..,.-.-, +13:u03:4016-4025, +18:u07:graphene-oxide, +12:u05:cryo-EM., +13:u06:Palovcak,, +13:u11:4016-4025, +13:uI1:.,..,.-.-, +13:u02:4016-4025, +18:u06:graphene-oxide, +12:u04:cryo-EM., +13:u05:Palovcak,, +13:u10:4016-4025, +18:u14:graphene-oxide, +13:uI0:.,..,.-.-, +13:u01:4016-4025, +18:u05:graphene-oxide, +12:u03:cryo-EM., +13:u04:Palovcak,, +18:u13:graphene-oxide, +15:uI2:--....,-()., +13:u00:4016-4025, +18:u04:graphene-oxide, +12:u02:cryo-EM., +13:u03:Palovcak,, +18:u12:graphene-oxide, +19:u14:single-particle, +15:uI1:--....,-()., +18:u03:graphene-oxide, +12:u01:cryo-EM., +13:u02:Palovcak,, +18:u11:graphene-oxide, +19:u13:single-particle, +15:uI0:--....,-()., +13:uI2:--...,()., +18:u02:graphene-oxide, +13:u08:1009-1014, +12:u00:cryo-EM., +13:u01:Palovcak,, +16:u08:cryoelectron, +18:u10:graphene-oxide, +19:u12:single-particle, +13:uI1:--...,()., +18:u01:graphene-oxide, +13:u00:Palovcak,, +16:u07:cryoelectron, +19:u11:single-particle, +13:uI0:--...,()., +18:u00:graphene-oxide, +13:u07:1009-1014, +16:u06:cryoelectron, +13:u08:Esfahani,, +19:u10:single-particle, +13:u06:1009-1014, +16:u05:cryoelectron, +13:u07:Esfahani,, +13:u14:1009-1014, +13:u05:1009-1014, +16:u04:cryoelectron, +13:u06:Esfahani,, +13:u08:air/water, +13:u13:1009-1014, +13:u04:1009-1014, +16:u03:cryoelectron, +13:u05:Esfahani,, +13:u07:air/water, +13:u12:1009-1014, +13:u03:1009-1014, +16:u02:cryoelectron, +13:u04:Esfahani,, +13:u06:air/water, +13:u11:1009-1014, +13:u02:1009-1014, +16:u01:cryoelectron, +13:u03:Esfahani,, +13:u05:air/water, +13:u10:1009-1014, +13:u01:1009-1014, +14:u08:Chameleon:, +16:u00:cryoelectron, +13:u02:Esfahani,, +13:u04:air/water, +11:u08:Darrow,, +20:uI2:.,.,,.,,.,,.,..:, +13:u00:1009-1014, +13:u01:Esfahani,, +13:u03:air/water, +11:u07:Darrow,, +20:uI1:.,.,,.,,.,,.,..:, +14:u07:Chameleon:, +13:u00:Esfahani,, +13:u02:air/water, +11:u06:Darrow,, +13:u08:Spotiton., +20:uI0:.,.,,.,,.,,.,..:, +14:u06:Chameleon:, +13:u01:air/water, +11:u05:Darrow,, +13:u07:Spotiton., +11:u08:Dandey,, +14:u14:chameleon:, +22:uI2:.,..,,..,,..,,.,.., +14:u05:Chameleon:, +13:u00:air/water, +11:u04:Darrow,, +13:u06:Spotiton., +11:u07:Dandey,, +14:u13:chameleon:, +22:uI1:.,..,,..,,..,,.,.., +14:u04:Chameleon:, +24:u08:specimen-preparation, +11:u03:Darrow,, +13:u05:Spotiton., +11:u06:Dandey,, +14:u12:chameleon:, +22:uI0:.,..,,..,,..,,.,.., +14:u03:Chameleon:, +13:u08:1063-1070, +11:u02:Darrow,, +13:u04:Spotiton., +11:u05:Dandey,, +14:u11:chameleon:, +13:uI2:.,...--.., +14:u02:Chameleon:, +24:u07:specimen-preparation, +11:u01:Darrow,, +13:u03:Spotiton., +11:u04:Dandey,, +14:u10:chameleon:, +13:uI1:.,...--.., +14:u01:Chameleon:, +24:u06:specimen-preparation, +13:u07:1063-1070, +11:u00:Darrow,, +13:u02:Spotiton., +11:u03:Dandey,, +24:u14:specimen-preparation, +13:uI0:.,...--.., +13:uI2:.,...--:-, +14:u00:Chameleon:, +24:u05:specimen-preparation, +13:u06:1063-1070, +13:u01:Spotiton., +11:u02:Dandey,, +10:u08:cryoEM, +24:u13:specimen-preparation, +13:u14:1063-1070, +13:uI1:.,...--:-, +24:u04:specimen-preparation, +13:u05:1063-1070, +13:u00:Spotiton., +11:u01:Dandey,, +10:u07:cryoEM, +24:u12:specimen-preparation, +13:u13:1063-1070, +13:uI0:.,...--:-, +24:u03:specimen-preparation, +13:u04:1063-1070, +11:u00:Dandey,, +10:u06:cryoEM, +24:u08:Hernández-Sánchez,, +24:u11:specimen-preparation, +13:u12:1063-1070, +13:uI2:.,..,..--, +24:u02:specimen-preparation, +13:u03:1063-1070, +10:u05:cryoEM, +24:u07:Hernández-Sánchez,, +24:u10:specimen-preparation, +13:u11:1063-1070, +13:uI1:.,..,..--, +24:u01:specimen-preparation, +13:u02:1063-1070, +10:u04:cryoEM, +24:u06:Hernández-Sánchez,, +13:u10:1063-1070, +13:uI0:.,..,..--, +24:u00:specimen-preparation, +13:u01:1063-1070, +10:u03:cryoEM, +24:u05:Hernández-Sánchez,, +13:u08:Hibshman,, +11:uI2:.-,...:, +13:u00:1063-1070, +10:u02:cryoEM, +24:u04:Hernández-Sánchez,, +13:u07:Hibshman,, +11:uI1:.-,...:, +10:u01:cryoEM, +24:u03:Hernández-Sánchez,, +13:u06:Hibshman,, +11:uI0:.-,...:, +10:u08:worms,, +10:u00:cryoEM, +24:u02:Hernández-Sánchez,, +13:u05:Hibshman,, +14:u08:tolerance:, +24:u01:Hernández-Sánchez,, +13:u04:Hibshman,, +14:u07:tolerance:, +10:u07:worms,, +24:u00:Hernández-Sánchez,, +13:u03:Hibshman,, +14:u06:tolerance:, +10:u06:worms,, +13:u02:Hibshman,, +14:u05:tolerance:, +10:u14:worms,, +10:u05:worms,, +11:u08:plexes., +13:u01:Hibshman,, +14:u04:tolerance:, +10:u13:worms,, +10:u04:worms,, +13:u00:Hibshman,, +14:u03:tolerance:, +10:u12:worms,, +13:uI2:.,.,,..,., +10:u03:worms,, +11:u07:plexes., +14:u02:tolerance:, +10:u11:worms,, +13:uI1:.,.,,..,., +10:u02:worms,, +11:u06:plexes., +13:u08:1813-1829, +14:u01:tolerance:, +10:u10:worms,, +11:u14:plexes., +13:uI0:.,.,,..,., +10:u01:worms,, +11:u05:plexes., +14:u00:tolerance:, +11:u08:(2024)., +11:u13:plexes., +10:u00:worms,, +11:u04:plexes., +13:u07:1813-1829, +11:u07:(2024)., +13:u08:Kilkenny,, +11:u12:plexes., +11:u03:plexes., +13:u06:1813-1829, +11:u06:(2024)., +13:u07:Kilkenny,, +11:u11:plexes., +13:u14:1813-1829, +11:u02:plexes., +13:u05:1813-1829, +11:u05:(2024)., +13:u06:Kilkenny,, +11:u10:plexes., +13:u13:1813-1829, +11:u01:plexes., +13:u04:1813-1829, +11:u04:(2024)., +13:u05:Kilkenny,, +13:u12:1813-1829, +8:u23:1813, +11:u00:plexes., +13:u03:1813-1829, +12:u08:eabc3393, +11:u03:(2024)., +13:u04:Kilkenny,, +14:u08:H2AK119ub1, +13:u11:1813-1829, +13:u02:1813-1829, +11:u02:(2024)., +13:u03:Kilkenny,, +14:u07:H2AK119ub1, +13:u10:1813-1829, +13:u01:1813-1829, +12:u07:eabc3393, +11:u01:(2024)., +13:u02:Kilkenny,, +14:u06:H2AK119ub1, +13:u00:1813-1829, +12:u06:eabc3393, +11:u00:(2024)., +13:u01:Kilkenny,, +14:u05:H2AK119ub1, +12:u14:eabc3393, +12:u05:eabc3393, +13:u00:Kilkenny,, +14:u04:H2AK119ub1, +12:u13:eabc3393, +12:u04:eabc3393, +14:u03:H2AK119ub1, +12:u12:eabc3393, +7:u22:eab, +8:u23:eabc, +12:u03:eabc3393, +16:u08:G-quadruplex, +14:u02:H2AK119ub1, +12:u11:eabc3393, +12:u02:eabc3393, +14:u01:H2AK119ub1, +12:u10:eabc3393, +12:u01:eabc3393, +16:u07:G-quadruplex, +14:u00:H2AK119ub1, +12:u00:eabc3393, +16:u06:G-quadruplex, +16:u14:g-quadruplex, +16:u05:G-quadruplex, +16:u13:g-quadruplex, +16:u04:G-quadruplex, +16:u08:Baranovskiy,, +16:u12:g-quadruplex, +7:u22:G-q, +8:u23:G-qu, +16:u03:G-quadruplex, +15:u08:10006-10020, +16:u07:Baranovskiy,, +16:u11:g-quadruplex, +16:u02:G-quadruplex, +16:u06:Baranovskiy,, +16:u10:g-quadruplex, +16:u01:G-quadruplex, +15:u07:10006-10020, +16:u05:Baranovskiy,, +16:u00:G-quadruplex, +15:u06:10006-10020, +16:u04:Baranovskiy,, +15:u14:10006-10020, +15:u05:10006-10020, +16:u03:Baranovskiy,, +12:u08:(sub-500, +15:u13:10006-10020, +15:u04:10006-10020, +16:u02:Baranovskiy,, +12:u07:(sub-500, +15:u12:10006-10020, +15:u03:10006-10020, +16:u01:Baranovskiy,, +12:u06:(sub-500, +13:u08:Møbjerg,, +15:u11:10006-10020, +15:u02:10006-10020, +11:u08:409-420, +16:u00:Baranovskiy,, +12:u05:(sub-500, +13:u07:Møbjerg,, +15:u10:10006-10020, +15:u01:10006-10020, +12:u04:(sub-500, +13:u06:Møbjerg,, +15:u00:10006-10020, +11:u07:409-420, +12:u03:(sub-500, +13:u05:Møbjerg,, +11:u06:409-420, +12:u02:(sub-500, +13:u04:Møbjerg,, +11:u14:409-420, +11:u05:409-420, +12:u01:(sub-500, +13:u03:Møbjerg,, +11:u13:409-420, +11:u04:409-420, +17:u08:anhydrobiotic, +12:u00:(sub-500, +13:u02:Møbjerg,, +11:u12:409-420, +11:u03:409-420, +13:u01:Møbjerg,, +11:u11:409-420, +11:u02:409-420, +17:u07:anhydrobiotic, +13:u00:Møbjerg,, +11:u10:409-420, +11:u01:409-420, +17:u06:anhydrobiotic, +17:u14:anhydrobiotic, +11:u00:409-420, +17:u05:anhydrobiotic, +17:u13:anhydrobiotic, +17:u04:anhydrobiotic, +17:u12:anhydrobiotic, +17:u03:anhydrobiotic, +17:u11:anhydrobiotic, +17:u02:anhydrobiotic, +17:u10:anhydrobiotic, +17:u01:anhydrobiotic, +17:u00:anhydrobiotic, +10:u08:Stagg,, +10:u07:Stagg,, +10:u06:Stagg,, +10:u05:Stagg,, +11:u08:160-183, +10:u04:Stagg,, +10:u03:Stagg,, +11:u07:160-183, +10:u02:Stagg,, +14:u08:Rosenthal,, +12:uI2:.,..,.--, +11:u06:160-183, +10:u01:Stagg,, +14:u07:Rosenthal,, +11:u14:160-183, +12:uI1:.,..,.--, +11:u05:160-183, +10:u00:Stagg,, +14:u06:Rosenthal,, +11:u13:160-183, +12:uI0:.,..,.--, +11:u04:160-183, +14:u05:Rosenthal,, +12:u08:Snijder,, +11:u12:160-183, +11:u03:160-183, +14:u04:Rosenthal,, +12:u07:Snijder,, +11:u11:160-183, +11:u02:160-183, +14:u03:Rosenthal,, +12:u06:Snijder,, +10:u08:grids., +11:u10:160-183, +11:u01:160-183, +14:u02:Rosenthal,, +12:u05:Snijder,, +10:u07:grids., +12:u08:Kampjut,, +11:u00:160-183, +14:u01:Rosenthal,, +12:u04:Snijder,, +10:u06:grids., +12:u07:Kampjut,, +14:u00:Rosenthal,, +12:u03:Snijder,, +10:u05:grids., +12:u06:Kampjut,, +14:u08:modulator., +12:u02:Snijder,, +10:u04:grids., +12:u05:Kampjut,, +12:u01:Snijder,, +10:u03:grids., +12:u04:Kampjut,, +14:u07:modulator., +12:u00:Snijder,, +10:u02:grids., +12:u03:Kampjut,, +16:u08:Mastronarde,, +14:u06:modulator., +9:u08:36-51, +10:u01:grids., +12:u02:Kampjut,, +16:u07:Mastronarde,, +14:u14:modulator., +14:u05:modulator., +10:u00:grids., +12:u01:Kampjut,, +16:u06:Mastronarde,, +14:u13:modulator., +14:u04:modulator., +9:u07:36-51, +9:u08:PARC:, +12:u00:Kampjut,, +16:u05:Mastronarde,, +12:u08:Punjani,, +14:u12:modulator., +14:u03:modulator., +9:u06:36-51, +16:u04:Mastronarde,, +12:u07:Punjani,, +14:u11:modulator., +9:u14:36-51, +14:u02:modulator., +9:u05:36-51, +9:u07:PARC:, +16:u03:Mastronarde,, +12:u06:Punjani,, +14:u10:modulator., +9:u13:36-51, +14:u01:modulator., +9:u04:36-51, +9:u06:PARC:, +16:u02:Mastronarde,, +12:u05:Punjani,, +9:u12:36-51, +9:u14:parc:, +7:u22:36-, +8:u23:36-5, +19:uI2:.,.,,..,,..,..-, +14:u00:modulator., +9:u03:36-51, +9:u05:PARC:, +16:u01:Mastronarde,, +12:u04:Punjani,, +9:u11:36-51, +9:u13:parc:, +19:uI1:.,.,,..,,..,..-, +9:u02:36-51, +9:u04:PARC:, +16:u00:Mastronarde,, +12:u03:Punjani,, +9:u10:36-51, +9:u12:parc:, +8:u23:PARC, +19:uI0:.,.,,..,,..,..-, +9:u01:36-51, +9:u03:PARC:, +12:u02:Punjani,, +9:u08:Meng,, +9:u11:parc:, +9:u00:36-51, +9:u02:PARC:, +12:u01:Punjani,, +9:u07:Meng,, +9:u10:parc:, +9:u01:PARC:, +12:u00:Punjani,, +13:u08:Pintilie,, +9:u00:PARC:, +13:u07:Pintilie,, +13:u08:Q-scores., +13:u06:Pintilie,, +13:u07:Q-scores., +13:u05:Pintilie,, +13:u06:Q-scores., +7:u08:keV, +13:u04:Pintilie,, +13:u05:Q-scores., +7:u07:keV, +8:u08:216,, +13:u03:Pintilie,, +13:u04:Q-scores., +7:u06:keV, +8:u07:216,, +9:u08:53-65, +13:u02:Pintilie,, +13:u03:Q-scores., +7:u05:keV, +8:u06:216,, +13:u01:Pintilie,, +13:u02:Q-scores., +7:u04:keV, +8:u05:216,, +9:u07:53-65, +13:u00:Pintilie,, +13:u01:Q-scores., +7:u03:keV, +8:u04:216,, +10:u08:Hagen,, +9:u06:53-65, +15:u08:subtomogram, +13:u00:Q-scores., +7:u02:keV, +8:u03:216,, +10:u07:Hagen,, +9:u14:53-65, +9:u05:53-65, +7:u01:keV, +8:u02:216,, +10:u06:Hagen,, +14:u08:averaging., +9:u13:53-65, +9:u04:53-65, +15:u07:subtomogram, +7:u00:keV, +8:u01:216,, +10:u05:Hagen,, +14:u07:averaging., +10:u08:Grant,, +9:u12:53-65, +17:uI2:.,...,,.,...-, +9:u03:53-65, +15:u06:subtomogram, +8:u00:216,, +10:u04:Hagen,, +14:u06:averaging., +10:u07:Grant,, +9:u11:53-65, +15:u14:subtomogram, +17:uI1:.,...,,.,...-, +9:u02:53-65, +15:u05:subtomogram, +10:u03:Hagen,, +14:u05:averaging., +10:u06:Grant,, +9:u10:53-65, +15:u13:subtomogram, +17:uI0:.,...,,.,...-, +9:u01:53-65, +15:u04:subtomogram, +10:u02:Hagen,, +14:u04:averaging., +10:u05:Grant,, +16:u08:marker-free,, +15:u12:subtomogram, +14:uI2:.,.,,.,.,-, +9:u00:53-65, +15:u03:subtomogram, +10:u08:100068, +10:u01:Hagen,, +14:u03:averaging., +10:u04:Grant,, +16:u07:marker-free,, +15:u11:subtomogram, +14:uI1:.,.,,.,.,-, +15:u02:subtomogram, +10:u00:Hagen,, +14:u02:averaging., +10:u03:Grant,, +16:u06:marker-free,, +15:u10:subtomogram, +14:uI0:.,.,,.,.,-, +15:u01:subtomogram, +10:u07:100068, +14:u01:averaging., +10:u02:Grant,, +16:u05:marker-free,, +15:u00:subtomogram, +10:u06:100068, +14:u00:averaging., +10:u01:Grant,, +16:u04:marker-free,, +10:u14:100068, +10:u05:100068, +10:u00:Grant,, +16:u03:marker-free,, +11:u08:Kremer,, +10:u13:100068, +10:u04:100068, +16:u02:marker-free,, +11:u07:Kremer,, +10:u12:100068, +10:u03:100068, +16:u01:marker-free,, +11:u06:Kremer,, +8:u08:116,, +10:u11:100068, +10:u02:100068, +11:u08:ImageJ:, +16:u00:marker-free,, +11:u05:Kremer,, +8:u07:116,, +10:u10:100068, +10:u01:100068, +11:u04:Kremer,, +8:u06:116,, +10:u00:100068, +11:u07:ImageJ:, +11:u08:Dynamo:, +11:u03:Kremer,, +8:u05:116,, +19:u08:Castaño-Díez,, +11:u06:ImageJ:, +12:u08:tomogram, +11:u02:Kremer,, +8:u04:116,, +19:u07:Castaño-Díez,, +11:u14:imagej:, +11:u05:ImageJ:, +11:u07:Dynamo:, +11:u01:Kremer,, +8:u03:116,, +19:u06:Castaño-Díez,, +11:u13:imagej:, +12:uI2::..,-()., +11:u04:ImageJ:, +11:u06:Dynamo:, +12:u07:tomogram, +11:u00:Kremer,, +8:u02:116,, +19:u05:Castaño-Díez,, +11:u12:imagej:, +11:u14:dynamo:, +12:uI1::..,-()., +11:u03:ImageJ:, +11:u05:Dynamo:, +12:u06:tomogram, +8:u01:116,, +19:u04:Castaño-Díez,, +11:u11:imagej:, +11:u13:dynamo:, +12:u14:tomogram, +12:uI0::..,-()., +11:u02:ImageJ:, +11:u04:Dynamo:, +12:u05:tomogram, +8:u00:116,, +19:u03:Castaño-Díez,, +11:u10:imagej:, +11:u12:dynamo:, +12:u13:tomogram, +11:u01:ImageJ:, +11:u03:Dynamo:, +12:u04:tomogram, +19:u02:Castaño-Díez,, +11:u11:dynamo:, +12:u12:tomogram, +11:u00:ImageJ:, +11:u02:Dynamo:, +12:u03:tomogram, +19:u01:Castaño-Díez,, +11:u10:dynamo:, +12:u11:tomogram, +11:u01:Dynamo:, +12:u02:tomogram, +19:u00:Castaño-Díez,, +12:u10:tomogram, +11:u00:Dynamo:, +12:u01:tomogram, +12:u00:tomogram, +16:u14:appreciation, +16:u13:appreciation, +16:u12:appreciation, +16:u11:appreciation, +16:u10:appreciation, +20:u08:(www.sbgrid.org), +20:u07:(www.sbgrid.org), +20:u06:(www.sbgrid.org), +20:u14:(www.sbgrid.org), +20:u05:(www.sbgrid.org), +20:u13:(www.sbgrid.org), +20:u04:(www.sbgrid.org), +14:u08:Chancellor, +20:u12:(www.sbgrid.org), +20:u03:(www.sbgrid.org), +20:u11:(www.sbgrid.org), +20:u02:(www.sbgrid.org), +14:u07:Chancellor, +17:u08:Biochemistry., +13:u08:Wisconsin, +20:u10:(www.sbgrid.org), +20:u01:(www.sbgrid.org), +14:u06:Chancellor, +12:u08:doctoral, +13:u07:Wisconsin, +14:u14:chancellor, +20:u00:(www.sbgrid.org), +14:u05:Chancellor, +17:u07:Biochemistry., +13:u08:Morgridge, +13:u06:Wisconsin, +14:u08:fellowship, +14:u13:chancellor, +14:u04:Chancellor, +17:u06:Biochemistry., +12:u07:doctoral, +13:u05:Wisconsin, +14:u07:fellowship, +14:u12:chancellor, +17:u14:biochemistry., +14:u03:Chancellor, +17:u05:Biochemistry., +12:u06:doctoral, +13:u07:Morgridge, +13:u04:Wisconsin, +14:u06:fellowship, +14:u11:chancellor, +17:u13:biochemistry., +12:u14:doctoral, +14:u02:Chancellor, +17:u04:Biochemistry., +12:u05:doctoral, +13:u06:Morgridge, +13:u03:Wisconsin, +14:u05:fellowship, +14:u10:chancellor, +17:u12:biochemistry., +12:u13:doctoral, +13:u14:morgridge, +14:u01:Chancellor, +17:u03:Biochemistry., +12:u04:doctoral, +13:u05:Morgridge, +13:u02:Wisconsin, +14:u04:fellowship, +9:u08:K.M.A, +17:u11:biochemistry., +12:u12:doctoral, +13:u13:morgridge, +14:u00:Chancellor, +17:u02:Biochemistry., +12:u03:doctoral, +13:u04:Morgridge, +13:u01:Wisconsin, +14:u03:fellowship, +9:u07:K.M.A, +17:u10:biochemistry., +12:u11:doctoral, +13:u12:morgridge, +17:u01:Biochemistry., +12:u02:doctoral, +13:u03:Morgridge, +13:u00:Wisconsin, +14:u02:fellowship, +9:u06:K.M.A, +15:u08:tilt-series, +12:u10:doctoral, +13:u11:morgridge, +17:u00:Biochemistry., +12:u01:doctoral, +13:u02:Morgridge, +10:u08:K.M.A., +14:u01:fellowship, +9:u05:K.M.A, +15:u07:tilt-series, +13:u10:morgridge, +12:u00:doctoral, +13:u01:Morgridge, +9:u08:G.L.,, +14:u00:fellowship, +9:u04:K.M.A, +15:u06:tilt-series, +13:u00:Morgridge, +10:u07:K.M.A., +9:u03:K.M.A, +15:u05:tilt-series, +14:uI2:--.......-, +10:u06:K.M.A., +9:u07:G.L.,, +9:u02:K.M.A, +15:u04:tilt-series, +10:u14:k.m.a., +14:uI1:--.......-, +10:u05:K.M.A., +9:u06:G.L.,, +9:u01:K.M.A, +15:u03:tilt-series, +10:u13:k.m.a., +9:u14:g.l.,, +14:uI0:--.......-, +12:uI2:.......,, +10:u04:K.M.A., +9:u05:G.L.,, +9:u00:K.M.A, +15:u02:tilt-series, +10:u08:Alumni, +10:u12:k.m.a., +9:u13:g.l.,, +12:uI1:.......,, +13:uI2:..,..,..., +10:u03:K.M.A., +9:u04:G.L.,, +15:u01:tilt-series, +10:u07:Alumni, +10:u11:k.m.a., +9:u12:g.l.,, +12:uI0:.......,, +13:uI1:..,..,..., +10:u02:K.M.A., +9:u03:G.L.,, +15:u00:tilt-series, +10:u06:Alumni, +10:u10:k.m.a., +9:u11:g.l.,, +13:u14:wisconsin, +13:uI0:..,..,..., +10:u01:K.M.A., +9:u02:G.L.,, +10:u05:Alumni, +9:u10:g.l.,, +13:u13:wisconsin, +11:u14:declare, +10:u00:K.M.A., +9:u01:G.L.,, +10:u04:Alumni, +13:u12:wisconsin, +11:u13:declare, +9:u00:G.L.,, +10:u03:Alumni, +13:u11:wisconsin, +11:u12:declare, +10:u02:Alumni, +13:u10:wisconsin, +11:u11:declare, +10:u01:Alumni, +11:u10:declare, +47:u08:https://doi.org/10.1038/s41467-024-52091-1., +10:u00:Alumni, +47:u07:https://doi.org/10.1038/s41467-024-52091-1., +47:u06:https://doi.org/10.1038/s41467-024-52091-1., +6:u08:Ji, +47:u14:https://doi.org/10.1038/s41467-024-52091-1., +47:u05:https://doi.org/10.1038/s41467-024-52091-1., +6:u07:Ji, +47:u13:https://doi.org/10.1038/s41467-024-52091-1., +47:u04:https://doi.org/10.1038/s41467-024-52091-1., +6:u06:Ji, +47:u12:https://doi.org/10.1038/s41467-024-52091-1., +47:u03:https://doi.org/10.1038/s41467-024-52091-1., +6:u05:Ji, +47:u11:https://doi.org/10.1038/s41467-024-52091-1., +47:u02:https://doi.org/10.1038/s41467-024-52091-1., +34:u08:http://www.nature.com/reprints, +6:u04:Ji, +47:u10:https://doi.org/10.1038/s41467-024-52091-1., +47:u01:https://doi.org/10.1038/s41467-024-52091-1., +6:u03:Ji, +47:u00:https://doi.org/10.1038/s41467-024-52091-1., +34:u07:http://www.nature.com/reprints, +15:u08:isdictional, +6:u02:Ji, +34:u06:http://www.nature.com/reprints, +6:u01:Ji, +34:u14:http://www.nature.com/reprints, +34:u05:http://www.nature.com/reprints, +15:u07:isdictional, +43:u08:Attribution-NonCommercial-NoDerivatives, +6:u00:Ji, +34:u13:http://www.nature.com/reprints, +34:u04:http://www.nature.com/reprints, +15:u06:isdictional, +34:u12:http://www.nature.com/reprints, +15:u14:isdictional, +34:u03:http://www.nature.com/reprints, +15:u05:isdictional, +43:u07:Attribution-NonCommercial-NoDerivatives, +34:u11:http://www.nature.com/reprints, +15:u13:isdictional, +34:u02:http://www.nature.com/reprints, +15:u04:isdictional, +43:u06:Attribution-NonCommercial-NoDerivatives, +34:u10:http://www.nature.com/reprints, +15:u12:isdictional, +43:u14:attribution-noncommercial-noderivatives, +7:u22:isd, +8:u23:isdi, +34:u01:http://www.nature.com/reprints, +15:u03:isdictional, +43:u05:Attribution-NonCommercial-NoDerivatives, +15:u11:isdictional, +43:u13:attribution-noncommercial-noderivatives, +34:u00:http://www.nature.com/reprints, +15:u02:isdictional, +43:u04:Attribution-NonCommercial-NoDerivatives, +15:u10:isdictional, +43:u12:attribution-noncommercial-noderivatives, +15:u01:isdictional, +43:u03:Attribution-NonCommercial-NoDerivatives, +43:u11:attribution-noncommercial-noderivatives, +10:u14:credit, +15:u00:isdictional, +43:u02:Attribution-NonCommercial-NoDerivatives, +43:u10:attribution-noncommercial-noderivatives, +10:u13:credit, +43:u01:Attribution-NonCommercial-NoDerivatives, +10:u12:credit, +43:u00:Attribution-NonCommercial-NoDerivatives, +12:u08:licence,, +10:u11:credit, +11:u08:licence, +12:u07:licence,, +10:u10:credit, +12:u06:licence,, +11:u07:licence, +12:u05:licence,, +11:u06:licence, +47:u08:creativecommons.org/licenses/by-nc-nd/4.0/., +12:u04:licence,, +11:u14:licence, +11:u05:licence, +12:u03:licence,, +11:u13:licence, +11:u04:licence, +47:u07:creativecommons.org/licenses/by-nc-nd/4.0/., +12:u02:licence,, +11:u12:licence, +11:u03:licence, +47:u06:creativecommons.org/licenses/by-nc-nd/4.0/., +12:u01:licence,, +11:u11:licence, +47:u14:creativecommons.org/licenses/by-nc-nd/4.0/., +11:u02:licence, +47:u05:creativecommons.org/licenses/by-nc-nd/4.0/., +12:u00:licence,, +11:u10:licence, +47:u13:creativecommons.org/licenses/by-nc-nd/4.0/., +13:uI2:.//--/./., +11:u01:licence, +47:u04:creativecommons.org/licenses/by-nc-nd/4.0/., +47:u12:creativecommons.org/licenses/by-nc-nd/4.0/., +13:uI1:.//--/./., +11:u00:licence, +47:u03:creativecommons.org/licenses/by-nc-nd/4.0/., +47:u11:creativecommons.org/licenses/by-nc-nd/4.0/., +13:uI0:.//--/./., +47:u02:creativecommons.org/licenses/by-nc-nd/4.0/., +47:u10:creativecommons.org/licenses/by-nc-nd/4.0/., +47:u01:creativecommons.org/licenses/by-nc-nd/4.0/., +47:u00:creativecommons.org/licenses/by-nc-nd/4.0/., 9:u08:Radio, 9:u07:Radio, 9:u06:Radio, @@ -1368517,7 +1385916,6 @@ 7:u05:geo, 9:u11:20°4, 8:u12:0°b, -7:u21:0°, 8:u22:0°B, 8:u23:0°B, 9:u02:20°4, @@ -1369282,39 +1386680,25 @@ 13:u03:relevant., 16:u12:tunka-grande, 16:u03:Tunka-Grande, -13:u08:prospects, 13:u02:relevant., 16:u11:tunka-grande, 16:u02:Tunka-Grande, 13:u01:relevant., 16:u10:tunka-grande, 16:u01:Tunka-Grande, -13:u07:prospects, 9:u08:tenna, 13:u00:relevant., 16:u00:Tunka-Grande, -13:u06:prospects, -13:u14:prospects, -13:u05:prospects, 9:u07:tenna, -13:u13:prospects, -13:u04:prospects, 9:u06:tenna, -13:u12:prospects, 9:u14:tenna, -13:u03:prospects, 9:u05:tenna, -13:u11:prospects, 9:u13:tenna, -13:u02:prospects, 9:u04:tenna, -13:u10:prospects, 9:u12:tenna, 8:u23:tenn, -13:u01:prospects, 9:u03:tenna, 9:u11:tenna, -13:u00:prospects, 9:u02:tenna, 11:u08:CoREAS., 9:u10:tenna, @@ -1369366,7 +1386750,6 @@ 20:u04:air-fluorescence, 12:u01:stricter, 20:u12:air-fluorescence, -8:u23:air-, 12:uI0:--(/-[]), 12:uI1:-(/[]).-, 20:u03:air-fluorescence, @@ -1372999,67 +1390382,45 @@ 8:u13:1-5,, 8:u04:1-5,, 8:u12:1-5,, -7:u14:1-7, 8:u23:1-5,, 8:u03:1-5,, 8:u11:1-5,, -7:u13:1-7, 8:u02:1-5,, 8:u10:1-5,, -7:u12:1-7, -7:u23:1-7, 8:u01:1-5,, -7:u11:1-7, 8:u00:1-5,, -7:u08:WGS, -7:u10:1-7, 8:u08:tem), 14:u08:(Universal, 13:uI2:.(.,;.,)., -7:u07:WGS, 14:u07:(Universal, 7:u14:gps, 13:uI1:.(.,;.,)., -7:u06:WGS, 8:u07:tem), 14:u06:(Universal, 7:u13:gps, -7:u14:wgs, 13:uI0:.(.,;.,)., -7:u05:WGS, 8:u06:tem), 14:u05:(Universal, 7:u12:gps, -7:u13:wgs, 8:u14:tem), 7:u22:GPS, 7:u23:GPS, -7:u04:WGS, 8:u05:tem), 14:u04:(Universal, 7:u11:gps, -7:u12:wgs, 8:u13:tem), -7:u22:WGS, -7:u23:WGS, -7:u03:WGS, 8:u04:tem), 14:u03:(Universal, 7:u10:gps, -7:u11:wgs, 8:u12:tem), 8:u23:tem), -7:u02:WGS, 8:u03:tem), 14:u02:(Universal, -7:u10:wgs, 8:u11:tem), -7:u01:WGS, 8:u02:tem), 15:u08:FORMOSAT-2,, 14:u01:(Universal, 8:u10:tem), -7:u00:WGS, 8:u01:tem), 13:u08:shortwave, 14:u00:(Universal, @@ -1373865,44 +1391226,30 @@ 9:u08:NDVI,, 11:u11:aanssen, 11:u02:aanssen, -10:u08:mated., 9:u07:NDVI,, 11:u10:aanssen, 11:u01:aanssen, 9:u06:NDVI,, 11:u00:aanssen, -10:u07:mated., 9:u05:NDVI,, 9:u08:LAIs,, -10:u06:mated., 9:u04:NDVI,, 9:u07:LAIs,, 11:u08:(beans), -10:u14:mated., -10:u05:mated., 9:u03:NDVI,, 9:u06:LAIs,, 11:u07:(beans), -10:u13:mated., -10:u04:mated., 9:u02:NDVI,, 9:u05:LAIs,, 11:u06:(beans), -10:u12:mated., -10:u03:mated., 9:u01:NDVI,, 9:u04:LAIs,, 11:u05:(beans), -10:u11:mated., -10:u02:mated., 9:u00:NDVI,, 9:u03:LAIs,, 11:u04:(beans), -10:u10:mated., -10:u01:mated., 9:u02:LAIs,, 11:u03:(beans), -10:u00:mated., 9:u01:LAIs,, 11:u02:(beans), 9:u00:LAIs,, @@ -1374438,18 +1391785,13 @@ 8:u01:1181, 8:u00:1181, 11:u08:guishes, -7:u14:vit, 11:u07:guishes, -7:u13:vit, 11:u06:guishes, -7:u12:vit, 11:u14:guishes, 7:u23:VIT, 11:u05:guishes, -7:u11:vit, 11:u13:guishes, 11:u04:guishes, -7:u10:vit, 11:u12:guishes, 11:u03:guishes, 11:u11:guishes, @@ -1380042,24 +1397384,19 @@ 20:u14:charge-discharge, 20:u05:charge-discharge, 20:u13:charge-discharge, -10:u14:angles, 20:u04:charge-discharge, 9:u07:A1762, 20:u12:charge-discharge, -10:u13:angles, 20:u03:charge-discharge, 9:u06:A1762, 20:u11:charge-discharge, -10:u12:angles, 9:u14:a1762, 20:u02:charge-discharge, 9:u05:A1762, 20:u10:charge-discharge, -10:u11:angles, 9:u13:a1762, 20:u01:charge-discharge, 9:u04:A1762, -10:u10:angles, 9:u12:a1762, 20:u00:charge-discharge, 9:u03:A1762, @@ -1381893,7 +1399230,6 @@ 7:u01:3-9, 12:u02:Fungorum, 15:u05:Micromphale, -12:u08:Agaricus, 10:u12:hist.,, 13:uI2:(.)...():, 8:u00:Figs, @@ -1381902,7 +1399238,6 @@ 7:u00:3-9, 12:u01:Fungorum, 15:u04:Micromphale, -12:u07:Agaricus, 10:u11:hist.,, 13:uI1:(.)...():, 10:u02:Hist.,, @@ -1381910,7 +1399245,6 @@ 11:u08:liard's, 12:u00:Fungorum, 15:u03:Micromphale, -12:u06:Agaricus, 12:u08:homonym], 10:u10:hist.,, 8:u14:[not, @@ -1381918,7 +1399252,6 @@ 10:u01:Hist.,, 8:u05:[NOT, 15:u02:Micromphale, -12:u05:Agaricus, 12:u07:homonym], 12:u08:epithet), 8:u13:[not, @@ -1381928,7 +1399261,6 @@ 11:u07:liard's, 10:u08:westii, 15:u01:Micromphale, -12:u04:Agaricus, 12:u06:homonym], 12:u07:epithet), 8:u12:[not, @@ -1381940,7 +1399272,6 @@ 11:u06:liard's, 13:u08:Holotype., 15:u00:Micromphale, -12:u03:Agaricus, 12:u05:homonym], 12:u06:epithet), 12:u08:Murrill., @@ -1381952,7 +1399283,6 @@ 8:u02:[NOT, 11:u05:liard's, 10:u07:westii, -12:u02:Agaricus, 12:u04:homonym], 12:u05:epithet), 12:u07:Murrill., @@ -1381965,7 +1399295,6 @@ 11:u04:liard's, 10:u06:westii, 13:u07:Holotype., -12:u01:Agaricus, 12:u03:homonym], 12:u04:epithet), 12:u06:Murrill., @@ -1381981,7 +1399310,6 @@ 10:u05:westii, 13:u06:Holotype., 11:u08:Epitype, -12:u00:Agaricus, 12:u02:homonym], 12:u03:epithet), 12:u05:Murrill., @@ -1383966,20 +1401294,17 @@ 15:u08:Desjardin's, 17:u14:thick-walled,, 8:uI0:.,:", -8:uI2:;-,;, 17:u05:thick-walled,, 10:u00:(1988), 11:u05:hyaline, 15:u07:Desjardin's, 17:u13:thick-walled,, -8:uI1:;-,;, 11:uI2:-,;.,(;, 17:u04:thick-walled,, 9:u08:morph, 11:u04:hyaline, 15:u06:Desjardin's, 17:u12:thick-walled,, -8:uI0:;-,;, 11:uI1:-,;.,(;, 10:uI2::(.).", 17:u03:thick-walled,, @@ -1384316,7 +1401641,6 @@ 9:u03:14505, 19:u04:30°39'43.61"N,, 9:u06:14498, -8:u08:Co.,, 16:u10:12.vii.2014,, 7:u11:tfb, 14:u12:trailhead,, @@ -1384334,7 +1401658,6 @@ 9:u02:14505, 19:u03:30°39'43.61"N,, 9:u05:14498, -8:u07:Co.,, 8:u08:RHP,, 7:u10:tfb, 14:u11:trailhead,, @@ -1384355,7 +1401678,6 @@ 9:u01:14505, 19:u02:30°39'43.61"N,, 9:u04:14498, -8:u06:Co.,, 8:u07:RHP,, 14:u10:trailhead,, 20:u11:(tenn-f-069182);, @@ -1384373,7 +1401695,6 @@ 9:u00:14505, 19:u01:30°39'43.61"N,, 9:u03:14498, -8:u05:Co.,, 8:u06:RHP,, 20:u10:(tenn-f-069182);, 16:u12:17.vii.1987,, @@ -1384390,7 +1401711,6 @@ 9:u08:56693, 19:u00:30°39'43.61"N,, 9:u02:14498, -8:u04:Co.,, 8:u05:RHP,, 14:u08:Highlands,, 16:u11:17.vii.1987,, @@ -1384404,7 +1401724,6 @@ 6:u05:ga, 20:u06:(TENN-F-047665);, 9:u01:14498, -8:u03:Co.,, 8:u04:RHP,, 14:u07:Highlands,, 20:u08:(TENN-F-048667);, @@ -1384419,7 +1401738,6 @@ 20:u05:(TENN-F-047665);, 9:u07:56693, 9:u00:14498, -8:u02:Co.,, 8:u03:RHP,, 14:u06:Highlands,, 20:u07:(TENN-F-048667);, @@ -1384435,7 +1401753,6 @@ 6:u03:ga, 20:u04:(TENN-F-047665);, 9:u06:56693, -8:u01:Co.,, 8:u02:RHP,, 14:u05:Highlands,, 20:u06:(TENN-F-048667);, @@ -1384449,7 +1401766,6 @@ 20:u03:(TENN-F-047665);, 9:u05:56693, 16:u08:10.VII.1990,, -8:u00:Co.,, 8:u01:RHP,, 14:u04:Highlands,, 20:u05:(TENN-F-048667);, @@ -1387172,21 +1404488,18 @@ 12:u05:Barshan,, 13:u12:ropsychol, 8:u23:rops, -17:uI2:.,.,,.,,.,..-, 13:u03:ropsychol, 14:u06:manifolds., 11:u01:Heaton,, 12:u04:Barshan,, 13:u11:ropsychol, 14:u14:manifolds., -17:uI1:.,.,,.,,.,..-, 13:u02:ropsychol, 14:u05:manifolds., 11:u00:Heaton,, 12:u03:Barshan,, 13:u10:ropsychol, 14:u13:manifolds., -17:uI0:.,.,,.,,.,..-, 13:u01:ropsychol, 14:u04:manifolds., 12:u02:Barshan,, @@ -1387281,8 +1404594,6 @@ 12:u02:Majithia, 11:u06:Cologne, 15:u07:Psychiatric, -7:u22:MA,, -7:u23:MA,, 14:u08:Luxembourg, 12:u00:Koeleman, 12:u01:Majithia, @@ -1388028,7 +1405339,6 @@ 8:u00:5264, 8:u02:3982, 8:u07:2087, -10:u08:ARID1B, 7:u05:EPI, 8:u10:3982, 8:u01:3982, @@ -1388038,51 +1405348,37 @@ 8:u14:2087, 8:u00:3982, 8:u05:2087, -10:u07:ARID1B, 7:u03:EPI, 9:u07:(40),, 8:u13:2087, 8:u04:2087, -10:u06:ARID1B, 12:u08:4.28E-58, 7:u02:EPI, 9:u06:(40),, 8:u12:2087, -10:u14:arid1b, 8:u23:2087, 8:u03:2087, -10:u05:ARID1B, 7:u01:EPI, 9:u05:(40),, 8:u11:2087, -10:u13:arid1b, 8:u02:2087, -10:u04:ARID1B, 12:u07:4.28E-58, 7:u00:EPI, 9:u04:(40),, 8:u10:2087, -10:u12:arid1b, -8:u23:ARID, 8:u01:2087, -10:u03:ARID1B, 12:u06:4.28E-58, 9:u03:(40),, -10:u11:arid1b, 12:u14:4.28e-58, 8:u00:2087, -10:u02:ARID1B, 12:u05:4.28E-58, 9:u08:SCN2A, 9:u02:(40),, -10:u10:arid1b, 12:u13:4.28e-58, -10:u01:ARID1B, 12:u04:4.28E-58, 10:u08:SCN11A, 9:u01:(40),, 12:u12:4.28e-58, -10:u00:ARID1B, 12:u03:4.28E-58, 9:u07:SCN2A, 10:u08:SCN10A, @@ -1388134,7 +1405430,6 @@ 10:u01:SCN11A, 10:u02:SCN10A, 12:u05:1.77E-52, -9:u08:DDX3X, 10:u10:scn10a, 12:u13:1.77e-52, 10:u00:SCN11A, @@ -1388143,35 +1405438,21 @@ 12:u12:1.77e-52, 10:u00:SCN10A, 12:u03:1.77E-52, -9:u07:DDX3X, 12:u11:1.77e-52, 12:u02:1.77E-52, -9:u06:DDX3X, 12:u08:8.94E-52, 12:u10:1.77e-52, -9:u14:ddx3x, 12:u01:1.77E-52, -9:u05:DDX3X, -9:u13:ddx3x, 12:u00:1.77E-52, -9:u04:DDX3X, 12:u07:8.94E-52, -9:u12:ddx3x, -8:u23:DDX3, -9:u03:DDX3X, 12:u06:8.94E-52, -9:u11:ddx3x, 12:u14:8.94e-52, -9:u02:DDX3X, 12:u05:8.94E-52, 10:u08:DYRK1A, -9:u10:ddx3x, 12:u13:8.94e-52, -9:u01:DDX3X, 12:u04:8.94E-52, 12:u12:8.94e-52, 8:u23:8.94, -9:u00:DDX3X, 12:u03:8.94E-52, 10:u07:DYRK1A, 12:u11:8.94e-52, @@ -1388195,7 +1405476,6 @@ 12:u14:1.89e-40, 10:u02:DYRK1A, 12:u05:1.89E-40, -9:u08:EP300, 10:u10:dyrk1a, 12:u13:1.89e-40, 10:u01:DYRK1A, @@ -1388203,36 +1405483,21 @@ 12:u12:1.89e-40, 10:u00:DYRK1A, 12:u03:1.89E-40, -9:u07:EP300, 12:u11:1.89e-40, 12:u02:1.89E-40, -9:u06:EP300, 12:u08:8.81E-38, 12:u10:1.89e-40, -9:u14:ep300, 12:u01:1.89E-40, -9:u05:EP300, -9:u13:ep300, 12:u00:1.89E-40, -9:u04:EP300, 12:u07:8.81E-38, -9:u12:ep300, -7:u22:EP3, -8:u23:EP30, -9:u03:EP300, 12:u06:8.81E-38, -9:u11:ep300, 12:u14:8.81e-38, -9:u02:EP300, 12:u05:8.81E-38, 9:u08:KCNQ2, -9:u10:ep300, 12:u13:8.81e-38, -9:u01:EP300, 12:u04:8.81E-38, 12:u12:8.81e-38, 8:u23:8.81, -9:u00:EP300, 12:u03:8.81E-38, 9:u07:KCNQ2, 12:u11:8.81e-38, @@ -1388343,7 +1405608,6 @@ 12:u14:1.46e-17, 10:u02:GRIN2B, 12:u05:1.46E-17, -10:u08:CTNNB1, 10:u10:grin2b, 12:u13:1.46e-17, 10:u01:GRIN2B, @@ -1388351,35 +1405615,20 @@ 12:u12:1.46e-17, 10:u00:GRIN2B, 12:u03:1.46E-17, -10:u07:CTNNB1, 12:u11:1.46e-17, 12:u02:1.46E-17, -10:u06:CTNNB1, 12:u08:2.27E-17, 12:u10:1.46e-17, -10:u14:ctnnb1, 12:u01:1.46E-17, -10:u05:CTNNB1, -10:u13:ctnnb1, 12:u00:1.46E-17, -10:u04:CTNNB1, 12:u07:2.27E-17, -10:u12:ctnnb1, -7:u22:CTN, -8:u23:CTNN, -10:u03:CTNNB1, 12:u06:2.27E-17, -10:u11:ctnnb1, 12:u14:2.27e-17, -10:u02:CTNNB1, 12:u05:2.27E-17, 8:u08:CHD2, -10:u10:ctnnb1, 12:u13:2.27e-17, -10:u01:CTNNB1, 12:u04:2.27E-17, 12:u12:2.27e-17, -10:u00:CTNNB1, 12:u03:2.27E-17, 8:u07:CHD2, 12:u11:2.27e-17, @@ -1388515,8 +1405764,6 @@ 12:u07:1.71E-14, 9:u04:(14),, 9:u12:cdk13, -7:u22:CDK, -8:u23:CDK1, 9:u03:CDK13, 12:u06:1.71E-14, 9:u03:(14),, @@ -1388558,8 +1405805,6 @@ 11:u05:PPP2R5E, 11:u12:ppp2r5d, 12:u13:ppp2r5c,, -7:u22:PPP, -8:u23:PPP2, 11:u03:PPP2R5D, 12:u04:PPP2R5C,, 12:u07:3.62E-14, @@ -1388755,7 +1406000,6 @@ 12:u14:7.73e-13, 8:u02:CHD8, 12:u05:7.73E-13, -11:u08:CSNK2A1, 8:u10:chd8, 12:u13:7.73e-13, 8:u01:CHD8, @@ -1388763,35 +1406007,20 @@ 12:u12:7.73e-13, 8:u00:CHD8, 12:u03:7.73E-13, -11:u07:CSNK2A1, 12:u11:7.73e-13, 12:u02:7.73E-13, -11:u06:CSNK2A1, 12:u08:5.00E-12, 12:u10:7.73e-13, -11:u14:csnk2a1, 12:u01:7.73E-13, -11:u05:CSNK2A1, -11:u13:csnk2a1, 12:u00:7.73E-13, -11:u04:CSNK2A1, 12:u07:5.00E-12, -11:u12:csnk2a1, -7:u22:CSN, -8:u23:CSNK, -11:u03:CSNK2A1, 12:u06:5.00E-12, -11:u11:csnk2a1, 12:u14:5.00e-12, -11:u02:CSNK2A1, 12:u05:5.00E-12, 11:u08:CACNA1E, -11:u10:csnk2a1, 12:u13:5.00e-12, -11:u01:CSNK2A1, 12:u04:5.00E-12, 12:u12:5.00e-12, -11:u00:CSNK2A1, 12:u03:5.00E-12, 11:u07:CACNA1E, 12:u11:5.00e-12, @@ -1388882,7 +1406111,6 @@ 9:u12:gnao1, 10:u13:gna14,, 10:u14:gna15,, -7:u22:GNA, 8:u23:GNAO, 9:u03:GNAO1, 10:u04:GNA14,, @@ -1389315,7 +1406543,6 @@ 9:u04:USP9X, 12:u07:5.29E-08, 9:u12:usp9x, -7:u22:USP, 8:u23:USP9, 9:u03:USP9X, 12:u06:5.29E-08, @@ -1389466,7 +1406693,6 @@ 12:u14:5.43e-07, 10:u02:ZBTB18, 12:u05:5.43E-07, -10:u08:TCF7L2, 10:u10:zbtb18, 12:u13:5.43e-07, 10:u01:ZBTB18, @@ -1389475,34 +1406701,20 @@ 8:u23:5.43, 10:u00:ZBTB18, 12:u03:5.43E-07, -10:u07:TCF7L2, 12:u11:5.43e-07, 12:u02:5.43E-07, -10:u06:TCF7L2, 12:u08:1.48E-06, 12:u10:5.43e-07, -10:u14:tcf7l2, 12:u01:5.43E-07, -10:u05:TCF7L2, -10:u13:tcf7l2, 12:u00:5.43E-07, -10:u04:TCF7L2, 12:u07:1.48E-06, -10:u12:tcf7l2, -8:u23:TCF7, -10:u03:TCF7L2, 12:u06:1.48E-06, -10:u11:tcf7l2, 12:u14:1.48e-06, -10:u02:TCF7L2, 12:u05:1.48E-06, 8:u08:TBR1, -10:u10:tcf7l2, 12:u13:1.48e-06, -10:u01:TCF7L2, 12:u04:1.48E-06, 12:u12:1.48e-06, -10:u00:TCF7L2, 12:u03:1.48E-06, 8:u07:TBR1, 12:u11:1.48e-06, @@ -1389790,7 +1407002,6 @@ 34:u04:(SCN[1/2/3/4/5/7/8/9/10/11]A),, 13:u06:(OR=4.96,, 34:u12:(scn[1/2/3/4/5/7/8/9/10/11]a),, -7:u22:(SC, 8:u23:(SCN, 18:uI1:([/////////]),, 17:u00:voltage-gated, @@ -1390501,7 +1407712,6 @@ 10:u01:"other, 14:u02:specified", 34:u04:(http://www.icd10monitor.com)., -9:u08:PPARG, 14:u10:specified", 34:u12:(http://www.icd10monitor.com)., 16:uI1:(://..)."""", @@ -1390514,38 +1407724,23 @@ 12:uI2:(://..)., 14:u00:specified", 34:u02:(http://www.icd10monitor.com)., -9:u07:PPARG, 34:u10:(http://www.icd10monitor.com)., 12:uI1:(://..)., 34:u01:(http://www.icd10monitor.com)., -9:u06:PPARG, 14:u07:PolyPhen2,, -9:u14:pparg, 12:uI0:(://..)., 34:u00:(http://www.icd10monitor.com)., -9:u05:PPARG, 14:u06:PolyPhen2,, -9:u13:pparg, 14:u14:polyphen2,, -9:u04:PPARG, 14:u05:PolyPhen2,, -9:u12:pparg, 14:u13:polyphen2,, -7:u22:PPA, -8:u23:PPAR, -9:u03:PPARG, 14:u04:PolyPhen2,, -9:u11:pparg, 14:u12:polyphen2,, -9:u02:PPARG, 14:u03:PolyPhen2,, 11:u08:PPARG)., -9:u10:pparg, 14:u11:polyphen2,, -9:u01:PPARG, 14:u02:PolyPhen2,, 14:u10:polyphen2,, -9:u00:PPARG, 14:u01:PolyPhen2,, 11:u07:PPARG)., 12:u08:webtools, @@ -1392942,7 +1410137,6 @@ 35:u03:agence-nationale-recherche.fr/), 16:u08:frm.org/en)., 17:u04:n˚dim140053;, -14:u08:fellowship, 9:u10:(anr;, 35:u11:agence-nationale-recherche.fr/), 10:u12:(grant, @@ -1392952,7 +1410146,6 @@ 35:u02:agence-nationale-recherche.fr/), 9:u07:(FRM;, 17:u03:n˚dim140053;, -14:u07:fellowship, 35:u10:agence-nationale-recherche.fr/), 10:u11:(grant, 14:uI0:(;://.-./), @@ -1392961,21 +1410154,18 @@ 9:u06:(FRM;, 16:u07:frm.org/en)., 17:u02:n˚dim140053;, -14:u06:fellowship, 10:u10:(grant, 9:u14:(frm;, 35:u00:agence-nationale-recherche.fr/), 9:u05:(FRM;, 16:u06:frm.org/en)., 17:u01:n˚dim140053;, -14:u05:fellowship, 9:u13:(frm;, 16:u14:frm.org/en)., 11:uI2:(;;://., 9:u04:(FRM;, 16:u05:frm.org/en)., 17:u00:n˚dim140053;, -14:u04:fellowship, 9:u12:(frm;, 16:u13:frm.org/en)., 7:u22:(FR, @@ -1392984,7 +1410174,6 @@ 8:uI2:./)., 9:u03:(FRM;, 16:u04:frm.org/en)., -14:u03:fellowship, 9:u11:(frm;, 16:u12:frm.org/en)., 7:u22:frm, @@ -1392993,19 +1410182,16 @@ 8:uI1:./)., 9:u02:(FRM;, 16:u03:frm.org/en)., -14:u02:fellowship, 9:u10:(frm;, 16:u11:frm.org/en)., 8:uI0:./)., 9:u01:(FRM;, 16:u02:frm.org/en)., -14:u01:fellowship, 8:u08:(PG), 16:u10:frm.org/en)., 9:u00:(FRM;, 16:u01:frm.org/en)., 12:u08:phatases, -14:u00:fellowship, 8:u07:(PG), 16:u00:frm.org/en)., 8:u06:(PG), @@ -1394583,7 +1411769,6 @@ 13:u03:128-fold,, 9:u12:myxin, 10:u14:pylori, -7:u22:myx, 8:u23:myxi, 10:uI0:-,,).-, 9:u03:myxin, @@ -1399359,7 +1416544,6 @@ 15:u00:Smallholder, 11:u05:drought, 12:u07:(HOWELER, -10:u08:Clonal, 11:u00:farmers, 9:u03:crop., 13:u05:tolerant,, @@ -1399375,7 +1416559,6 @@ 8:u23:drou, 11:u03:drought, 12:u05:(HOWELER, -10:u07:Clonal, 9:u01:crop., 13:u03:tolerant,, 10:u04:starch, @@ -1399383,47 +1416566,35 @@ 12:u13:(howeler, 11:u02:drought, 12:u04:(HOWELER, -10:u06:Clonal, 9:u00:crop., 13:u02:tolerant,, 10:u03:starch, 17:u08:post-harvest,, 11:u10:drought, 12:u12:(howeler, -10:u14:clonal, 7:u22:(HO, 8:u23:(HOW, 11:u01:drought, 12:u03:(HOWELER, -10:u05:Clonal, 13:u01:tolerant,, 10:u02:starch, 17:u07:post-harvest,, 12:u11:(howeler, -10:u13:clonal, 11:u00:drought, 12:u02:(HOWELER, -10:u04:Clonal, 13:u00:tolerant,, 10:u01:starch, 17:u06:post-harvest,, 12:u10:(howeler, -10:u12:clonal, 12:u01:(HOWELER, -10:u03:Clonal, 10:u00:starch, 17:u05:post-harvest,, -10:u11:clonal, 9:u14:crop., 12:u00:(HOWELER, -10:u02:Clonal, 17:u04:post-harvest,, -10:u10:clonal, 9:u13:crop., -10:u01:Clonal, 17:u03:post-harvest,, 9:u12:crop., -10:u00:Clonal, 17:u02:post-harvest,, 9:u11:crop., 12:uI2:(),,-(),, @@ -1399539,30 +1416710,21 @@ 14:u07:accessions, 10:u10:(rabbi, 10:u01:(RABBI, -8:u08:map,, 14:u06:accessions, 10:u00:(RABBI, 14:u05:accessions, -8:u07:map,, 14:u04:accessions, -8:u06:map,, 14:u03:accessions, -8:u05:map,, 14:u02:accessions, -8:u04:map,, 14:u01:accessions, 13:u08:projects., 8:u23:map,, -8:u03:map,, 14:u00:accessions, 13:u07:projects., -8:u02:map,, 15:u08:centiMorgan, 13:u06:projects., -8:u01:map,, 13:u05:projects., 8:u08:(cM), -8:u00:map,, 15:u07:centiMorgan, 9:u08:71.9%, 13:u04:projects., @@ -1406936,7 +1424098,6 @@ 14:u04:phenomena,, 12:u05:anaphora, 11:u07:overtly, -7:u08:NPs, 10:u14:zeros), 13:u00:on-demand, 8:u04:Zero, @@ -1406944,7 +1424105,6 @@ 14:u03:phenomena,, 12:u04:anaphora, 11:u06:overtly, -7:u07:NPs, 10:u13:zeros), 8:u23:Zero, 8:u03:Zero, @@ -1406952,14 +1424112,12 @@ 14:u02:phenomena,, 12:u03:anaphora, 11:u05:overtly, -7:u06:NPs, 10:u12:zeros), 8:u02:Zero, 10:u03:zeros), 14:u01:phenomena,, 12:u02:anaphora, 11:u04:overtly, -7:u05:NPs, 10:u11:zeros), 8:u01:Zero, 10:u02:zeros), @@ -1406967,28 +1424125,23 @@ 14:u00:phenomena,, 12:u01:anaphora, 11:u03:overtly, -7:u04:NPs, 9:u08:(JSL), 10:u10:zeros), 8:u00:Zero, 10:u01:zeros), 12:u00:anaphora, 11:u02:overtly, -7:u03:NPs, 9:u07:(JSL), 10:u00:zeros), 11:u07:hension, 11:u01:overtly, -7:u02:NPs, 9:u06:(JSL), 11:u06:hension, 11:u00:overtly, -7:u01:NPs, 9:u05:(JSL), 11:u14:hension, 11:u05:hension, 16:u08:antecedents., -7:u00:NPs, 9:u04:(JSL), 11:u13:hension, 11:u04:hension, @@ -1407704,7 +1424857,6 @@ 10:u04:INPUT:, 11:u03:Clauses, 14:u10:output(a):, -7:u22:INP, 8:u23:INPU, 14:u01:OUTPUT(A):, 10:u03:INPUT:, @@ -1408934,50 +1426086,36 @@ 7:u04:ZD,, 7:u03:ZD,, 7:u02:ZD,, -14:u08:struction., 7:u01:ZD,, 14:u08:novative",, 7:u00:ZD,, -14:u07:struction., 16:u08:"effective",, -14:u06:struction., 14:u07:novative",, 12:u08:guessing, 16:u07:"effective",, -14:u14:struction., -14:u05:struction., 14:u06:novative",, 16:u06:"effective",, -14:u13:struction., 14:u14:novative",, -14:u04:struction., 14:u05:novative",, 12:u07:guessing, 16:u05:"effective",, -14:u12:struction., 14:u13:novative",, -14:u03:struction., 14:u04:novative",, 12:u06:guessing, 16:u04:"effective",, -14:u11:struction., 14:u12:novative",, 12:u14:guessing, 8:u23:nova, -14:u02:struction., 14:u03:novative",, 12:u05:guessing, 16:u03:"effective",, -14:u10:struction., 14:u11:novative",, 12:u13:guessing, -14:u01:struction., 14:u02:novative",, 12:u04:guessing, 16:u02:"effective",, 14:u10:novative",, 12:u12:guessing, -14:u00:struction., 14:u01:novative",, 12:u03:guessing, 16:u01:"effective",, @@ -1413626,17 +1430764,14 @@ 25:u01:microorganism-related, 13:u10:charides,, 11:u13:kin)-17, -9:uI2:)--.-, 13:u01:charides,, 11:u04:kin)-17, 25:u00:microorganism-related, 11:u12:kin)-17, 8:u23:kin), -9:uI1:)--.-, 13:u00:charides,, 11:u03:kin)-17, 11:u11:kin)-17, -9:uI0:)--.-, 11:u02:kin)-17, 11:u10:kin)-17, 11:u01:kin)-17, @@ -1415414,7 +1432549,6 @@ 11:u14:(kotov,, 11:uI1:(,,,;,;, 11:u05:(Kotov,, -11:u08:Farmer,, 11:u03:(Brown,, 11:u13:(kotov,, 11:uI0:(,,,;,;, @@ -1415424,19 +1432558,16 @@ 11:u12:(kotov,, 8:u23:(Kot, 11:u03:(Kotov,, -11:u07:Farmer,, 13:u08:Prescott,, 11:u01:(Brown,, 11:u11:(kotov,, 11:u02:(Kotov,, -11:u06:Farmer,, 15:u07:neuroticism, 11:u00:(Brown,, 11:u10:(kotov,, 11:u14:farmer,, 9:uI2:(,;,,, 11:u01:(Kotov,, -11:u05:Farmer,, 15:u06:neuroticism, 13:u07:Prescott,, 10:u08:worry,, @@ -1415444,21 +1432575,18 @@ 15:u14:neuroticism, 9:uI1:(,;,,, 11:u00:(Kotov,, -11:u04:Farmer,, 15:u05:neuroticism, 13:u06:Prescott,, 11:u12:farmer,, 15:u13:neuroticism, 13:u14:prescott,, 9:uI0:(,;,,, -11:u03:Farmer,, 15:u04:neuroticism, 13:u05:Prescott,, 10:u07:worry,, 11:u11:farmer,, 15:u12:neuroticism, 13:u13:prescott,, -11:u02:Farmer,, 15:u03:neuroticism, 13:u04:Prescott,, 10:u06:worry,, @@ -1415466,14 +1432594,12 @@ 15:u11:neuroticism, 13:u12:prescott,, 10:u14:worry,, -11:u01:Farmer,, 15:u02:neuroticism, 13:u03:Prescott,, 10:u05:worry,, 15:u10:neuroticism, 13:u11:prescott,, 10:u13:worry,, -11:u00:Farmer,, 15:u01:neuroticism, 13:u02:Prescott,, 10:u04:worry,, @@ -1417150,17 +1434276,8 @@ 16:u12:convincingly, 16:u11:convincingly, 16:u10:convincingly, -13:u08:disorder,, -13:u07:disorder,, -13:u06:disorder,, -13:u05:disorder,, -13:u04:disorder,, -13:u03:disorder,, -13:u02:disorder,, 10:u08:(Dugas, -13:u01:disorder,, 10:u07:(Dugas, -13:u00:disorder,, 10:u06:(Dugas, 16:u08:GAD-specific, 10:u05:(Dugas, @@ -1420756,7 +1437873,6 @@ 9:u02:Abidi, 8:u04:Adye, 10:u07:Aleksa, -7:u08:Ali, 20:uI0:..,,,.,.,.,.,.,,, 18:uI1:.,..,.,.,..-,,, 21:uI2:.,,.,,.,...,.,..,, @@ -1420764,7 +1437880,6 @@ 9:u01:Abidi, 8:u03:Adye, 10:u06:Aleksa, -7:u07:Ali, 11:u08:Allport, 18:uI0:.,..,.,.,..-,,, 21:uI1:.,,.,,.,...,.,..,, @@ -1420773,14 +1437888,12 @@ 9:u00:Abidi, 8:u02:Adye, 10:u05:Aleksa, -7:u06:Ali, 11:u07:Allport, 21:uI0:.,,.,,.,...,.,..,, 17:uI1:..,,.,.,..,.,, 8:u06:P.P., 8:u01:Adye, 10:u04:Aleksa, -7:u05:Ali, 11:u06:Allport, 10:u08:Amaral, 8:u14:p.p., @@ -1420789,7 +1437902,6 @@ 8:u05:P.P., 8:u00:Adye, 10:u03:Aleksa, -7:u04:Ali, 11:u05:Allport, 10:u07:Amaral, 8:u13:p.p., @@ -1420797,7 +1437909,6 @@ 22:uI2:..,.,,.,.,.,..,..,, 8:u04:P.P., 10:u02:Aleksa, -7:u03:Ali, 11:u04:Allport, 10:u06:Amaral, 8:u12:p.p., @@ -1420808,7 +1437919,6 @@ 15:uI2:.,.,..,,..,, 8:u03:P.P., 10:u01:Aleksa, -7:u02:Ali, 11:u03:Allport, 10:u05:Amaral, 13:u08:Angelozzi, @@ -1420817,7 +1437927,6 @@ 15:uI1:.,.,..,,..,, 8:u02:P.P., 10:u00:Aleksa, -7:u01:Ali, 11:u02:Allport, 10:u04:Amaral, 13:u07:Angelozzi, @@ -1420826,7 +1437935,6 @@ 15:uI0:.,.,..,,..,, 8:u01:P.P., 8:u08:J-F., -7:u00:Ali, 11:u01:Allport, 10:u03:Amaral, 13:u06:Angelozzi, @@ -1429153,7 +1446261,6 @@ 8:u14:axel, 10:uI2:*,,,-,, 8:u05:Axel, -12:u08:Kingdom,, 9:u04:Salem, 13:u05:Haferkamp, 9:u06:Knoll, @@ -1429170,7 +1446277,6 @@ 8:u23:Axel, 10:uI0:*,,,-,, 8:u03:Axel, -12:u07:Kingdom,, 12:u08:Urology,, 9:u02:Salem, 13:u03:Haferkamp, @@ -1429178,59 +1446284,47 @@ 10:u06:Mainz,, 8:u11:axel, 8:u02:Axel, -12:u06:Kingdom,, 9:u01:Salem, 13:u02:Haferkamp, 9:u03:Knoll, 10:u05:Mainz,, 12:u08:Klinikum, 8:u10:axel, -12:u14:kingdom,, 13:uI2:,,,,'.',,, 8:u01:Axel, -12:u05:Kingdom,, 12:u07:Urology,, 9:u00:Salem, 13:u01:Haferkamp, 9:u02:Knoll, 10:u04:Mainz,, 12:u07:Klinikum, -12:u13:kingdom,, 13:uI1:,,,,'.',,, 8:u00:Axel, -12:u04:Kingdom,, 12:u06:Urology,, 13:u00:Haferkamp, 9:u01:Knoll, 10:u03:Mainz,, 12:u06:Klinikum, 20:u08:j.salem@gesru.de, -12:u12:kingdom,, 12:u14:urology,, 13:uI0:,,,,'.',,, -12:u03:Kingdom,, 12:u05:Urology,, 9:u00:Knoll, 10:u02:Mainz,, 12:u05:Klinikum, 20:u07:j.salem@gesru.de, -12:u11:kingdom,, 12:u13:urology,, -12:u02:Kingdom,, 12:u04:Urology,, 11:u08:Twitter, 10:u01:Mainz,, 12:u04:Klinikum, 20:u06:j.salem@gesru.de, -12:u10:kingdom,, 12:u12:urology,, -12:u01:Kingdom,, 12:u03:Urology,, 10:u00:Mainz,, 12:u03:Klinikum, 20:u05:j.salem@gesru.de, 12:u11:urology,, -12:u00:Kingdom,, 12:u02:Urology,, 11:u07:Twitter, 12:u02:Klinikum, @@ -1431480,27 +1448574,22 @@ 12:u07:Figshare, 12:u06:Figshare, 25:u07:6b18c6ce273a3ecaaddc., -12:u14:figshare, 12:u05:Figshare, 25:u06:6b18c6ce273a3ecaaddc., -12:u13:figshare, 25:u14:6b18c6ce273a3ecaaddc., 11:uI2:,://.//, 12:u04:Figshare, 25:u05:6b18c6ce273a3ecaaddc., -12:u12:figshare, 25:u13:6b18c6ce273a3ecaaddc., 11:uI1:,://.//, 12:u03:Figshare, 25:u04:6b18c6ce273a3ecaaddc., -12:u11:figshare, 25:u12:6b18c6ce273a3ecaaddc., 7:u22:6b1, 8:u23:6b18, 11:uI0:,://.//, 12:u02:Figshare, 25:u03:6b18c6ce273a3ecaaddc., -12:u10:figshare, 25:u11:6b18c6ce273a3ecaaddc., 12:u01:Figshare, 25:u02:6b18c6ce273a3ecaaddc., @@ -1433455,48 +1450544,39 @@ 9:u02:Barve, 19:u04:222(11):1810-9., 9:u05:Owens, -12:u08:Peterson, 13:u06:263:10-8., 9:u01:Barve, 19:u03:222(11):1810-9., 9:u04:Owens, -12:u07:Peterson, 13:u14:263:10-8., 13:u05:263:10-8., 9:u00:Barve, 19:u02:222(11):1810-9., 9:u03:Owens, -12:u06:Peterson, 13:u13:263:10-8., 13:u04:263:10-8., 19:u01:222(11):1810-9., 9:u02:Owens, -12:u05:Peterson, 13:u12:263:10-8., 8:u23:263:, 13:u03:263:10-8., 19:u00:222(11):1810-9., 9:u01:Owens, -12:u04:Peterson, 12:u08:Ducheyne, 13:u11:263:10-8., 13:u02:263:10-8., 11:u08:Region., 9:u00:Owens, -12:u03:Peterson, 12:u07:Ducheyne, 13:u10:263:10-8., 13:u01:263:10-8., 12:u08:29444675, -12:u02:Peterson, 12:u06:Ducheyne, 13:u00:263:10-8., 11:u07:Region., -12:u01:Peterson, 12:u05:Ducheyne, 11:u06:Region., 12:u07:29444675, -12:u00:Peterson, 12:u04:Ducheyne, 11:u05:Region., 12:u06:29444675, @@ -1438943,7 +1456023,6 @@ 11:u14:selves,, 20:u04:psycho-oncology., 11:u05:selves,, -12:u08:oncology, 11:u00:worries, 20:u12:psycho-oncology., 11:u13:selves,, @@ -1438956,36 +1456035,28 @@ 20:u02:psycho-oncology., 11:u03:selves,, 11:u06:Dowling, -12:u07:oncology, 20:u10:psycho-oncology., 11:u11:selves,, 11:u14:dowling, 20:u01:psycho-oncology., 11:u02:selves,, 11:u05:Dowling, -12:u06:oncology, 11:u10:selves,, 11:u13:dowling, 20:u00:psycho-oncology., 11:u01:selves,, 11:u04:Dowling, -12:u05:oncology, 11:u12:dowling, 8:u23:Dowl, 11:u00:selves,, 11:u03:Dowling, -12:u04:oncology, 11:u11:dowling, 11:u02:Dowling, -12:u03:oncology, 9:u08:bers), 11:u10:dowling, 11:u01:Dowling, -12:u02:oncology, 11:u00:Dowling, -12:u01:oncology, 9:u07:bers), -12:u00:oncology, 9:u06:bers), 21:u08:characteristics)., 9:u14:bers), @@ -1441763,35 +1458834,20 @@ 6:u02:YY, 6:u01:YY, 6:u00:YY, -7:u08:261, 6:u08:GN, -7:u07:261, -7:u06:261, 6:u07:GN, -7:u14:261, -7:u05:261, 6:u06:GN, -7:u13:261, 6:u14:gn, -7:u04:261, 6:u05:GN, -7:u12:261, 6:u13:gn, -7:u23:261, -7:u03:261, 6:u04:GN, -7:u11:261, 6:u12:gn, 6:u22:GN, 6:u23:GN, -7:u02:261, 6:u03:GN, -7:u10:261, 6:u11:gn, -7:u01:261, 6:u02:GN, 6:u10:gn, -7:u00:261, 6:u01:GN, 6:u00:GN, 6:u14:fq, @@ -1442901,7 +1459957,6 @@ 9:u07:Erste, 10:u08:tische, 32:u05:Komplexbildungseigenschaften, -8:u08:1873, 14:u11:einleitung, 37:u12:n-acylchalkogenoharnstoffliganden, 15:u13:vorragenden, @@ -1442916,7 +1459971,6 @@ 10:u07:wurden, 10:u08:ganden, 32:u04:Komplexbildungseigenschaften, -8:u07:1873, 18:u08:Untersuchungen, 14:u10:einleitung, 37:u11:n-acylchalkogenoharnstoffliganden, @@ -1442933,7 +1459987,6 @@ 10:u07:tische, 12:u08:gangenen, 32:u03:Komplexbildungseigenschaften, -8:u06:1873, 18:u07:Untersuchungen, 37:u10:n-acylchalkogenoharnstoffliganden, 15:u11:vorragenden, @@ -1442949,7 +1460002,6 @@ 10:u06:tische, 10:u07:ganden, 32:u02:Komplexbildungseigenschaften, -8:u05:1873, 18:u06:Untersuchungen, 16:u08:Jahrhunderts, 15:u10:vorragenden, @@ -1442968,7 +1460020,6 @@ 10:u06:ganden, 12:u07:gangenen, 32:u01:Komplexbildungseigenschaften, -8:u04:1873, 18:u05:Untersuchungen, 16:u07:Jahrhunderts, 14:u10:interesse., @@ -1442986,7 +1460037,6 @@ 10:u05:ganden, 12:u06:gangenen, 32:u00:Komplexbildungseigenschaften, -8:u03:1873, 18:u04:Untersuchungen, 16:u06:Jahrhunderts, 11:u08:Leipzig, @@ -1443003,7 +1460053,6 @@ 10:u04:ganden, 12:u05:gangenen, 17:u08:Johannisallee, -8:u02:1873, 18:u03:Untersuchungen, 16:u05:Jahrhunderts, 11:u07:Leipzig, @@ -1443018,7 +1460067,6 @@ 10:u03:ganden, 12:u04:gangenen, 11:u08:D-04103, -8:u01:1873, 18:u02:Untersuchungen, 16:u04:Jahrhunderts, 11:u06:Leipzig, @@ -1443030,7 +1460078,6 @@ 10:u02:ganden, 12:u03:gangenen, 17:u07:Johannisallee, -8:u00:1873, 18:u01:Untersuchungen, 16:u03:Jahrhunderts, 11:u05:Leipzig, @@ -1445024,7 +1462071,6 @@ 12:u12:1,726(3), 12:u13:1,736(1), 12:u14:1,711(6), -8:u23:1,72, 12:u00:1,926(1), 12:u01:1,881(4), 10:u02:S1ϪC1, @@ -1449193,7 +1466239,6 @@ 9:u11:hernd, 17:u13:linienbreiten, 17:u14:unterstreicht, -9:uI2:-(/)-, 8:u00:(Zn), 11:u01:dueller, 9:u02:hernd, @@ -1449205,7 +1466250,6 @@ 17:u12:linienbreiten, 17:u13:unterstreicht, 8:u23:Lini, -9:uI1:-(/)-, 11:u00:dueller, 9:u01:hernd, 17:u03:Linienbreiten, @@ -1449215,7 +1466259,6 @@ 12:u04:hiermit,, 17:u11:linienbreiten, 17:u12:unterstreicht, -9:uI0:-(/)-, 9:u00:hernd, 17:u02:Linienbreiten, 17:u03:unterstreicht, @@ -1452427,7 +1469470,6 @@ 10:u11:nagoya, 11:u01:(JSPS),, 12:u06:10875115, -7:u08:SRC, 15:u02:University;, 10:u10:nagoya, 12:u14:10875115, @@ -1452437,37 +1469479,29 @@ 15:u01:University;, 12:u13:10875115, 12:u04:10875115, -7:u07:SRC, 15:u00:University;, 12:u12:10875115, 12:u03:10875115, -7:u06:SRC, 25:u07:R01-2008-000-10477-0), 21:u08:2008-313-C00177),, 12:u11:10875115, 12:u02:10875115, -7:u05:SRC, 25:u06:R01-2008-000-10477-0), 12:u10:10875115, 25:u14:r01-2008-000-10477-0), 12:u01:10875115, -7:u04:SRC, 25:u05:R01-2008-000-10477-0), 21:u07:2008-313-C00177),, 16:u08:Information;, 25:u13:r01-2008-000-10477-0), -7:u22:SRC, -7:u23:SRC, 10:uI2:----)-, 12:u00:10875115, -7:u03:SRC, 25:u04:R01-2008-000-10477-0), 21:u06:2008-313-C00177),, 16:u07:Information;, 25:u12:r01-2008-000-10477-0), 21:u14:2008-313-c00177),, 10:uI1:----)-, -7:u02:SRC, 25:u03:R01-2008-000-10477-0), 21:u05:2008-313-C00177),, 16:u06:Information;, @@ -1452475,7 +1469509,6 @@ 21:u13:2008-313-c00177),, 10:uI0:----)-, 8:uI2:--),, -7:u01:SRC, 25:u02:R01-2008-000-10477-0), 21:u04:2008-313-C00177),, 11:u08:Agency;, @@ -1452483,7 +1469516,6 @@ 25:u10:r01-2008-000-10477-0), 21:u12:2008-313-c00177),, 8:uI1:--),, -7:u00:SRC, 25:u01:R01-2008-000-10477-0), 21:u03:2008-313-C00177),, 16:u04:Information;, @@ -1463291,7 +1480323,6 @@ 7:u00:qCT, 8:u02:qCT., 13:u05:1.7037(4), -14:u08:complexes,, 12:u04:1.237(1), 8:u10:qct., 13:u13:1.7037(4), @@ -1463305,28 +1480336,15 @@ 23:uI1:.().(),.(),.().().,, 8:u00:qCT., 13:u03:1.7037(4), -14:u07:complexes,, 12:u02:1.237(1), 13:u11:1.7037(4), 23:uI0:.().(),.(),.().().,, 13:u02:1.7037(4), -14:u06:complexes,, 12:u01:1.237(1), 13:u10:1.7037(4), -14:u14:complexes,, 13:u01:1.7037(4), -14:u05:complexes,, 12:u00:1.237(1), -14:u13:complexes,, 13:u00:1.7037(4), -14:u04:complexes,, -14:u12:complexes,, -14:u03:complexes,, -14:u11:complexes,, -14:u02:complexes,, -14:u10:complexes,, -14:u01:complexes,, -14:u00:complexes,, 18:u14:determinations, 15:u08:Molecules"., 18:u13:determinations, @@ -1468213,7 +1485231,6 @@ 11:u06:(AuNPs), 23:u08:Electropolmerizable, 16:u13:nothiophenol, -17:u14:nanoparticles, 16:u04:nothiophenol, 10:u07:(CPF)., 13:u01:Machines,, @@ -1468221,7 +1485238,6 @@ 11:u05:(AuNPs), 23:u07:Electropolmerizable, 16:u12:nothiophenol, -17:u13:nanoparticles, 16:u03:nothiophenol, 10:u06:(CPF)., 13:u00:Machines,, @@ -1468229,7 +1485245,6 @@ 11:u04:(AuNPs), 23:u06:Electropolmerizable, 16:u11:nothiophenol, -17:u12:nanoparticles, 10:u14:(cpf)., 16:u02:nothiophenol, 10:u05:(CPF)., @@ -1468237,14 +1485252,12 @@ 11:u03:(AuNPs), 23:u05:Electropolmerizable, 16:u10:nothiophenol, -17:u11:nanoparticles, 10:u13:(cpf)., 16:u01:nothiophenol, 10:u04:(CPF)., 10:u01:(PATP), 11:u02:(AuNPs), 23:u04:Electropolmerizable, -17:u10:nanoparticles, 10:u12:(cpf)., 8:u23:(CPF, 16:u00:nothiophenol, @@ -1471879,27 +1488892,13 @@ 9:u10:\have, 9:u01:\have, 9:u00:\have, -10:u08:incurs, -10:u07:incurs, 16:u08:goal-related, -10:u06:incurs, 16:u07:goal-related, -10:u14:incurs, -10:u05:incurs, 16:u06:goal-related, -10:u13:incurs, -10:u04:incurs, 16:u05:goal-related, -10:u12:incurs, -10:u03:incurs, 16:u04:goal-related, -10:u11:incurs, -10:u02:incurs, 16:u03:goal-related, -10:u10:incurs, -10:u01:incurs, 16:u02:goal-related, -10:u00:incurs, 16:u01:goal-related, 16:u00:goal-related, 9:u08:CT(t), @@ -1475395,7 +1492394,6 @@ 10:u07:vague., 14:u10:ordonnées, 14:u01:ordonnées, -8:u08:2023, 14:u03:réalisés, 10:u06:vague., 13:u14:deuxième, @@ -1475405,32 +1492403,27 @@ 14:u02:réalisés, 10:u05:vague., 13:u13:deuxième, -8:u07:2023, 6:u08:"O, 14:u01:réalisés, 10:u04:vague., 13:u12:deuxième, -8:u06:2023, 7:u07:a», 14:u00:réalisés, 10:u03:vague., 13:u11:deuxième, 8:u14:2023, -8:u05:2023, 7:u06:a», 6:u07:"O, 10:u02:vague., 13:u10:deuxième, 8:u13:2023, 7:u14:a», -8:u04:2023, 7:u05:a», 6:u06:"O, 10:u01:vague., 8:u12:2023, 7:u13:a», 6:u14:"o, -8:u03:2023, 7:u04:a», 6:u05:"O, 7:u08:<\j, @@ -1475441,7 +1492434,6 @@ 7:u21:a», 7:u22:a», 7:u23:a», -8:u02:2023, 7:u03:a», 6:u04:"O, 8:u10:2023, @@ -1475449,13 +1492441,11 @@ 6:u12:"o, 6:u22:"O, 6:u23:"O, -8:u01:2023, 7:u02:a», 6:u03:"O, 7:u07:<\j, 7:u10:a», 6:u11:"o, -8:u00:2023, 7:u01:a», 6:u02:"O, 7:u06:<\j, @@ -1479594,74 +1496584,56 @@ 15:u00:connection,, 15:u08:phisticated, 12:u08:derstand, -10:u08:world,, 15:u07:phisticated, -10:u07:world,, 15:u06:phisticated, 12:u07:derstand, -10:u06:world,, 15:u14:phisticated, 15:u05:phisticated, 12:u06:derstand, -10:u05:world,, 15:u13:phisticated, 12:u14:derstand, 15:u04:phisticated, 12:u05:derstand, -10:u04:world,, 15:u12:phisticated, 12:u13:derstand, 15:u03:phisticated, 12:u04:derstand, -10:u03:world,, 15:u11:phisticated, 12:u12:derstand, 15:u02:phisticated, 12:u03:derstand, -10:u02:world,, 15:u10:phisticated, 12:u11:derstand, 14:u14:namespaces, 15:u01:phisticated, 12:u02:derstand, -10:u01:world,, 12:u10:derstand, 14:u13:namespaces, 15:u00:phisticated, 12:u01:derstand, -10:u00:world,, 14:u12:namespaces, 12:u00:derstand, 14:u11:namespaces, 14:u10:namespaces, -15:u08:interfaces,, -15:u07:interfaces,, 10:u08:turers, -15:u06:interfaces,, 7:u14:vfs, -15:u05:interfaces,, 7:u13:vfs, 10:u07:turers, -15:u04:interfaces,, 7:u12:vfs, 7:u22:VFS, 7:u23:VFS, 10:u06:turers, -15:u03:interfaces,, 11:u08:Web93]., 7:u11:vfs, 10:u14:turers, 10:u05:turers, -15:u02:interfaces,, 11:u07:Web93]., 7:u10:vfs, 10:u13:turers, 10:u04:turers, -15:u01:interfaces,, 11:u06:Web93]., 10:u12:turers, 10:u03:turers, -15:u00:interfaces,, 11:u05:Web93]., 10:u11:turers, 10:u02:turers, @@ -1481178,7 +1498150,6 @@ 10:u03:Wenbin, 13:u04:91630309), 14:u06:Disclaimer, -15:u08:manuscript;, 10:u11:wenbin, 13:u12:91630309), 8:u23:9163, @@ -1481192,38 +1498163,25 @@ 13:u02:91630309), 14:u04:Disclaimer, 12:u06:agement,, -15:u07:manuscript;, 13:u10:91630309), 12:u14:agement,, 10:u00:Wenbin, 13:u01:91630309), 14:u03:Disclaimer, 12:u05:agement,, -15:u06:manuscript;, 12:u13:agement,, -15:u14:manuscript;, 13:u00:91630309), 14:u02:Disclaimer, 12:u04:agement,, -15:u05:manuscript;, 12:u12:agement,, -15:u13:manuscript;, 14:u01:Disclaimer, 12:u03:agement,, -15:u04:manuscript;, 12:u11:agement,, -15:u12:manuscript;, 14:u00:Disclaimer, 12:u02:agement,, -15:u03:manuscript;, 12:u10:agement,, -15:u11:manuscript;, 12:u01:agement,, -15:u02:manuscript;, -15:u10:manuscript;, 12:u00:agement,, -15:u01:manuscript;, -15:u00:manuscript;, 10:u08:Xinyue, 10:u07:Xinyue, 11:u08:Hubei),, @@ -1484378,7 +1501336,6 @@ 8:u04:(25%, 7:u12:acv, 7:u13:(1%, -7:u22:ACV, 7:u23:ACV, 11:uI2:(()).--, 10:u00:(n=2-6, @@ -1484650,26 +1501607,20 @@ 8:u00:2.95, 8:u01:3.05, 8:u00:3.05, -13:u08:Extracted, -13:u07:Extracted, 11:u08:Acetoin, 10:u08:88.05), -13:u06:Extracted, 15:u08:Tri-culture, 10:u07:88.05), -13:u05:Extracted, 11:u07:Acetoin, 12:u08:(~0.28%), 10:u06:88.05), 8:u14:(m/z, -13:u04:Extracted, 11:u06:Acetoin, 15:u07:Tri-culture, 14:u08:Co-culture, 10:u05:88.05), 8:u13:(m/z, 11:u14:acetoin, -13:u03:Extracted, 11:u05:Acetoin, 15:u06:Tri-culture, 12:u07:(~0.28%), @@ -1484680,7 +1501631,6 @@ 15:u14:tri-culture, 7:u22:(m/, 8:u23:(m/z, -13:u02:Extracted, 11:u04:Acetoin, 15:u05:Tri-culture, 12:u06:(~0.28%), @@ -1484690,7 +1501640,6 @@ 11:u12:acetoin, 15:u13:tri-culture, 12:u14:(~0.28%), -13:u01:Extracted, 11:u03:Acetoin, 15:u04:Tri-culture, 12:u05:(~0.28%), @@ -1484702,7 +1501651,6 @@ 11:u11:acetoin, 15:u12:tri-culture, 12:u13:(~0.28%), -13:u00:Extracted, 11:u02:Acetoin, 15:u03:Tri-culture, 12:u04:(~0.28%), @@ -1485718,34 +1502666,20 @@ 9:uI0:().,/, 10:uI1:(),.,/, 10:uI0:(),.,/, -10:u08:100000, -10:u07:100000, -10:u06:100000, -10:u14:100000, -10:u05:100000, 13:u08:Standard:, 9:u08:87.1), -10:u13:100000, -10:u04:100000, 9:u07:87.1), -10:u12:100000, -10:u03:100000, 13:u07:Standard:, 17:u08:(S.cerevisiae, 9:u06:87.1), -10:u11:100000, -10:u02:100000, 13:u06:Standard:, 14:u08:A.malorum), 9:u05:87.1), -10:u10:100000, 13:u14:standard:, -10:u01:100000, 13:u05:Standard:, 17:u07:(S.cerevisiae, 9:u04:87.1), 13:u13:standard:, -10:u00:100000, 13:u04:Standard:, 17:u06:(S.cerevisiae, 14:u07:A.malorum), @@ -1487110,7 +1504044,6 @@ 7:u03:Oil, 7:u12:emd, 14:u13:gibbstown,, -7:u22:EMD, 7:u23:EMD, 7:u03:EMD, 14:u04:Gibbstown,, @@ -1487643,7 +1504576,6 @@ 12:u02:Ethanol,, 9:u03:Decon, 10:u05:Acetal, -9:u08:Acros, 16:u03:Laboratories, 9:u05:(1,1,, 9:u11:decon, @@ -1487655,70 +1504587,48 @@ 9:u08:Grand, 16:u02:Laboratories, 9:u04:(1,1,, -12:u08:Organics, 9:u10:decon, 10:u12:acetal, 12:u00:Ethanol,, 9:u01:Decon, 10:u03:Acetal, 16:u06:Acetaldehyde, -9:u07:Acros, 16:u01:Laboratories, 9:u03:(1,1,, -12:u07:Organics, 10:u11:acetal, 9:u00:Decon, 10:u02:Acetal, 16:u05:Acetaldehyde, -9:u06:Acros, 9:u07:Grand, 16:u00:Laboratories, 9:u02:(1,1,, -12:u06:Organics, 10:u10:acetal, -9:u14:acros, 10:u01:Acetal, 16:u04:Acetaldehyde, -9:u05:Acros, 9:u06:Grand, 9:u01:(1,1,, -12:u05:Organics, -9:u13:acros, 9:u14:grand, 10:u00:Acetal, 16:u03:Acetaldehyde, -9:u04:Acros, 9:u05:Grand, 14:u08:1-pentanol, 9:u00:(1,1,, -12:u04:Organics, -9:u12:acros, 9:u13:grand, 16:u02:Acetaldehyde, -9:u03:Acros, 9:u04:Grand, -12:u03:Organics, -9:u11:acros, 9:u12:grand, 16:u01:Acetaldehyde, -9:u02:Acros, 9:u03:Grand, 14:u07:1-pentanol, -12:u02:Organics, -9:u10:acros, 9:u11:grand, 16:u00:Acetaldehyde, -9:u01:Acros, 9:u02:Grand, 14:u06:1-pentanol, 18:u08:Benzeneethanol, -12:u01:Organics, 9:u10:grand, 14:u14:1-pentanol, -9:u00:Acros, 9:u01:Grand, 14:u05:1-pentanol, -12:u00:Organics, 21:u08:(2-phenylethanol), 14:u13:1-pentanol, 9:u00:Grand, @@ -1492034,8 +1508944,6 @@ 15:u13:dual-colour, 15:u04:Dual-colour, 15:u12:dual-colour, -7:u22:Dua, -8:u23:Dual, 15:u03:Dual-colour, 15:u11:dual-colour, 15:u02:Dual-colour, @@ -1492820,7 +1509728,6 @@ 11:u04:Arriola, 21:u07:Rodriguez-Pinilla, 9:uI0::.;:., -9:u08:CCND1, 12:u01:Elbauomy, 11:u03:Arriola, 21:u06:Rodriguez-Pinilla, @@ -1492829,47 +1509736,32 @@ 11:u02:Arriola, 21:u05:Rodriguez-Pinilla, 14:u07:Reis-Filho, -9:u07:CCND1, 11:u01:Arriola, 21:u04:Rodriguez-Pinilla, 14:u06:Reis-Filho, -9:u06:CCND1, 9:u08:EGFR,, 11:u00:Arriola, 21:u03:Rodriguez-Pinilla, 14:u05:Reis-Filho, -9:u14:ccnd1, -9:u05:CCND1, 21:u02:Rodriguez-Pinilla, 14:u04:Reis-Filho, -9:u13:ccnd1, -9:u04:CCND1, 9:u07:EGFR,, 21:u01:Rodriguez-Pinilla, 14:u03:Reis-Filho, -9:u12:ccnd1, -7:u22:CCN, -8:u23:CCND, -9:u03:CCND1, 9:u06:EGFR,, 21:u00:Rodriguez-Pinilla, 14:u02:Reis-Filho, 12:u08:Martinho, -9:u11:ccnd1, 9:u14:egfr,, -9:u02:CCND1, 9:u05:EGFR,, 9:u08:PDGFA, 14:u01:Reis-Filho, 12:u07:Martinho, -9:u10:ccnd1, 9:u13:egfr,, -9:u01:CCND1, 9:u04:EGFR,, 14:u00:Reis-Filho, 12:u06:Martinho, 9:u12:egfr,, -9:u00:CCND1, 9:u03:EGFR,, 9:u07:PDGFA, 12:u05:Martinho, @@ -1494320,14 +1511212,12 @@ 13:u07:pitch/yaw, 10:u13:stylet, 8:u14:loo,, -9:uI2:.(.,-, 10:u04:stylet, 8:u05:loo,, 11:u05:Canada), 13:u06:pitch/yaw, 10:u12:stylet, 8:u13:loo,, -9:uI1:.(.,-, 10:u03:stylet, 8:u04:loo,, 11:u04:Canada), @@ -1494336,7 +1511226,6 @@ 10:u11:stylet, 8:u12:loo,, 8:u23:loo,, -9:uI0:.(.,-, 9:uI2:/..,., 10:u02:stylet, 8:u03:loo,, @@ -1496969,15 +1513858,12 @@ 10:u01:(RMSE), 10:u00:(RMSE), 16:u08:REGCAN95/UTM, -9:uI2:-(./), 16:u07:REGCAN95/UTM, 18:u08:OpenTopography, -9:uI1:-(./), 16:u06:REGCAN95/UTM, 10:u08:Errors, 18:u07:OpenTopography, 16:u14:regcan95/utm, -9:uI0:-(./), 16:u05:REGCAN95/UTM, 18:u06:OpenTopography, 16:u13:regcan95/utm, @@ -1509305,27 +1526191,9 @@ 7:u03:699, 7:u11:699, 7:u02:699, -6:u08:r2, 7:u10:699, 7:u01:699, -6:u07:r2, 7:u00:699, -6:u06:r2, -6:u05:r2, -6:u04:r2, -6:u08:r3, -6:u03:r2, -6:u07:r3, -6:u02:r2, -6:u06:r3, -6:u01:r2, -6:u05:r3, -6:u00:r2, -6:u04:r3, -6:u03:r3, -6:u02:r3, -6:u01:r3, -6:u00:r3, 6:u14:.6, 6:u13:.6, 6:u12:.6, @@ -1517178,19 +1534046,16 @@ 9:u00:Kirk,, 11:u03:Effort:, 15:u05:Herrera-Mor, -13:uI2:.-,-,-,-., 18:u03:Responsibility, 15:u06:self-esteem, 11:u02:Effort:, 15:u04:Herrera-Mor, 15:u14:self-esteem, -13:uI1:.-,-,-,-., 18:u02:Responsibility, 15:u05:self-esteem, 11:u01:Effort:, 15:u03:Herrera-Mor, 15:u13:self-esteem, -13:uI0:.-,-,-,-., 12:uI2:-..;():-, 18:u01:Responsibility, 15:u04:self-esteem, @@ -1518357,14 +1535222,9 @@ 8:u05:one;, 8:u04:one;, 8:u03:one;, -11:u14:frames., 8:u02:one;, -11:u13:frames., 8:u01:one;, -11:u12:frames., 8:u00:one;, -11:u11:frames., -11:u10:frames., 11:u08:pering., 11:u07:pering., 19:u08:re-authenticate, @@ -1518919,24 +1535779,18 @@ 18:u05:Instantiation., 7:u01:Os], 18:u13:instantiation., -7:u14:ned, 7:u00:Go,, 18:u04:Instantiation., 7:u00:Os], 18:u12:instantiation., -7:u13:ned, 18:u03:Instantiation., 13:u08:practice", 18:u11:instantiation., -7:u12:ned, -7:u23:ned, 18:u02:Instantiation., 18:u10:instantiation., -7:u11:ned, 18:u01:Instantiation., 13:u07:practice", 8:u08:BR]., -7:u10:ned, 18:u00:Instantiation., 13:u06:practice", 13:u14:practice", @@ -1522211,15 +1539065,10 @@ 12:u00:command), 11:u07:system), 11:u06:system), -11:u14:system), 11:u05:system), -11:u13:system), 11:u04:system), -11:u12:system), 11:u03:system), -11:u11:system), 11:u02:system), -11:u10:system), 11:u01:system), 11:u00:system), 11:u08:(names), @@ -1527873,44 +1544722,30 @@ 10:u07:GOLPH3, 11:u05:MYO18A,, 10:u06:GOLPH3, -20:u08:phosphoinositide, 11:u04:MYO18A,, 10:u14:golph3, 10:u05:GOLPH3, 11:u03:MYO18A,, 10:u13:golph3, 10:u04:GOLPH3, -20:u07:phosphoinositide, 11:u02:MYO18A,, 10:u12:golph3, 10:u03:GOLPH3, -20:u06:phosphoinositide, 11:u01:MYO18A,, 10:u11:golph3, -20:u14:phosphoinositide, 10:u02:GOLPH3, -20:u05:phosphoinositide, 11:u00:MYO18A,, 10:u10:golph3, -20:u13:phosphoinositide, 10:u01:GOLPH3, -20:u04:phosphoinositide, 8:u08:Sac1, -20:u12:phosphoinositide, 10:u00:GOLPH3, -20:u03:phosphoinositide, 8:u07:Sac1, -20:u11:phosphoinositide, -20:u02:phosphoinositide, 8:u06:Sac1, 25:u08:Phosphatidylinositols, -20:u10:phosphoinositide, -20:u01:phosphoinositide, 18:u08:polyadenylated, 8:u05:Sac1, 25:u07:Phosphatidylinositols, 9:u08:InsP6, -20:u00:phosphoinositide, 8:u04:Sac1, 25:u06:Phosphatidylinositols, 9:u07:InsP6, @@ -1528955,7 +1545790,6 @@ 12:uI2:(,)(.).,, 25:u00:mannosyltransferases., 8:u12:mapk, -8:u23:MAPK, 12:uI1:(,)(.).,, 14:u07:Jendretzki, 8:u11:mapk, @@ -1529447,7 +1546281,6 @@ 7:u02:Ngo, 14:u04:Pellicioli, 10:u05:Foiani, -11:u08:Petkova, 7:u02:GH,, 7:u10:ngo, 14:u12:pellicioli, @@ -1529463,44 +1546296,36 @@ 7:u00:Ngo, 14:u02:Pellicioli, 10:u03:Foiani, -11:u07:Petkova, 7:u00:GH,, 14:u10:pellicioli, 10:u11:foiani, 14:u01:Pellicioli, 10:u02:Foiani, -11:u06:Petkova, 11:u08:Potelle, 10:u10:foiani, 11:u14:petkova, 14:u00:Pellicioli, 10:u01:Foiani, -11:u05:Petkova, 11:u13:petkova, 11:uI2:,-,-..-, 10:u00:Foiani, -11:u04:Petkova, 11:u07:Potelle, 11:u08:Puglisi, 11:u12:petkova, 11:uI1:,-,-..-, -11:u03:Petkova, 11:u06:Potelle, 11:u11:petkova, 11:u14:potelle, 11:uI0:,-,-..-, -11:u02:Petkova, 11:u05:Potelle, 11:u07:Puglisi, 14:u08:2328-2339., 11:u10:petkova, 11:u13:potelle, -11:u01:Petkova, 11:u04:Potelle, 11:u06:Puglisi, 11:u12:potelle, 11:u14:puglisi, -11:u00:Petkova, 11:u03:Potelle, 11:u05:Puglisi, 14:u07:2328-2339., @@ -1530278,7 +1547103,6 @@ 8:u12:rrm3, 8:u13:tel1, 9:u14:mre11, -7:u22:RRM, 8:u23:RRM3, 9:u00:YKU80, 8:u01:NMD2, @@ -1535228,7 +1552052,6 @@ 16:u00:Pierre-Simon, 11:u11:tokyo),, 13:u12:mri-cgcm3, -8:u23:MRI-, 13:u00:MIROC-ESM, 11:u02:Tokyo),, 13:u03:MRI-CGCM3, @@ -1546006,7 +1562829,6 @@ 15:u02:infarction,, 11:u04:(p=2.33, 10:u12:cdkn2b, -8:u23:CDKN, 15:uI1:(.−)(.)(,, 15:u01:infarction,, 11:u03:(p=2.33, @@ -1547208,18 +1564030,15 @@ 10:u02:(ARIC), 10:u03:Lamina, 13:u06:16952925], -12:uI2:--..;:-., 12:u03:brachial, 18:u00:ankle-brachial, 10:u01:(ARIC), 10:u02:Lamina, 13:u05:16952925], -12:uI1:--..;:-., 12:u02:brachial, 10:u00:(ARIC), 10:u01:Lamina, 13:u04:16952925], -12:uI0:--..;:-., 12:u01:brachial, 10:u00:Lamina, 13:u03:16952925], @@ -1547990,13 +1564809,11 @@ 13:u06:16979004], 9:u07:Conen, 16:u13:multi-ethnic, -13:uI2:-()..;:-., 16:u04:Multi-Ethnic, 13:u01:18714375], 13:u05:16979004], 9:u06:Conen, 16:u12:multi-ethnic, -13:uI1:-()..;:-., 16:u03:Multi-Ethnic, 18:u08:apolipoprotein, 13:u00:18714375], @@ -1548004,7 +1564821,6 @@ 9:u05:Conen, 9:u08:Viiri, 16:u11:multi-ethnic, -13:uI0:-()..;:-., 16:u02:Multi-Ethnic, 13:u03:16979004], 9:u04:Conen, @@ -1551025,32 +1567841,26 @@ 10:u03:Mirror, 11:u06:Conical, 12:u08:−ξ/δ, -11:u14:conical, 10:u02:Mirror, 11:u05:Conical, 13:u07:Spherical, -11:u13:conical, 10:u01:Mirror, 11:u04:Conical, 13:u06:Spherical, 12:u07:−ξ/δ, -11:u12:conical, 16:uI2:(())/(()−), 10:u00:Mirror, 11:u03:Conical, 13:u05:Spherical, 12:u06:−ξ/δ, 14:u08:concentric, -11:u11:conical, 12:u14:−ξ/δ, 16:uI1:(())/(()−), 11:u02:Conical, 13:u04:Spherical, 12:u05:−ξ/δ, 12:u08:circles., -11:u10:conical, 12:u13:−ξ/δ, -8:u23:Sphe, 16:uI0:(())/(()−), 11:u01:Conical, 13:u03:Spherical, @@ -1551654,7 +1568464,6 @@ 16:u01:outnumbering, 12:u04:conical,, 12:u12:conical,, -8:u23:coni, 8:uI0:-);,, 11:uI1:,;,'-'., 16:u00:outnumbering, @@ -1560951,17 +1577760,12 @@ 16:u03:translation,, 8:u00:RNA?, 16:u02:translation,, -16:u14:appreciation, 16:u01:translation,, 19:u08:rationalization, -16:u13:appreciation, 16:u00:translation,, 19:u07:rationalization, -16:u12:appreciation, 19:u06:rationalization, -16:u11:appreciation, 19:u05:rationalization, -16:u10:appreciation, 19:u04:rationalization, 19:u03:rationalization, 19:u02:rationalization, @@ -1572142,44 +1588946,35 @@ 13:u12:inactive,, 13:u03:inactive,, 25:u05:prophase-to-metaphase, -8:u08:CDK1, 13:u11:inactive,, 11:uI2:--[,].,, 13:u02:inactive,, 14:u08:junctional, 25:u04:prophase-to-metaphase, -8:u07:CDK1, 13:u10:inactive,, 11:uI1:--[,].,, 13:u01:inactive,, 25:u03:prophase-to-metaphase, -8:u06:CDK1, 11:uI0:--[,].,, 13:u00:inactive,, 14:u07:junctional, 25:u02:prophase-to-metaphase, -8:u05:CDK1, 14:u06:junctional, 16:u08:[8,9,10,11];, 25:u01:prophase-to-metaphase, -8:u04:CDK1, 14:u14:junctional, 14:u05:junctional, 25:u00:prophase-to-metaphase, -8:u03:CDK1, 14:u13:junctional, 14:u04:junctional, 16:u07:[8,9,10,11];, -8:u02:CDK1, 14:u12:junctional, 14:u03:junctional, 16:u06:[8,9,10,11];, -8:u01:CDK1, 14:u11:junctional, 16:u14:[8,9,10,11];, 14:u02:junctional, 16:u05:[8,9,10,11];, -8:u00:CDK1, 14:u10:junctional, 16:u13:[8,9,10,11];, 17:uI2:[,,,];-[],[]., @@ -1572647,7 +1589442,6 @@ 7:u08:RIa, 15:u14:treated/not, 15:u05:treated/not, -7:u08:mM), 10:u04:(CCs),, 7:u07:RIa, 15:u13:treated/not, @@ -1572656,37 +1589450,29 @@ 7:u06:RIa, 15:u12:treated/not, 15:u03:treated/not, -7:u07:mM), 10:u02:(CCs),, 7:u05:RIa, 15:u11:treated/not, 15:u02:treated/not, -7:u06:mM), 10:u01:(CCs),, 7:u04:RIa, 15:u10:treated/not, 7:u14:mm), 15:u01:treated/not, -7:u05:mM), 10:u00:(CCs),, 7:u03:RIa, 7:u13:mm), 15:u00:treated/not, -7:u04:mM), 7:u02:RIa, 7:u12:mm), 7:u22:mM), 7:u23:mM), -7:u03:mM), 41:u08:doi:10.1371/journal.pone.0037835.g003, 7:u01:RIa, 7:u11:mm), -7:u02:mM), 7:u00:RIa, 7:u10:mm), -7:u01:mM), 41:u07:doi:10.1371/journal.pone.0037835.g003, -7:u00:mM), 41:u06:doi:10.1371/journal.pone.0037835.g003, 41:u14:doi:10.1371/journal.pone.0037835.g003, 41:u05:doi:10.1371/journal.pone.0037835.g003, @@ -1572950,7 +1589736,6 @@ 16:u04:CREB-binding, 65:u07:www.sabiosciences.com/chipqpcrsearch.php?species_id=1&factor=, 16:u12:creb-binding, -8:u23:CREB, 16:u03:CREB-binding, 65:u06:www.sabiosciences.com/chipqpcrsearch.php?species_id=1&factor=, 56:u07:CREB&gene=GPR3&nfactor=n&ninfo=n&ngene=n&B2=Search)., @@ -1575058,18 +1591843,15 @@ 9:u11:dmrs,, 12:u12:ips-dmrs, 8:u23:iPS-, -8:uI2::--,, 16:u01:ES-iPS-DMRs., 9:u02:DMRs,, 12:u03:iPS-DMRs, 9:u10:dmrs,, 12:u11:ips-dmrs, -8:uI1::--,, 16:u00:ES-iPS-DMRs., 9:u01:DMRs,, 12:u02:iPS-DMRs, 12:u10:ips-dmrs, -8:uI0::--,, 9:u00:DMRs,, 12:u01:iPS-DMRs, 19:u08:de-methylation,, @@ -1575143,7 +1591925,6 @@ 15:u00:ES-iPS-DMRs, 14:u05:ES-iPS-DMR, 13:u12:esom-ipsc, -7:u22:Eso, 8:u23:Esom, 12:uI1:---,(.)., 13:u03:Esom-iPSC, @@ -1575758,50 +1592539,41 @@ 23:u03:2011;7(5):e1002085., 26:u06:2009;462(7271):315-22., 19:u00:extra-embryonic, -19:u08:cancer-specific, 23:u11:2011;7(5):e1002085., 26:u14:2009;462(7271):315-22., 14:uI1:[],,,,,-,., 23:u02:2011;7(5):e1002085., 26:u05:2009;462(7271):315-22., 14:u07:tissue-and, -19:u07:cancer-specific, 23:u10:2011;7(5):e1002085., 26:u13:2009;462(7271):315-22., 14:uI0:[],,,,,-,., 23:u01:2011;7(5):e1002085., 26:u04:2009;462(7271):315-22., 14:u06:tissue-and, -19:u06:cancer-specific, 26:u12:2009;462(7271):315-22., 14:u14:tissue-and, 23:u00:2011;7(5):e1002085., 26:u03:2009;462(7271):315-22., 14:u05:tissue-and, -19:u05:cancer-specific, 26:u11:2009;462(7271):315-22., 14:u13:tissue-and, 26:u02:2009;462(7271):315-22., 14:u04:tissue-and, -19:u04:cancer-specific, 26:u10:2009;462(7271):315-22., 14:u12:tissue-and, 26:u01:2009;462(7271):315-22., 14:u03:tissue-and, -19:u03:cancer-specific, 14:u11:tissue-and, 26:u00:2009;462(7271):315-22., 14:u02:tissue-and, -19:u02:cancer-specific, 9:u08:Tesar, 14:u10:tissue-and, 14:u01:tissue-and, 25:u08:2007;448(7150):196-9., -19:u01:cancer-specific, 9:u07:Tesar, 12:u08:epiblast, 14:u00:tissue-and, -19:u00:cancer-specific, 9:u06:Tesar, 12:u07:epiblast, 25:u07:2007;448(7150):196-9., @@ -1576603,7 +1593375,6 @@ 9:u11:rab25, 9:u12:ptpn6, 8:u14:rin2, -8:u23:PTPN, 10:u01:POU5F1, 9:u02:RAB25, 9:u03:PTPN6, @@ -1578210,7 +1594981,6 @@ 9:u13:igf2r, 9:u04:IGF2R, 9:u12:igf2r, -7:u22:IGF, 8:u23:IGF2, 9:u03:IGF2R, 9:u11:igf2r, @@ -1582953,7 +1599723,6 @@ 8:u11:1058, 8:u12:1064, 8:u13:2122, -8:u23:1064, 8:u02:1058, 8:u03:1064, 8:u04:2122, @@ -1586120,7 +1602889,6 @@ 8:u02:ods., 9:u04:(Apis, 40:u05:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u08:toma, 15:u03:Chaud-Netto, 13:u04:mellifera, 12:u06:Insausti, @@ -1586146,7 +1602914,6 @@ 8:u00:ods., 9:u02:(Apis, 40:u03:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u07:toma, 15:u01:Chaud-Netto, 13:u02:mellifera, 12:u04:Insausti, @@ -1586158,7 +1602925,6 @@ 11:uI0:..////., 9:u01:(Apis, 40:u02:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u06:toma, 15:u00:Chaud-Netto, 13:u01:mellifera, 12:u03:Insausti, @@ -1586166,51 +1602932,41 @@ 13:u06:infestans, 12:u07:477-481., 40:u10:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u14:toma, 12:uI2:.,,,.-,-, 9:u00:(Apis, 40:u01:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u05:toma, 12:u08:20061564, 13:u00:mellifera, 12:u02:Insausti, 10:u04:Moraes, 13:u05:infestans, 12:u06:477-481., -8:u13:toma, 7:u14:65:, 12:uI1:.,,,.-,-, 11:uI2:(,)..;;, 40:u00:www.scielo.br/pdf/gmb/v23n1/2314.pdf, -8:u04:toma, 12:u01:Insausti, 10:u03:Moraes, 13:u04:infestans, 12:u05:477-481., -8:u12:toma, 7:u13:65:, 12:uI0:.,,,.-,-, 11:uI1:(,)..;;, -8:u03:toma, 12:u07:20061564, 12:u00:Insausti, 10:u02:Moraes, 13:u03:infestans, 12:u04:477-481., -8:u11:toma, 7:u12:65:, 7:u23:65:, 11:uI0:(,)..;;, -8:u02:toma, 12:u06:20061564, 10:u01:Moraes, 13:u02:infestans, 12:u03:477-481., -8:u10:toma, 7:u11:65:, 12:u14:20061564, 19:uI2:;;:-.://././..:, -8:u01:toma, 12:u05:20061564, 10:u00:Moraes, 13:u01:infestans, @@ -1586218,7 +1602974,6 @@ 7:u10:65:, 12:u13:20061564, 19:uI1:;;:-.://././..:, -8:u00:toma, 12:u04:20061564, 11:u08:9714595, 13:u00:infestans, @@ -1594226,24 +1610981,20 @@ 14:u01:Maniscalco, 15:u03:orthopedics, 27:u05:10.23750/abm.v91i2.9636, -7:u08:JCO, 15:u07:encounters., 14:u00:Maniscalco, 15:u02:orthopedics, 27:u04:10.23750/abm.v91i2.9636, -7:u07:JCO, 15:u06:encounters., 9:u07:00068, 15:u01:orthopedics, 27:u03:10.23750/abm.v91i2.9636, -7:u06:JCO, 8:u08:Sass, 15:u14:encounters., 15:u05:encounters., 9:u06:00068, 15:u00:orthopedics, 27:u02:10.23750/abm.v91i2.9636, -7:u05:JCO, 8:u07:Sass, 15:u13:encounters., 9:u14:00068, @@ -1594251,7 +1611002,6 @@ 15:u04:encounters., 9:u05:00068, 27:u01:10.23750/abm.v91i2.9636, -7:u04:JCO, 8:u06:Sass, 15:u12:encounters., 9:u13:00068, @@ -1594260,7 +1611010,6 @@ 9:u04:00068, 11:u08:01374-w, 27:u00:10.23750/abm.v91i2.9636, -7:u03:JCO, 8:u05:Sass, 15:u11:encounters., 9:u12:00068, @@ -1594268,20 +1611017,17 @@ 16:uI0:..():-.:./.., 15:u02:encounters., 9:u03:00068, -7:u02:JCO, 8:u04:Sass, 15:u10:encounters., 9:u11:00068, 15:u01:encounters., 9:u02:00068, 11:u07:01374-w, -7:u01:JCO, 8:u03:Sass, 9:u10:00068, 15:u00:encounters., 9:u01:00068, 11:u06:01374-w, -7:u00:JCO, 8:u02:Sass, 11:u14:01374-w, 14:uI2:.():.:./--, @@ -1594455,7 +1611201,6 @@ 7:u11:aif, 7:u12:cbf, 10:u14:⌬r2*, -7:u22:CBF, 7:u23:CBF, 7:u02:AIF, 7:u03:CBF, @@ -1598257,34 +1615002,25 @@ 22:u01:optomotor-impaired, 11:u11:telling, 11:u02:telling, -12:u08:tethered, 22:u00:optomotor-impaired, 11:u10:telling, 11:u01:telling, 11:u00:telling, -12:u07:tethered, -12:u06:tethered, 12:u14:tethered, -12:u05:tethered, 13:u08:modality,, 12:u13:tethered, -12:u04:tethered, 13:u07:modality,, 12:u12:tethered, 13:u14:attempts., -12:u03:tethered, 13:u06:modality,, 12:u11:tethered, 13:u13:attempts., -12:u02:tethered, 13:u05:modality,, 12:u10:tethered, 13:u12:attempts., -12:u01:tethered, 19:u08:unphysiological, 13:u04:modality,, 13:u11:attempts., -12:u00:tethered, 13:u03:modality,, 13:u10:attempts., 19:u07:unphysiological, @@ -1602196,28 +1618932,19 @@ 8:u02:mans, 8:u05:ous,, 16:u00:feedforward:, -9:u08:base,, 8:u10:mans, 8:u13:ous,, 8:u01:mans, 8:u04:ous,, -9:u07:base,, 8:u12:ous,, 8:u23:ous,, 8:u00:mans, 8:u03:ous,, -9:u06:base,, 8:u11:ous,, 8:u02:ous,, -9:u05:base,, 8:u10:ous,, 8:u01:ous,, -9:u04:base,, 8:u00:ous,, -9:u03:base,, -9:u02:base,, -9:u01:base,, -9:u00:base,, 14:u08:(Daelemans, 10:uI2:(),(;), 14:u07:(Daelemans, @@ -1602722,7 +1619449,6 @@ 10:u05:27{37,, 14:u10:daelemans,, 10:u12:jholt,, -6:u21:jh, 7:u22:jho, 8:u23:jhol, 10:uI1:,.,,:,, @@ -1605546,7 +1622272,6 @@ 8:u23:ADs,, 8:u03:ADs,, 14:u07:attitudes,, -8:u08:cers, 12:u03:14,27,28, 8:u02:ADs,, 14:u06:attitudes,, @@ -1605554,36 +1622279,22 @@ 14:u14:attitudes,, 8:u01:ADs,, 14:u05:attitudes,, -8:u07:cers, 12:u01:14,27,28, 14:u13:attitudes,, 8:u00:ADs,, 14:u04:attitudes,, -8:u06:cers, 12:u00:14,27,28, 14:u12:attitudes,, -8:u14:cers, 14:u03:attitudes,, -8:u05:cers, 14:u11:attitudes,, -8:u13:cers, 14:u02:attitudes,, -8:u04:cers, 14:u10:attitudes,, -8:u12:cers, -8:u23:cers, 14:u01:attitudes,, -8:u03:cers, 13:u08:together., -8:u11:cers, 14:u00:attitudes,, -8:u02:cers, 9:u08:16,31, -8:u10:cers, -8:u01:cers, 13:u07:together., 9:u07:16,31, -8:u00:cers, 13:u06:together., 9:u06:16,31, 13:u14:together., @@ -1609217,7 +1625928,6 @@ 11:u04:975-80., 8:u05:Sahm, 11:u12:975-80., -8:u23:975-, 15:u00:directives., 11:u03:975-80., 11:u07:437-40., @@ -1615242,33 +1631952,24 @@ 14:u02:mandatory., 14:u01:mandatory., 14:u00:mandatory., -12:u08:powdered, 12:u08:theatres, 12:u07:theatres, -12:u07:powdered, 12:u06:theatres, -12:u06:powdered, 12:u05:theatres, 12:u14:powdered, -12:u05:powdered, 12:u04:theatres, 12:u13:powdered, -12:u04:powdered, 12:u03:theatres, 12:u12:powdered, 9:uI2:•'', -12:u03:powdered, 12:u02:theatres, 12:u11:powdered, 9:uI1:•'', -12:u02:powdered, 12:u01:theatres, 12:u10:powdered, 9:uI0:•'', -12:u01:powdered, 12:u00:theatres, 17:u08:Non-essential, -12:u00:powdered, 17:u07:Non-essential, 17:u06:Non-essential, 17:u05:Non-essential, @@ -1615943,7 +1632644,6 @@ 14:u07:endophytic, 13:u12:mushrooms, 19:u14:single-stranded, -8:u23:mush, 13:u03:mushrooms, 19:u05:single-stranded, 14:u06:endophytic, @@ -1616835,7 +1633535,6 @@ 8:u00:48),, 8:u02:(49,, 18:u06:marrow-derived, -12:u08:Purified, 8:u10:(49,, 18:u14:marrow-derived, 8:u01:(49,, @@ -1616844,37 +1633543,29 @@ 9:uI2:-()/,, 8:u00:(49,, 18:u04:marrow-derived, -12:u07:Purified, 9:u08:27527, 18:u12:marrow-derived, 9:uI1:-()/,, 18:u03:marrow-derived, -12:u06:Purified, 18:u11:marrow-derived, 9:uI0:-()/,, 18:u02:marrow-derived, -12:u05:Purified, 9:u07:27527, 18:u10:marrow-derived, 18:u01:marrow-derived, -12:u04:Purified, 9:u06:27527, 9:u14:27527, 10:uI2:(),-.(, 18:u00:marrow-derived, -12:u03:Purified, 9:u05:27527, 9:u13:27527, 10:uI1:(),-.(, -12:u02:Purified, 9:u04:27527, 9:u12:27527, 8:u23:2752, 10:uI0:(),-.(, -12:u01:Purified, 9:u03:27527, 9:u11:27527, -12:u00:Purified, 9:u02:27527, 9:u10:27527, 9:u01:27527, @@ -1617230,39 +1633921,30 @@ 11:u05:globosa, 10:u03:27543,, 11:u04:globosa, -9:u08:broth, 11:u07:Bertani, 10:u02:27543,, 11:u03:globosa, -9:u07:broth, 11:uI2:(,-).,., 11:u06:Bertani, 10:u01:27543,, 11:u02:globosa, -9:u06:broth, 11:u14:bertani, 11:uI1:(,-).,., 11:u05:Bertani, 10:u00:27543,, 11:u01:globosa, -9:u05:broth, 11:u13:bertani, 11:uI0:(,-).,., 11:u04:Bertani, 11:u00:globosa, -9:u04:broth, 11:u12:bertani, 11:u03:Bertani, -9:u03:broth, 11:u11:bertani, 11:u02:Bertani, -9:u02:broth, 11:u10:bertani, 11:u01:Bertani, -9:u01:broth, 14:uI2:(.(/)-,.)., 11:u00:Bertani, -9:u00:broth, 14:uI1:(.(/)-,.)., 14:uI0:(.(/)-,.)., 11:u08:119,000, @@ -1624351,38 +1641033,15 @@ 14:u06:Cerebellum, 14:u14:cerebellum, 14:u05:Cerebellum, -9:u08:Ovary, 14:u13:cerebellum, 14:u04:Cerebellum, -10:u08:Testis, 14:u12:cerebellum, 14:u03:Cerebellum, -9:u07:Ovary, 14:u11:cerebellum, 14:u02:Cerebellum, -9:u06:Ovary, -10:u07:Testis, 14:u10:cerebellum, 14:u01:Cerebellum, -9:u05:Ovary, -10:u06:Testis, -10:u14:testis, 14:u00:Cerebellum, -9:u04:Ovary, -10:u05:Testis, -10:u13:testis, -9:u03:Ovary, -10:u04:Testis, -10:u12:testis, -9:u02:Ovary, -10:u03:Testis, -10:u11:testis, -9:u01:Ovary, -10:u02:Testis, -10:u10:testis, -9:u00:Ovary, -10:u01:Testis, -10:u00:Testis, 8:u14:tfs,, 8:u13:tfs,, 13:uI2:,.()()()., @@ -1624864,7 +1641523,6 @@ 10:u05:RPL10L, 10:u06:TDRD15, 8:u07:TLR8, -8:u08:TERT, 8:u10:dazl, 9:u11:tdrd1, 9:u12:adad2, @@ -1624891,7 +1641549,6 @@ 10:u04:TDRD15, 8:u05:TLR8, 10:u06:RNASE3, -8:u07:TERT, 10:u08:RNASE9, 9:u10:adad2, 10:u11:rpl10l, @@ -1624904,74 +1641561,62 @@ 10:u03:TDRD15, 8:u04:TLR8, 10:u05:RNASE3, -8:u06:TERT, 10:u07:IFIT1B, 10:u08:RNASE7, 10:u10:rpl10l, 10:u11:tdrd15, 8:u12:tlr8, 10:u13:rnase3, -8:u14:tert, 8:u23:TLR8, 9:u00:ADAD2, 10:u01:RPL10L, 10:u02:TDRD15, 8:u03:TLR8, 10:u04:RNASE3, -8:u05:TERT, 10:u06:IFIT1B, 10:u07:RNASE9, 10:u08:ZCCHC5, 10:u10:tdrd15, 8:u11:tlr8, 10:u12:rnase3, -8:u13:tert, 10:u14:ifit1b, 10:u00:RPL10L, 10:u01:TDRD15, 8:u02:TLR8, 10:u03:RNASE3, -8:u04:TERT, 10:u05:IFIT1B, 10:u06:RNASE9, 10:u07:RNASE7, 11:u08:RNASE13, 8:u10:tlr8, 10:u11:rnase3, -8:u12:tert, 10:u13:ifit1b, 10:u14:rnase9, -8:u23:TERT, 10:u00:TDRD15, 8:u01:TLR8, 10:u02:RNASE3, -8:u03:TERT, 10:u04:IFIT1B, 10:u05:RNASE9, 10:u06:RNASE7, 10:u07:ZCCHC5, 11:u08:EIF4E1B, 10:u10:rnase3, -8:u11:tert, 10:u12:ifit1b, 10:u13:rnase9, 10:u14:rnase7, 8:u00:TLR8, 10:u01:RNASE3, -8:u02:TERT, 10:u03:IFIT1B, 10:u04:RNASE9, 10:u05:RNASE7, 10:u06:ZCCHC5, 11:u07:RNASE13, 8:u08:NXF5, -8:u10:tert, 10:u11:ifit1b, 10:u12:rnase9, 10:u13:rnase7, 10:u14:zcchc5, 10:u00:RNASE3, -8:u01:TERT, 10:u02:IFIT1B, 10:u03:RNASE9, 10:u04:RNASE7, @@ -1624984,7 +1641629,6 @@ 10:u12:rnase7, 10:u13:zcchc5, 11:u14:rnase13, -8:u00:TERT, 10:u01:IFIT1B, 10:u02:RNASE9, 10:u03:RNASE7, @@ -1625338,7 +1641982,6 @@ 9:u12:rps17, 10:u13:ankhd1, 11:u14:eif2s3l, -7:u22:RPS, 8:u23:RPS1, 8:u00:DQX1, 10:u01:LIN28A, @@ -1625469,7 +1642112,6 @@ 9:u05:PTCD1, 9:u06:PSMA6, 10:u07:RNASEK, -8:u08:SMN2, 8:u10:ppan, 9:u11:sarnp, 10:u12:aarsd1, @@ -1625499,83 +1642141,69 @@ 9:u04:PSMA6, 10:u05:RNASEK, 9:u06:EIF3C, -8:u07:SMN2, 9:u08:HELZ2, 10:u10:aarsd1, 9:u11:ptcd1, 9:u12:psma6, 10:u13:rnasek, 9:u14:eif3c, -8:u23:PSMA, 9:u00:SARNP, 10:u01:AARSD1, 9:u02:PTCD1, 9:u03:PSMA6, 10:u04:RNASEK, 9:u05:EIF3C, -8:u06:SMN2, 11:u07:EIF5AL1, 12:u08:ARHGEF28, 9:u10:ptcd1, 9:u11:psma6, 10:u12:rnasek, 9:u13:eif3c, -8:u14:smn2, 10:u00:AARSD1, 9:u01:PTCD1, 9:u02:PSMA6, 10:u03:RNASEK, 9:u04:EIF3C, -8:u05:SMN2, 11:u06:EIF5AL1, 9:u07:HELZ2, 12:u08:PPARGC1B, 9:u10:psma6, 10:u11:rnasek, 9:u12:eif3c, -8:u13:smn2, 11:u14:eif5al1, 8:u23:EIF3, 9:u00:PTCD1, 9:u01:PSMA6, 10:u02:RNASEK, 9:u03:EIF3C, -8:u04:SMN2, 11:u05:EIF5AL1, 9:u06:HELZ2, 12:u07:ARHGEF28, 11:u08:ZC3H12B, 10:u10:rnasek, 9:u11:eif3c, -8:u12:smn2, 11:u13:eif5al1, 9:u14:helz2, -7:u22:SMN, -8:u23:SMN2, 9:u00:PSMA6, 10:u01:RNASEK, 9:u02:EIF3C, -8:u03:SMN2, 11:u04:EIF5AL1, 9:u05:HELZ2, 12:u06:ARHGEF28, 12:u07:PPARGC1B, 10:u08:NANOS1, 9:u10:eif3c, -8:u11:smn2, 11:u12:eif5al1, 9:u13:helz2, 12:u14:arhgef28, 8:u23:EIF5, 10:u00:RNASEK, 9:u01:EIF3C, -8:u02:SMN2, 11:u03:EIF5AL1, 9:u04:HELZ2, 12:u05:ARHGEF28, 12:u06:PPARGC1B, 11:u07:ZC3H12B, -8:u10:smn2, 11:u11:eif5al1, 9:u12:helz2, 12:u13:arhgef28, @@ -1625583,7 +1642211,6 @@ 7:u22:HEL, 8:u23:HELZ, 9:u00:EIF3C, -8:u01:SMN2, 11:u02:EIF5AL1, 9:u03:HELZ2, 12:u04:ARHGEF28, @@ -1625596,7 +1642223,6 @@ 12:u12:arhgef28, 12:u13:ppargc1b, 11:u14:zc3h12b, -8:u00:SMN2, 11:u01:EIF5AL1, 9:u02:HELZ2, 12:u03:ARHGEF28, @@ -1626030,7 +1642656,6 @@ 17:u11:4932411n23rik, 11:u12:smarcc2, 11:u13:smarcc1, -9:u14:ncor2, 9:u00:RBPs:, 17:u02:4932411N23Rik, 11:u03:Smarcc2, @@ -1626042,8 +1642667,6 @@ 17:u10:4932411n23rik, 11:u11:smarcc2, 11:u12:smarcc1, -9:u13:ncor2, -9:u14:ncor1, 17:u01:4932411N23Rik, 11:u02:Smarcc2, 11:u03:Smarcc1, @@ -1626054,8 +1642677,6 @@ 9:u08:Mybl1, 11:u10:smarcc2, 11:u11:smarcc1, -9:u12:ncor2, -9:u13:ncor1, 9:u14:cdc5l, 7:u22:Nco, 8:u23:Ncor, @@ -1626069,8 +1642690,6 @@ 9:u07:Mybl2, 9:u08:Terf1, 11:u10:smarcc1, -9:u11:ncor2, -9:u12:ncor1, 9:u13:cdc5l, 11:u00:Smarcc2, 11:u01:Smarcc1, @@ -1626081,8 +1642700,6 @@ 9:u06:Mybl2, 9:u07:Mybl1, 10:u08:Dnajc1, -9:u10:ncor2, -9:u11:ncor1, 9:u12:cdc5l, 9:u14:mybl2, 8:u23:Cdc5, @@ -1626095,11 +1642712,9 @@ 9:u06:Mybl1, 9:u07:Terf1, 8:u08:Ttf1, -9:u10:ncor1, 9:u11:cdc5l, 9:u13:mybl2, 9:u14:mybl1, -7:u22:Myb, 7:u23:Myb, 9:u00:Ncor2, 9:u01:Ncor1, @@ -1626406,7 +1643021,6 @@ 9:u05:DMTF1, 11:u06:SMARCC2, 10:u07:DNAJC1, -9:u08:NCOR1, 9:u00:MYBL1, 9:u01:MYBL2, 9:u02:RCOR2, @@ -1626424,15 +1643038,12 @@ 11:u04:SMARCC2, 10:u05:DNAJC1, 9:u06:RCOR1, -9:u07:NCOR1, -9:u08:NCOR2, 9:u00:RCOR2, 11:u01:SMARCC1, 9:u02:DMTF1, 11:u03:SMARCC2, 10:u04:DNAJC1, 9:u05:RCOR1, -9:u06:NCOR1, 9:u07:CDC5L, 9:u08:RCOR3, 8:u23:DNAJ, @@ -1626441,51 +1643052,38 @@ 11:u02:SMARCC2, 10:u03:DNAJC1, 9:u04:RCOR1, -9:u05:NCOR1, 9:u06:CDC5L, -9:u07:NCOR2, 8:u08:TTF1, 9:u00:DMTF1, 11:u01:SMARCC2, 10:u02:DNAJC1, 9:u03:RCOR1, -9:u04:NCOR1, 9:u05:CDC5L, -9:u06:NCOR2, 9:u07:RCOR3, 9:u08:TERF2, -8:u23:NCOR, 11:u00:SMARCC2, 10:u01:DNAJC1, 9:u02:RCOR1, -9:u03:NCOR1, 9:u04:CDC5L, -9:u05:NCOR2, 9:u06:RCOR3, 8:u07:TTF1, 10:u08:SNAPC4, 8:u23:CDC5, 10:u00:DNAJC1, 9:u01:RCOR1, -9:u02:NCOR1, 9:u03:CDC5L, -9:u04:NCOR2, 9:u05:RCOR3, 8:u06:TTF1, 9:u07:TERF2, 10:u08:TADA2B, 9:u00:RCOR1, -9:u01:NCOR1, 9:u02:CDC5L, -9:u03:NCOR2, 9:u04:RCOR3, 8:u05:TTF1, 9:u06:TERF2, 10:u07:SNAPC4, 10:u08:DNAJC2, -9:u00:NCOR1, 9:u01:CDC5L, -9:u02:NCOR2, 9:u03:RCOR3, 8:u04:TTF1, 9:u05:TERF2, @@ -1626494,7 +1643092,6 @@ 9:u08:TERF1, 8:u23:TTF1, 9:u00:CDC5L, -9:u01:NCOR2, 9:u02:RCOR3, 8:u03:TTF1, 9:u04:TERF2, @@ -1626503,7 +1643100,6 @@ 10:u07:DNAJC2, 8:u08:ZZZ3, 8:u23:TERF, -9:u00:NCOR2, 9:u01:RCOR3, 8:u02:TTF1, 9:u03:TERF2, @@ -1627132,7 +1643728,6 @@ 9:u04:FOXD4, 9:u05:FOXP3, 9:u07:FOXL2, -9:u08:FOXA1, 11:u10:foxd4l1, 9:u11:foxh1, 9:u12:foxd4, @@ -1627155,7 +1643750,6 @@ 9:u03:FOXP3, 9:u05:FOXL2, 9:u06:FOXA2, -9:u07:FOXA1, 9:u08:FOXD2, 9:u10:foxd4, 9:u11:foxp3, @@ -1627166,69 +1643760,57 @@ 9:u02:FOXP3, 9:u04:FOXL2, 9:u05:FOXA2, -9:u06:FOXA1, 9:u07:FOXA3, 9:u08:FOXL1, 9:u10:foxp3, 9:u12:foxl2, 9:u13:foxa2, -9:u14:foxa1, 8:u23:FOXL, 9:u00:FOXD4, 9:u01:FOXP3, 9:u03:FOXL2, 9:u04:FOXA2, -9:u05:FOXA1, 9:u06:FOXA3, 9:u07:FOXD2, 9:u08:FOXC2, 9:u11:foxl2, 9:u12:foxa2, -9:u13:foxa1, 9:u14:foxa3, -8:u23:FOXA, 9:u00:FOXP3, 9:u02:FOXL2, 9:u03:FOXA2, -9:u04:FOXA1, 9:u05:FOXA3, 9:u06:FOXD2, 9:u07:FOXL1, 9:u08:FOXF1, 9:u10:foxl2, 9:u11:foxa2, -9:u12:foxa1, 9:u13:foxa3, 9:u14:foxd2, 9:u01:FOXL2, 9:u02:FOXA2, -9:u03:FOXA1, 9:u04:FOXA3, 9:u05:FOXD2, 9:u06:FOXL1, 9:u07:FOXC2, 9:u08:FOXP2, 9:u10:foxa2, -9:u11:foxa1, 9:u12:foxa3, 9:u13:foxd2, 9:u14:foxl1, 9:u00:FOXL2, 9:u01:FOXA2, -9:u02:FOXA1, 9:u03:FOXA3, 9:u04:FOXD2, 9:u05:FOXL1, 9:u06:FOXC2, 9:u07:FOXF1, 9:u08:FOXQ1, -9:u10:foxa1, 9:u11:foxa3, 9:u12:foxd2, 9:u13:foxl1, 9:u14:foxc2, 9:u00:FOXA2, -9:u01:FOXA1, 9:u02:FOXA3, 9:u03:FOXD2, 9:u04:FOXL1, @@ -1627241,7 +1643823,6 @@ 9:u12:foxl1, 9:u13:foxc2, 9:u14:foxf1, -9:u00:FOXA1, 9:u01:FOXA3, 9:u02:FOXD2, 9:u03:FOXL1, @@ -1627445,7 +1644026,6 @@ 9:u05:FOXK2, 9:u06:FOXJ3, 9:u07:FOXN3, -9:u08:FOXO3, 9:u12:foxp4, 9:u13:foxk2, 9:u14:foxj3, @@ -1627464,7 +1644044,6 @@ 9:u04:FOXJ3, 9:u05:FOXN3, 9:u06:FOXJ2, -9:u07:FOXO3, 9:u10:foxp4, 9:u11:foxk2, 9:u12:foxj3, @@ -1627475,47 +1644054,35 @@ 9:u03:FOXJ3, 9:u04:FOXN3, 9:u05:FOXJ2, -9:u06:FOXO3, 9:u10:foxk2, 9:u11:foxj3, 9:u12:foxn3, 9:u13:foxj2, -9:u14:foxo3, 9:u00:FOXP4, 9:u01:FOXK2, 9:u02:FOXJ3, 9:u03:FOXN3, 9:u04:FOXJ2, -9:u05:FOXO3, 9:u10:foxj3, 9:u11:foxn3, 9:u12:foxj2, -9:u13:foxo3, 9:u00:FOXK2, 9:u01:FOXJ3, 9:u02:FOXN3, 9:u03:FOXJ2, -9:u04:FOXO3, 9:u10:foxn3, 9:u11:foxj2, -9:u12:foxo3, 9:u00:FOXJ3, 9:u01:FOXN3, 9:u02:FOXJ2, -9:u03:FOXO3, 9:u08:Foxi2, 9:u10:foxj2, -9:u11:foxo3, 9:u00:FOXN3, 9:u01:FOXJ2, -9:u02:FOXO3, 9:u08:Foxe1, -9:u10:foxo3, 9:u00:FOXJ2, -9:u01:FOXO3, 9:u07:Foxi2, 9:u08:Foxn1, -9:u00:FOXO3, 9:u06:Foxi2, 9:u07:Foxe1, 9:u08:Foxe3, @@ -1628671,26 +1645238,17 @@ 14:u02:subtleties, 14:u01:subtleties, 14:u00:subtleties, -8:u08:law., -8:u07:law., -8:u06:law., 14:u08:Motivating, -8:u05:law., 14:u07:Motivating, 7:uI2:.],, -8:u04:law., 14:u06:Motivating, 7:uI1:.],, -8:u03:law., 14:u05:Motivating, 7:uI0:.],, 7:u08:1]., -8:u02:law., 14:u04:Motivating, -8:u01:law., 14:u03:Motivating, 7:u07:1]., -8:u00:law., 14:u02:Motivating, 7:u06:1]., 14:u01:Motivating, @@ -1629645,17 +1646203,8 @@ 7:u00:δ}, 8:uI2::,?,, 8:uI1::,?,, -7:u08:saw, 8:uI0::,?,, -7:u07:saw, -7:u06:saw, -7:u05:saw, -7:u04:saw, -7:u03:saw, -7:u02:saw, -7:u01:saw, 9:uI2:;:::), -7:u00:saw, 9:uI1:;:::), 9:uI0:;:::), 6:u08:?L, @@ -1630058,7 +1646607,6 @@ 14:u12:kitazawa,*, 12:u13:shinsaku, 10:u14:kanbe,, -7:u22:KIT, 8:u23:KITA, 9:u00:Kohji, 12:u01:KISHIO,*, @@ -1631914,7 +1648462,6 @@ 18:u04:(glucagon-like, 11:u05:L-cells, 9:u12:glp-1, -7:u22:GLP, 8:u23:GLP-, 13:u00:**Protein, 9:u03:GLP-1, @@ -1641599,7 +1658146,6 @@ 6:u05:ï, 6:u08:Ui, 7:u01:£2, -6:u08:Ji, 7:u12:5% frequency f fr fre freq BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 0 ). 2 4 0 0 0 0 1 +Actionability of actionability A Ac Act Acti BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 1 no 0 10 0 0 0 0 1 +We next we W We We We BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 1 no 0 10 0 0 0 0 1 +alterations through alterations a al alt alte BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 1 - 1 8 0 0 0 0 1 +ogy Knowledge ogy o og ogy ogy BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 1 (). 3 9 0 0 0 0 1 +samples and samples s sa sam samp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 1 . 1 9 0 0 0 0 1 +Data from data D Da Dat Data BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 1 (,,) 4 9 0 0 0 0 1 +possessed at possessed p po pos poss BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 1 no 0 9 0 0 0 0 1 +in a in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 1 (.), 4 9 0 0 0 0 1 +samples (5,805 samples s sa sam samp BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 1 (,,) 4 9 0 0 0 0 1 +biologically relevant biologically b bi bio biol BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 (.- 3 9 0 0 0 0 1 +tary Tables tary t ta tar tary BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 ).,(,,) 7 9 0 0 0 0 1 +of the of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 no 0 9 0 0 0 0 1 +defined by defined d de def defi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 . 1 8 0 0 0 0 1 +(n = (n ( (n (n (n BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 (,),,,,, 8 9 0 0 0 0 1 +clonal and clonal c cl clo clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 . 1 4 0 0 0 0 1 +The most the T Th The The BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 2 no 0 8 0 0 0 0 1 +the 35 the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 ,(- 3 9 0 0 0 0 1 +mentary Fig. mentary m me men ment BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 .)., 4 9 0 0 0 0 1 +subunit of subunit s su sub subu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 -(). 4 9 0 0 0 0 1 +missense mutations missense m mi mis miss BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 - 1 9 0 0 0 0 1 +cers and cers c ce cer cers BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 no 0 10 0 0 0 0 1 +for the for f fo for for BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 . 1 10 0 0 0 0 1 +in a in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 2 () 2 9 0 0 0 0 1 +(47%) and (47%) ( (4 (47 (47% BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 2 () 2 10 0 0 0 0 1 +an allosteric an a an an an BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 2 . 1 10 0 0 0 0 1 +with pancreatic with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 , 1 8 0 0 0 0 1 +with actionable with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 (-). 4 9 0 0 0 0 1 +mutation was mutation m mu mut muta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 2 - 1 9 0 0 0 0 1 +geted by geted g ge get gete BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 2 - 1 9 0 0 0 0 1 +C>A C>A c>a C C> C>A C>A BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +C>G C>G c>g C C> C>G C>G BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +C>T C>T c>t C C> C>T C>T BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +T>A T>A t>a T T> T>A T>A BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +T>C T>C t>c T T> T>C T>C BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +T>G T>G t>g T T> T>G T>G BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 4 no 0 10 0 0 0 0 1 +a a a a a a a BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 2 5 no 0 10 1 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +ANK1 ANK1 ank1 A AN ANK ANK1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +APC APC apc A AP APC APC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 5 0 0 0 0 1 +ATRX ATRX atrx A AT ATR ATRX BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +BAP1 BAP1 bap1 B BA BAP BAP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +CDKN2A CDKN2A cdkn2a C CD CDK CDKN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +CIC CIC cic C CI CIC CIC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +CSMD3 CSMD3 csmd3 C CS CSM CSMD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +CTNNB1 CTNNB1 ctnnb1 C CT CTN CTNN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +ERBB2 ERBB2 erbb2 E ER ERB ERBB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +FAT1 FAT1 fat1 F FA FAT FAT1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +FGFR3 FGFR3 fgfr3 F FG FGF FGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +FUBP1 FUBP1 fubp1 F FU FUB FUBP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +KIT KIT kit K KI KIT KIT BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 1 1 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +KMT2C KMT2C kmt2c K KM KMT KMT2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +KMT2D KMT2D kmt2d K KM KMT KMT2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +LRP1B LRP1B lrp1b L LR LRP LRP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +MGAM MGAM mgam M MG MGA MGAM BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +MTOR MTOR mtor M MT MTO MTOR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +NF2 NF2 nf2 N NF NF2 NF2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +NOTCH1 NOTCH1 notch1 N NO NOT NOTC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +NRAS NRAS nras N NR NRA NRAS BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +PDGFRA PDGFRA pdgfra P PD PDG PDGF BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +PKHD1L1 PKHD1L1 pkhd1l1 P PK PKH PKHD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +SYNE1 SYNE1 syne1 S SY SYN SYNE BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +TRAF7 TRAF7 traf7 T TR TRA TRAF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +TSC1 TSC1 tsc1 T TS TSC TSC1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +VHL VHL vhl V VH VHL VHL BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +75 75 75 7 75 75 75 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 5 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 6 no 0 6 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 6 no 0 10 0 0 0 0 1 +20 20 20 2 20 20 20 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 6 no 0 10 0 0 0 0 1 +30 30 30 3 30 30 30 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 6 no 0 10 0 0 0 0 1 +Number of number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 6 no 0 4 0 0 0 0 1 +Maximum mutation maximum M Ma Max Maxi BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 6 () 2 10 0 0 0 0 1 +b b b b b b b BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 2 6 no 0 10 1 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 -- 2 10 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 -- 2 10 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 6 - 1 10 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +75 75 75 7 75 75 75 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 7 no 0 6 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +75 75 75 7 75 75 75 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Percentage of percentage P Pe Per Perc BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 - 1 10 0 0 0 0 1 +Tumor group tumor T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Activating Activating activating A Ac Act Acti BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Ambiguous Ambiguous ambiguous A Am Amb Ambi BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Loss of loss L Lo Los Loss BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Predicted Predicted predicted P Pr Pre Pred BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 no 0 8 0 0 0 0 1 +driver role driver d dr dri driv BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 7 no 0 10 0 0 0 0 1 +Fig. 4 fig. F Fi Fig Fig. BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 7 . 1 9 0 0 0 0 1 +across tumor across a ac acr acro BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 7 ., 2 9 0 0 0 0 1 +cancer: y cancer: c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 7 :,;, 4 10 0 0 0 0 1 +tumor types tumor t tu tum tumo BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 7 . 1 9 0 0 0 0 1 +drivers in drivers d dr dri driv BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 8 no 0 9 0 0 0 0 1 +tumor type tumor t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 8 ., 2 9 0 0 0 0 1 +with each with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 8 :,;,- 5 10 0 0 0 0 1 +driver genes. driver d dr dri driv BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 8 . 1 1 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 8 1 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 8 1 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 5 1 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 4 1 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 -- 2 6 1 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 8 1 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 10 1 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 5 1 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 9 1 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 9 1 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 7 1 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 4 1 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 5 1 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 5 1 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 8 1 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 10 1 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 4 1 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 6 1 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 4 1 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 -- 2 7 1 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 9 1 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 2 8 - 1 4 1 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +NRAS NRAS nras N NR NRA NRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +APC APC apc A AP APC APC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +ERBB3 ERBB3 erbb3 E ER ERB ERBB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MTOR MTOR mtor M MT MTO MTOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +DUSP16 DUSP16 dusp16 D DU DUS DUSP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +ACVR2A ACVR2A acvr2a A AC ACV ACVR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +RNF43 RNF43 rnf43 R RN RNF RNF4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +ATRX ATRX atrx A AT ATR ATRX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CDKN2A CDKN2A cdkn2a C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +KMT2C KMT2C kmt2c K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +FOXA1 FOXA1 foxa1 F FO FOX FOXA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MAP3K1 MAP3K1 map3k1 M MA MAP MAP3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +MAP2K4 MAP2K4 map2k4 M MA MAP MAP2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +RUNX1 RUNX1 runx1 R RU RUN RUNX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +NCOR1 NCOR1 ncor1 N NC NCO NCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ZFPM1 ZFPM1 zfpm1 Z ZF ZFP ZFPM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +SPEN SPEN spen S SP SPE SPEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +GATA3 GATA3 gata3 G GA GAT GATA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +SF3B1 SF3B1 sf3b1 S SF SF3 SF3B BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ERBB2 ERBB2 erbb2 E ER ERB ERBB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CDH1 CDH1 cdh1 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +TBX3 TBX3 tbx3 T TB TBX TBX3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CBFB CBFB cbfb C CB CBF CBFB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +KMT2D KMT2D kmt2d K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +TSC1 TSC1 tsc1 T TS TSC TSC1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +KDM6A KDM6A kdm6a K KD KDM KDM6 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CREBBP CREBBP crebbp C CR CRE CREB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +STAG2 STAG2 stag2 S ST STA STAG BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ELF3 ELF3 elf3 E EL ELF ELF3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +EP300 EP300 ep300 E EP EP3 EP30 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +KMT2A KMT2A kmt2a K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +RHOA RHOA rhoa R RH RHO RHOA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CTNNB1 CTNNB1 ctnnb1 C CT CTN CTNN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +PPP2R1A PPP2R1A ppp2r1a P PP PPP PPP2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +FGFR2 FGFR2 fgfr2 F FG FGF FGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CHD4 CHD4 chd4 C CH CHD CHD4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +BCOR BCOR bcor B BC BCO BCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +SPOP SPOP spop S SP SPO SPOP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CIC CIC cic C CI CIC CIC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +FAT1 FAT1 fat1 F FA FAT FAT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +NOTCH1 NOTCH1 notch1 N NO NOT NOTC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +NFE2L2 NFE2L2 nfe2l2 N NF NFE NFE2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +SETD2 SETD2 setd2 S SE SET SETD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +BAP1 BAP1 bap1 B BA BAP BAP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +VHL VHL vhl V VH VHL VHL BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +PBRM1 PBRM1 pbrm1 P PB PBR PBRM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MGA MGA mga M MG MGA MGA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +RBM10 RBM10 rbm10 R RB RBM RBM1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +STK11 STK11 stk11 S ST STK STK1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +KEAP1 KEAP1 keap1 K KE KEA KEAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ARID2 ARID2 arid2 A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +RAC1 RAC1 rac1 R RA RAC RAC1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +IDH2 IDH2 idh2 I ID IDH IDH2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CASP8 CASP8 casp8 C CA CAS CASP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MAX MAX max M MA MAX MAX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +ARHGAP35 ARHGAP35 arhgap35 A AR ARH ARHG BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 10 1 0 0 0 1 +CTCF CTCF ctcf C CT CTC CTCF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +ESR1 ESR1 esr1 E ES ESR ESR1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +NF2 NF2 nf2 N NF NF2 NF2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +KLF4 KLF4 klf4 K KL KLF KLF4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +TRAF7 TRAF7 traf7 T TR TRA TRAF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ARID1B ARID1B arid1b A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +SIN3A SIN3A sin3a S SI SIN SIN3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +GNAS GNAS gnas G GN GNA GNAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +HLA-A HLA-A hla-a H HL HLA HLA- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 - 1 6 1 0 0 0 1 +MAP2K1 MAP2K1 map2k1 M MA MAP MAP2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +PSPC1 PSPC1 pspc1 P PS PSP PSPC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ZFHX3 ZFHX3 zfhx3 Z ZF ZFH ZFHX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MED12 MED12 med12 M ME MED MED1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ZMYM3 ZMYM3 zmym3 Z ZM ZMY ZMYM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CDK12 CDK12 cdk12 C CD CDK CDK1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +HRAS HRAS hras H HR HRA HRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CDKN1A CDKN1A cdkn1a C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +ASXL1 ASXL1 asxl1 A AS ASX ASXL BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MUC4 MUC4 muc4 M MU MUC MUC4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +ZNF98 ZNF98 znf98 Z ZN ZNF ZNF9 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ZSCAN5A ZSCAN5A zscan5a Z ZS ZSC ZSCA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +MUC20 MUC20 muc20 M MU MUC MUC2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CDKN1B CDKN1B cdkn1b C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +FOXO3 FOXO3 foxo3 F FO FOX FOXO BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +USP17L22 USP17L22 usp17l22 U US USP USP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 10 1 0 0 0 1 +SEC22B SEC22B sec22b S SE SEC SEC2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +SMARCA4 SMARCA4 smarca4 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +PRPF8 PRPF8 prpf8 P PR PRP PRPF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +TET2 TET2 tet2 T TE TET TET2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +CUL3 CUL3 cul3 C CU CUL CUL3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +SMARCB1 SMARCB1 smarcb1 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +ROCK1 ROCK1 rock1 R RO ROC ROCK BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +PRAMEF15 PRAMEF15 pramef15 P PR PRA PRAM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 10 1 0 0 0 1 +AGAP6 AGAP6 agap6 A AG AGA AGAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +BRCA2 BRCA2 brca2 B BR BRC BRCA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CSMD3 CSMD3 csmd3 C CS CSM CSMD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +HLA-B HLA-B hla-b H HL HLA HLA- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 - 1 6 1 0 0 0 1 +MYH9 MYH9 myh9 M MY MYH MYH9 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +SETD1B SETD1B setd1b S SE SET SETD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +PDGFRA PDGFRA pdgfra P PD PDG PDGF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +LRP1B LRP1B lrp1b L LR LRP LRP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +FAT3 FAT3 fat3 F FA FAT FAT3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +NCOR2 NCOR2 ncor2 N NC NCO NCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CDH10 CDH10 cdh10 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +NBEA NBEA nbea N NB NBE NBEA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +PDGFRB PDGFRB pdgfrb P PD PDG PDGF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +EPHA3 EPHA3 epha3 E EP EPH EPHA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +NSD1 NSD1 nsd1 N NS NSD NSD1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +ATR ATR atr A AT ATR ATR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +BIRC6 BIRC6 birc6 B BI BIR BIRC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +ROBO2 ROBO2 robo2 R RO ROB ROBO BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +PTPRB PTPRB ptprb P PT PTP PTPR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MUC16 MUC16 muc16 M MU MUC MUC1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +PDE4DIP PDE4DIP pde4dip P PD PDE PDE4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +FAT4 FAT4 fat4 F FA FAT FAT4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 5 1 0 0 0 1 +TRRAP TRRAP trrap T TR TRR TRRA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +SLC35G5 SLC35G5 slc35g5 S SL SLC SLC3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +DCTN1 DCTN1 dctn1 D DC DCT DCTN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +AKAP9 AKAP9 akap9 A AK AKA AKAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +CNTNAP2 CNTNAP2 cntnap2 C CN CNT CNTN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 8 1 0 0 0 1 +N4BP2 N4BP2 n4bp2 N N4 N4B N4BP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +DDX3X DDX3X ddx3x D DD DDX DDX3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 6 1 0 0 0 1 +MET MET met M ME MET MET BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 1 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +PTPN11 PTPN11 ptpn11 P PT PTP PTPN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 9 no 0 7 1 0 0 0 1 +KIT KIT kit K KI KIT KIT BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 1 1 0 0 0 0 0 2 9 no 0 4 1 0 0 0 1 +-log10q -log10q -log10q - -l -lo -log BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 11 - 1 10 1 1 0 0 1 +>6 >6 >6 > >6 >6 >6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 2 11 no 0 10 1 1 0 0 1 +4 4 4 4 4 4 4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 11 no 0 6 1 1 0 0 1 +2 2 2 2 2 2 2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 11 no 0 6 1 1 0 0 1 +0 0 0 0 0 0 0 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 2 11 no 0 6 1 1 0 0 1 +Fig. 3 fig. F Fi Fig Fig. BLOCKSTART PAGEEND NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 11 ... 3 10 1 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 0 - 1 10 0 1 1 0 0 +1872 1872 1872 1 18 187 1872 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 2 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 2 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 2 0 ://././--- 10 10 0 1 0 0 1 +or sotorasib or o or or or BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 0 ,. 2 10 0 0 0 0 1 +in patients in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 2 0 , 1 8 0 0 0 0 1 +thought to thought t th tho thou BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 0 . 1 9 0 0 0 0 1 +PTEN mutations pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 2 0 (), 3 8 0 0 0 0 1 +carcinoma (13%), carcinoma c ca car carc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 2 0 (),(),- 7 9 0 0 0 0 1 +toma multiforme toma t to tom toma BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 2 0 ()() 4 9 0 0 0 0 1 +would result would w wo wou woul BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 2 0 . 1 9 0 0 0 0 1 +Landscape of landscape L La Lan Land BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 1 no 0 10 0 0 0 0 1 +In addition in I In In In BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 3 1 , 1 9 0 0 0 0 1 +molecular alterations molecular m mo mol mole BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 -- 2 8 0 0 0 0 1 +ers of ers e er ers ers BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 1 . 1 8 0 0 0 0 1 +dMMR/POLE mutations dmmr/pole d dM dMM dMMR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 1 / 1 8 0 0 0 0 1 +(HRD), which (hrd), ( (H (HR (HRD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 1 (),- 4 8 0 0 0 0 1 +notherapy and notherapy n no not noth BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 1 .() 3 9 0 0 0 0 1 +exhibited a exhibited e ex exh exhi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 ,- 2 8 0 0 0 0 1 +tion for tion t ti tio tion BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 1 no 0 9 0 0 0 0 1 +chemotherapy 24-28 chemotherapy c ch che chem BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 1 -.,- 4 9 0 0 0 0 1 +logical basis logical l lo log logi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 ,, 2 10 0 0 0 0 1 +based on based b ba bas base BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 ,,, 3 9 0 0 0 0 1 +through germline through t th thr thro BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 . 1 9 0 0 0 0 1 +caused by caused c ca cau caus BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 , 1 9 0 0 0 0 1 +these data these t th the thes BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 , 1 9 0 0 0 0 1 +a strong a a a a a BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 3 1 no 0 9 0 0 0 0 1 +eligible for eligible e el eli elig BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 -. 2 9 0 0 0 0 1 +A total a A A A A BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 3 1 , 1 8 0 0 0 0 1 +burden (more burden b bu bur burd BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 1 (,) 3 8 0 0 0 0 1 +had evidence had h ha had had BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 . 1 8 0 0 0 0 1 +that 1,312 that t th tha that BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 1 ,,. 3 9 0 0 0 0 1 +explore the explore e ex exp expl BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 9 0 0 0 0 1 +same patient, same s sa sam same BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ,- 2 9 0 0 0 0 1 +tions with tions t ti tio tion BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 4 ,- 2 9 0 0 0 0 1 +tions. In tions. t ti tio tion BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 4 .,, 3 9 0 0 0 0 1 +in 6,151 in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 4 ,(,,), 6 9 0 0 0 0 1 +13% (1,361 13% 1 13 13% 13% BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 4 (,,)(,,) 8 10 0 0 0 0 1 +three clinically three t th thr thre BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 6 0 0 0 0 1 +Expanding the expanding E Ex Exp Expa BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 5 no 0 10 0 0 0 0 1 +An opportunity an A An An An BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 3 5 no 0 8 0 0 0 0 1 +genomes is genomes g ge gen geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 5 - 1 9 0 0 0 0 1 +gies. Of gies. g gi gie gies BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 5 ., 2 9 0 0 0 0 1 +261 (79%) 261 2 26 261 261 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 5 () 2 9 0 0 0 0 1 +COSMIC or cosmic C CO COS COSM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 1 0 0 0 0 0 3 5 . 1 8 0 0 0 0 1 +candidates for candidates c ca can cand BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 ,- 2 8 0 0 0 0 1 +ity and ity i it ity ity BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 5 / 1 9 0 0 0 0 1 +CRISPR DepMap crispr C CR CRI CRIS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 5 -- 2 8 0 0 0 0 1 +base, canSAR, base, b ba bas base BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 ,,,.() 6 10 0 0 0 0 1 +are predicted are a ar are are BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 () 2 8 0 0 0 0 1 +have a have h ha hav have BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 () 2 9 0 0 0 0 1 +three-dimensional (3D) three-dimensional t th thr thre BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 -()(). 6 7 0 0 0 0 1 +Motivated by motivated M Mo Mot Moti BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 5 - 1 8 0 0 0 0 1 +act with act a ac act act BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 no 0 9 0 0 0 0 1 +strategies, we strategies, s st str stra BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 , 1 9 0 0 0 0 1 +cancer 34,35 cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 ,., 3 9 0 0 0 0 1 +annotate networks annotate a an ann anno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 . 1 9 0 0 0 0 1 +Specifically, we specifically, S Sp Spe Spec BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 5 , 1 9 0 0 0 0 1 +tumor group tumor t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 - 1 8 0 0 0 0 1 +interactions to interactions i in int inte BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 5 -, 2 9 0 0 0 0 1 +Breast_DuctalCA Breast_DuctalCA breast_ductalca B Br Bre Brea BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 9 0 1 0 0 1 +Breast_LobularCA Breast_LobularCA breast_lobularca B Br Bre Brea BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +P value p P P P P BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 1 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +P value p P P P P BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +Expected mutation expected E Ex Exp Expe BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +rate rate rate r ra rat rate BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 8 no 0 2 0 0 0 0 1 +Expected mutation expected E Ex Exp Expe BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +rate rate rate r ra rat rate BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 8 no 0 2 0 0 0 0 1 +10 -4 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 1 0 0 1 +10 -10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 1 0 0 1 +10 0 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +10 -1 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 1 0 0 1 +10 -2 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 -3 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 -4 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 -10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 0 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +10 -1 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 -2 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +10 -3 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 8 - 1 10 0 0 0 0 1 +CNS_Astro CNS_Astro cns_astro C CN CNS CNS_ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +CNS_GBM_IDHmut CNS_GBM_IDHmut cns_gbm_idhmut C CN CNS CNS_ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +CNS_GBM_IDHwt CNS_GBM_IDHwt cns_gbm_idhwt C CN CNS CNS_ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +CNS_Menin CNS_Menin cns_menin C CN CNS CNS_ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +CNS_Oligo CNS_Oligo cns_oligo C CN CNS CNS_ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 1 0 0 1 +Kidney_CCRCC Kidney_CCRCC kidney_ccrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +Kidney_ChRCC Kidney_ChRCC kidney_chrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 8 no 0 10 0 0 0 0 1 +Breast Breast breast B Br Bre Brea BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Kidney Kidney kidney K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +CNS Connective cns C CN CNS CNS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Lung Lung lung L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Connective_Chondro Connective_Chondro connective_chondro C Co Con Conn BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Connective_Leiomyo Connective_Leiomyo connective_leiomyo C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Connective_Liposarc Connective_Liposarc connective_liposarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Connective_Myxofibro Connective_Myxofibro connective_myxofibro C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 1 0 0 1 +Connective_Osteosarc Connective_Osteosarc connective_osteosarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Connective_SCS Connective_SCS connective_scs C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Connective_SS Connective_SS connective_ss C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Lung_AdenoCA Lung_AdenoCA lung_adenoca L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Lung_LargeCell Lung_LargeCell lung_largecell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Lung_SCC Lung_SCC lung_scc L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Lung_SmallCell Lung_SmallCell lung_smallcell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +Kidney_PRCC Kidney_PRCC kidney_prcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +BRCA2 BRCA2 brca2 B BR BRC BRCA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +CBFB CBFB cbfb C CB CBF CBFB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +CDH1 CDH1 cdh1 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +CDKN1B CDKN1B cdkn1b C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +CTCF CTCF ctcf C CT CTC CTCF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +ERBB2 ERBB2 erbb2 E ER ERB ERBB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +GATA3 GATA3 gata3 G GA GAT GATA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +FOXA1 FOXA1 foxa1 F FO FOX FOXA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +KMT2C KMT2C kmt2c K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +KMT2D KMT2D kmt2d K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +SPEN SPEN spen S SP SPE SPEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +SF3B1 SF3B1 sf3b1 S SF SF3 SF3B BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +RUNX1 RUNX1 runx1 R RU RUN RUNX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +NCOR1 NCOR1 ncor1 N NC NCO NCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +MAP3K1 MAP3K1 map3k1 M MA MAP MAP3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +MAP2K4 MAP2K4 map2k4 M MA MAP MAP2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 10 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +CIC CIC cic C CI CIC CIC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +ATRX ATRX atrx A AT ATR ATRX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +ZFPM1 ZFPM1 zfpm1 Z ZF ZFP ZFPM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 8 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +TBX3 TBX3 tbx3 T TB TBX TBX3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +ATRX ATRX atrx A AT ATR ATRX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 5 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +TERT TERT tert T TE TER TERT BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 9 no 0 7 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +BAP1 BAP1 bap1 B BA BAP BAP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +KDM5C KDM5C kdm5c K KD KDM KDM5 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +MTOR MTOR mtor M MT MTO MTOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +PBRM1 PBRM1 pbrm1 P PB PBR PBRM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +SETD2 SETD2 setd2 S SE SET SETD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +TET2 TET2 tet2 T TE TET TET2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +VHL VHL vhl V VH VHL VHL BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 5 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +ARID2 ARID2 arid2 A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 5 0 0 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +CDH10 CDH10 cdh10 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +CDKN2A CDKN2A cdkn2a C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +CMTR2 CMTR2 cmtr2 C CM CMT CMTR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +FAT1 FAT1 fat1 F FA FAT FAT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +KEAP1 KEAP1 keap1 K KE KEA KEAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +KMT2D KMT2D kmt2d K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +LRP1B LRP1B lrp1b L LR LRP LRP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +MGA MGA mga M MG MGA MGA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 6 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +NFE2L2 NFE2L2 nfe2l2 N NF NFE NFE2 BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +NOTCH1 NOTCH1 notch1 N NO NOT NOTC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 8 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 3 10 no 0 6 0 0 0 0 1 +PKHD1L1 PKHD1L1 pkhd1l1 P PK PKH PKHD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +RASA1 RASA1 rasa1 R RA RAS RASA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +RBM10 RBM10 rbm10 R RB RBM RBM1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +SETD2 SETD2 setd2 S SE SET SETD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +SMARCA4 SMARCA4 smarca4 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 10 0 0 0 0 1 +STK11 STK11 stk11 S ST STK STK1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 3 10 no 0 7 0 0 0 0 1 +Fig. 5 fig. F Fi Fig Fig. BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 10 . 1 9 0 0 0 0 1 +histologies. Expected histologies. h hi his hist BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 10 . 1 10 0 0 0 0 1 +in the in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 10 (,,(),,, 8 9 0 0 0 0 1 +1,110 lung 1,110 1 1, 1,1 1,11 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 3 10 ,) 2 9 0 0 0 0 1 +the number the t th the the BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 11 no 0 10 0 0 0 0 1 +histology. Binomial histology. h hi his hist BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 11 .. 2 9 0 0 0 0 1 +false discovery false f fa fal fals BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 11 .. 2 3 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 - 1 10 0 1 1 0 0 +1873 1873 1873 1 18 187 1873 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 3 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 3 0 ://././--- 10 10 0 1 0 0 1 +each protein each e ea eac each BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 no 0 9 0 0 0 0 1 +'druggability', that 'druggability', ' 'd 'dr 'dru BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 '', 3 9 0 0 0 0 1 +small molecule small s sm sma smal BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 0 .- 2 9 0 0 0 0 1 +network with network n ne net netw BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 0 , 1 10 0 0 0 0 1 +proteins across proteins p pr pro prot BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 ().- 4 9 0 0 0 0 1 +ber of ber b be ber ber BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 , 1 9 0 0 0 0 1 +colorectal cancer colorectal c co col colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 (; 2 9 0 0 0 0 1 +Data Fig. data D Da Dat Data BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 .)- 3 9 0 0 0 0 1 +work (n work w wo wor work BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 (). 3 9 0 0 0 0 1 +size and size s si siz size BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 (' 2 9 0 0 0 0 1 +r = r r r r r BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 3 0 .,.-). 6 3 0 0 0 0 1 +Of these of O Of Of Of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 ,() 3 9 0 0 0 0 1 +network analysis, network n ne net netw BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 0 ,() 3 9 0 0 0 0 1 +as candidate as a as as as BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 ( 1 9 0 0 0 0 1 +cancer-network proteins). cancer-network c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 -)., 4 8 0 0 0 0 1 +and CDK1, and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 ,,,. 4 9 0 0 0 0 1 +We observed we W We We We BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 ()- 3 9 0 0 0 0 1 +targetable by targetable t ta tar targ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 , 1 9 0 0 0 0 1 +notable examples notable n no not nota BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 ., 2 9 0 0 0 0 1 +34 are 34 3 34 34 34 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 0 ,, 2 9 0 0 0 0 1 +48 are 48 4 48 48 48 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 3 0 - 1 9 0 0 0 0 1 +probe available probe p pr pro prob BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 (). 3 8 0 0 0 0 1 +provide potential provide p pr pro prov BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 0 . 1 9 0 0 0 0 1 +For example, for F Fo For For BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 0 ,,()/ 5 8 0 0 0 0 1 +pre-RNA splicing pre-rna p pr pre pre- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 -, 2 8 0 0 0 0 1 +network 36 network n ne net netw BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 0 . 1 9 0 0 0 0 1 +lineage specificity lineage l li lin line BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 0 . 1 7 0 0 0 0 1 +Discussion Discussion discussion D Di Dis Disc BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 10 0 1 0 0 1 +Clinical and clinical C Cl Cli Clin BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 9 0 1 0 0 1 +that genomic that t th tha that BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 10 0 1 0 0 1 +management of management m ma man mana BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 4 . 1 9 0 0 0 0 1 +to precision to t to to to BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 , 1 8 0 0 0 0 1 +recruited to recruited r re rec recr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 4 0 0 0 0 1 +Across all across A Ac Acr Acro BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 3 4 ,, 2 8 0 0 0 0 1 +which are which w wh whi whic BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 9 0 0 0 0 1 +limited by limited l li lim limi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +consideration of consideration c co con cons BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 -,- 3 8 0 0 0 0 1 +ylation events. ylation y yl yla ylat BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 4 ., 2 9 0 0 0 0 1 +comprehensive efforts comprehensive c co com comp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +serves as serves s se ser serv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 9 0 0 0 0 1 +in driver in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 4 no 0 9 0 0 0 0 1 +imply both imply i im imp impl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ., 2 8 0 0 0 0 1 +however, many however, h ho how howe BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ,- 2 8 0 0 0 0 1 +ent tumor ent e en ent ent BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 4 ., 2 9 0 0 0 0 1 +that currently that t th tha that BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ' 1 9 0 0 0 0 1 +mutation, either mutation, m mu mut muta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ,- 2 9 0 0 0 0 1 +ments or ments m me men ment BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 3 4 . 1 9 0 0 0 0 1 +if based if i if if if BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +use 38 use u us use use BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 9 0 0 0 0 1 +a proxy a a a a a BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 3 4 , 1 9 0 0 0 0 1 +approvals by approvals a ap app appr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 () 2 8 0 0 0 0 1 +that new that t th tha that BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +progression 39 progression p pr pro prog BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 ., 2 9 0 0 0 0 1 +we applied we w we we we BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +pharmacologically annotate pharmacologically p ph pha phar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +identified by identified i id ide iden BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 8 0 0 0 0 1 +measures of measures m me mea meas BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 4 , 1 9 0 0 0 0 1 +additional potential additional a ad add addi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 . 1 10 0 0 0 0 1 +endeavors will endeavors e en end ende BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 - 1 8 0 0 0 0 1 +reporter assays reporter r re rep repo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 3 4 no 0 8 0 0 0 0 1 +driver mutations driver d dr dri driv BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 3 4 . 1 5 0 0 0 0 1 +a a a a a a a BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 4 8 no 0 10 0 1 0 0 1 +b b b b b b b BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 4 8 no 0 10 0 1 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 8 no 0 6 0 0 0 0 1 +BCL9L BCL9L bcl9l B BC BCL BCL9 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +CREBBP CREBBP crebbp C CR CRE CREB BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +CTNNB1 CTNNB1 ctnnb1 C CT CTN CTNN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +INPPL1 INPPL1 inppl1 I IN INP INPP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +KMT2C KMT2C kmt2c K KM KMT KMT2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +MGA MGA mga M MG MGA MGA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +PSPC1 PSPC1 pspc1 P PS PSP PSPC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +RNF43 RNF43 rnf43 R RN RNF RNF4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +ZFHX3 ZFHX3 zfhx3 Z ZF ZFH ZFHX BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +ZFP36L2 ZFP36L2 zfp36l2 Z ZF ZFP ZFP3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +75 75 75 7 75 75 75 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 1 0 0 1 +100 100 100 1 10 100 100 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 8 no 0 5 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 7 0 0 0 0 1 +100 100 100 1 10 100 100 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +150 150 150 1 15 150 150 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +Total number total T To Tot Tota BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 8 no 0 9 0 0 0 0 1 +cancer driver cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 8 no 0 3 0 0 0 0 1 +Proportion of proportion P Pr Pro Prop BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 8 no 0 10 0 0 0 0 1 +gene that gene g ge gen gene BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 4 8 () 2 5 0 0 0 0 1 +APC APC apc A AP APC APC BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 8 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +APC APC apc A AP APC APC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 5 0 1 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +VHL VHL vhl V VH VHL VHL BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 9 no 0 8 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +75 75 75 7 75 75 75 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +100 100 100 1 10 100 100 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 9 no 0 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 9 no 0 3 0 0 0 0 1 +1,000 1,000 1,000 1 1, 1,0 1,00 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 9 , 1 10 0 0 0 0 1 +2,000 2,000 2,000 2 2, 2,0 2,00 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 9 , 1 10 0 0 0 0 1 +3,000 3,000 3,000 3 3, 3,0 3,00 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 9 , 1 10 0 0 0 0 1 +Total number total T To Tot Tota BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 9 no 0 9 0 0 0 0 1 +cancer driver cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 9 no 0 3 0 0 0 0 1 +Proportion of proportion P Pr Pro Prop BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +gene that gene g ge gen gene BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 4 9 () 2 4 0 0 0 0 1 +Fig. 6 fig. F Fi Fig Fig. BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 10 . 1 9 0 0 0 0 1 +cancer driver cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 ., 2 9 0 0 0 0 1 +cancer driver cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 :, 2 9 0 0 0 0 1 +oncogenic mutations oncogenic o on onc onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 10 ;, 2 9 0 0 0 0 1 +oncogenic mutations. oncogenic o on onc onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 10 . 1 8 0 0 0 0 1 +that occurred that t th tha that BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 (), 3 9 0 0 0 0 1 +clonal mutations clonal c cl clo clon BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 10 (), 3 10 0 0 0 0 1 +occurred when occurred o oc occ occu BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 11 . 1 9 0 0 0 0 1 +clonal oncogenic clonal c cl clo clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 11 no 0 8 0 0 0 0 1 +all oncogenic all a al all all BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 11 ., 2 9 0 0 0 0 1 +in candidate in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 4 11 :, 2 10 0 0 0 0 1 +subclonal oncogenic subclonal s su sub subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 11 ;, 2 9 0 0 0 0 1 +of subclonal of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 11 . 1 9 0 0 0 0 1 +oncogenic mutations oncogenic o on onc onco BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 11 . 1 8 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 10 0 1 1 0 0 +1874 1874 1874 1 18 187 1874 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 4 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 4 0 ://././--- 10 10 0 1 0 0 1 +The strengths the T Th The The BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 1 0 0 1 +the combination the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 9 0 1 0 0 1 +ing from ing i in ing ing BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 4 0 . 1 9 0 1 0 0 1 +minimize the minimize m mi min mini BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 9 0 1 0 0 1 +ensuring a ensuring e en ens ensu BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ., 2 10 0 1 0 0 1 +however, acknowledge however, h ho how howe BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 1 , 1 9 0 1 0 0 1 +our analysis our o ou our our BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 1 no 0 10 0 1 0 0 1 +Kingdom, patients kingdom, K Ki Kin King BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 1 , 1 9 0 1 0 0 1 +have early-stage have h ha hav have BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 1 -., 3 9 0 1 0 0 1 +ancestry and ancestry a an anc ance BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 1 , 1 9 0 1 0 0 1 +a a a a a a a BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 4 2 no 0 10 0 1 0 0 1 +Supported by supported S Su Sup Supp BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +None None none N No Non None BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +Clinical evidence clinical C Cl Cli Clin BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +of care of o of of of BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 3 no 0 6 0 0 0 0 1 +FDA approved fda F FD FDA FDA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +3 3 3 3 3 3 3 BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +4 4 4 4 4 4 4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +b b b b b b b BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +OncoKB actionability oncokb O On Onc Onco BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +1 1 1 1 1 1 1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 3 no 0 10 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +Standard of standard S St Sta Stan BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +COSMIC actionability cosmic C CO COS COSM BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 ALLCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 10 0 1 0 0 1 +3 3 3 3 3 3 3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +Approved marketed approved A Ap App Appr BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 7 0 0 0 0 1 +demonstrated e demonstrated d de dem demo BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +Phase 2/3 phase P Ph Pha Phas BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 / 1 10 0 0 0 0 1 +primary outcome primary p pr pri prim BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 7 0 0 0 0 1 +Drug in drug D Dr Dru Drug BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +None None none N No Non None BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 4 no 0 10 0 0 0 0 1 +1 1 1 1 1 1 1 BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +Tumor type tumor T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +2,000 2,000 2,000 2 2, 2,0 2,00 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 1 0 0 1 +1,500 1,500 1,500 1 1, 1,5 1,50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 1 0 0 1 +1,000 1,000 1,000 1 1, 1,0 1,00 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 0 0 0 1 +500 500 500 5 50 500 500 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +Number Number number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +2,000 2,000 2,000 2 2, 2,0 2,00 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 0 0 0 1 +1,500 1,500 1,500 1 1, 1,5 1,50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 0 0 0 1 +1,000 1,000 1,000 1 1, 1,0 1,00 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 4 5 , 1 10 0 0 0 0 1 +500 500 500 5 50 500 500 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +Number Number number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 5 no 0 10 0 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 8 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 9 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 10 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 9 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 4 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 9 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 5 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 5 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 5 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 4 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 4 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 5 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 8 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 6 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 8 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 -- 2 7 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 -- 2 6 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 4 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 4 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 8 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 5 - 1 7 0 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 8 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 9 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 10 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 9 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 4 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 9 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 5 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 5 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 5 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 4 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 4 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 5 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 8 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 6 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 8 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 -- 2 7 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 -- 2 6 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 4 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 4 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 8 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 7 - 1 7 0 0 0 0 1 +Tumor type tumor T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 9 no 0 10 0 0 0 0 1 +Fig. 7 fig. F Fi Fig Fig. BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 9 . 1 9 0 0 0 0 1 +gene. a, gene. g ge gen gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 9 ., 2 10 0 0 0 0 1 +according to according a ac acc acco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 9 . 1 9 0 0 0 0 1 +scoring gene scoring s sc sco scor BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 9 -,'' 4 9 0 0 0 0 1 +mutations were mutations m mu mut muta BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 ., 2 10 0 0 0 0 1 +candidate cancer candidate c ca can cand BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 . 1 9 0 0 0 0 1 +annotated by annotated a an ann anno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 -,'' 4 9 0 0 0 0 1 +indicating no indicating i in ind indi BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 10 . 1 7 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 10 0 1 1 0 0 +1875 1875 1875 1 18 187 1875 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 4 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 4 0 ://././--- 10 10 0 1 0 0 1 +which potentially which w wh whi whic BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +worldwide populations worldwide w wo wor worl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ,. 2 3 0 0 0 0 1 +Accepting these accepting A Ac Acc Acce BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 ,, 2 8 0 0 0 0 1 +depending on depending d de dep depe BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ,- 2 8 0 0 0 0 1 +tially eligible tially t ti tia tial BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +driver. Our driver. d dr dri driv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 .,, 3 9 0 0 0 0 1 +may potentially may m ma may may BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 1 0 0 4 0 no 0 9 0 0 0 0 1 +or pathway. or o or or or BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 .- 2 8 0 0 0 0 1 +often its often o of oft ofte BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +genes or genes g ge gen gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 . 1 9 0 0 0 0 1 +FDA-recognized as fda-recognized F FD FDA FDA- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 4 0 - 1 8 0 0 0 0 1 +grouped together grouped g gr gro grou BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ,- 2 9 0 0 0 0 1 +tially erroneously tially t ti tia tial BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 no 0 10 0 0 0 0 1 +responses. To responses. r re res resp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 .- 2 8 0 0 0 0 1 +ing the ing i in ing ing BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 4 0 , 1 9 0 0 0 0 1 +knowledge bases knowledge k kn kno know BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +of clinical of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 / 1 9 0 0 0 0 1 +biomarker of biomarker b bi bio biom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 ., 2 8 0 0 0 0 1 +address such address a ad add addr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 8 0 0 0 0 1 +assign actionability assign a as ass assi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ., 2 9 0 0 0 0 1 +knowledge databases knowledge k kn kno know BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +and are and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 . 1 10 0 0 0 0 1 +While the while W Wh Whi Whil BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +for well-established for f fo for for BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 - 1 9 0 0 0 0 1 +high sensitivity, high h hi hig high BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 4 0 ,- 2 9 0 0 0 0 1 +clinically actionable clinically c cl cli clin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 .- 2 10 0 0 0 0 1 +lished cancer-specific lished l li lis lish BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 -,, 3 8 0 0 0 0 1 +comparable to comparable c co com comp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 --,., 5 9 0 0 0 0 1 +of 100× of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +tumor purity tumor t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 (.-). 5 8 0 0 0 0 1 +A barrier a A A A A BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +may be may m ma may may BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 1 0 0 4 0 '' 2 8 0 0 0 0 1 +fact that fact f fa fac fact BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +the levels the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +oncoprotein. Recent oncoprotein. o on onc onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 ., 2 8 0 0 0 0 1 +new degraders, new n ne new new BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 , 1 8 0 0 0 0 1 +maps seek maps m ma map maps BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ''-., 5 9 0 0 0 0 1 +WGS allows wgs W WG WGS WGS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +individual genetic individual i in ind indi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 , 1 9 0 0 0 0 1 +benefit over benefit b be ben bene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 . 1 9 0 0 0 0 1 +associated with associated a as ass asso BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +clinically relevant clinically c cl cli clin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +PARP inhibition, parp P PA PAR PARP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 4 0 ,,., 4 9 0 0 0 0 1 +evidence that evidence e ev evi evid BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +cancer cells cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ,. 2 10 0 0 0 0 1 +more detailed more m mo mor more BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +of mutational of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +our companion our o ou our our BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 . 1 9 0 0 0 0 1 +signatures may signatures s si sig sign BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +incremental benefit incremental i in inc incr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 . 1 8 0 0 0 0 1 +Moreover, the moreover, M Mo Mor More BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 , 1 9 0 0 0 0 1 +management given management m ma man mana BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 4 0 -- 2 9 0 0 0 0 1 +tance and tance t ta tan tanc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +immunogenic tumor-specific immunogenic i im imm immu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 --. 3 7 0 0 0 0 1 +Despite the despite D De Des Desp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 4 0 -, 2 8 0 0 0 0 1 +adoption outside adoption a ad ado adop BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +limited 37 limited l li lim limi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 . 1 9 0 0 0 0 1 +patients is patients p pa pat pati BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 , 1 9 0 0 0 0 1 +sequencing platforms. sequencing s se seq sequ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 4 0 ., 2 9 0 0 0 0 1 +frozen samples frozen f fr fro froz BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 (/) 3 8 0 0 0 0 1 +analysis of analysis a an ana anal BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ., 2 9 0 0 0 0 1 +the limitations the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +balancing of balancing b ba bal bala BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 ., 2 9 0 0 0 0 1 +coverage of coverage c co cov cove BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 8 0 0 0 0 1 +detection of detection d de det dete BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 4 0 no 0 9 0 0 0 0 1 +drug response, drug d dr dru drug BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 ,- 2 9 0 0 0 0 1 +mal contamination. mal m ma mal mal BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 6 .- 2 8 0 0 0 0 1 +tions in tions t ti tio tion BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 6 no 0 8 0 0 0 0 1 +the use the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 -,-,- 5 8 0 0 0 0 1 +tumor tissue tumor t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 . 1 9 0 0 0 0 1 +that formalin that t th tha that BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 no 0 9 0 0 0 0 1 +reliably call reliably r re rel reli BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 , 1 8 0 0 0 0 1 +correction 41,56,57 correction c co cor corr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 ,,.- 4 9 0 0 0 0 1 +ent limitations ent e en ent ent BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 6 -., 3 9 0 0 0 0 1 +be robustly be b be be be BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 , 1 8 0 0 0 0 1 +implemented algorithms implemented i im imp impl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 ,. 2 10 0 0 0 0 1 +addressed by addressed a ad add addr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 -, 2 8 0 0 0 0 1 +incurs a incurs i in inc incu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 , 1 9 0 0 0 0 1 +use in use u us use use BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 . 1 9 0 0 0 0 1 +costs and costs c co cos cost BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 no 0 8 0 0 0 0 1 +drug response drug d dr dru drug BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 no 0 8 0 0 0 0 1 +of patients of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 .- 2 9 0 0 0 0 1 +cates, the cates, c ca cat cate BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 6 , 1 9 0 0 0 0 1 +enable more enable e en ena enab BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 6 no 0 8 0 0 0 0 1 +predictive of predictive p pr pre pred BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 6 . 1 3 0 0 0 0 1 +Online content online O On Onl Onli BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 7 no 0 10 0 0 0 0 1 +Any methods, any A An Any Any BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 8 ,,- 3 9 0 0 0 0 1 +maries, source maries, m ma mar mari BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 ,,,, 4 8 0 0 0 0 1 +acknowledgements, peer acknowledgements, a ac ack ackn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 ,;- 3 9 0 0 0 0 1 +butions and butions b bu but buti BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 ;- 2 10 0 0 0 0 1 +ability are ability a ab abi abil BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 ://././---. 11 9 0 0 0 0 1 +References References references R Re Ref Refe BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 8 no 0 10 0 0 0 0 1 +1. Topol, 1. 1 1. 1. 1. BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..-. 6 9 0 0 0 0 1 +157, 241-253 157, 1 15 157 157, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 ,-(). 5 2 0 0 0 0 1 +2. Schwartzberg, 2. 2 2. 2. 2. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,.,,..,,.,. 12 8 0 0 0 0 1 +oncology: who, oncology: o on onc onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 :,,,?... 8 8 0 0 0 0 1 +Oncol. Educ. oncol. O On Onc Onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 8 ..,-(). 7 5 0 0 0 0 1 +3. Stratton, 3. 3 3. 3. 3. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..,,..,... 12 9 0 0 0 0 1 +Nature 458, nature N Na Nat Natu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 8 ,-(). 5 3 0 0 0 0 1 +4. Martínez-Jiménez, 4. 4 4. 4. 4. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .-,.. 5 8 0 0 0 0 1 +driver genes. driver d dr dri driv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 5 8 ...,-(). 8 6 0 0 0 0 1 +5. Chakravarty, 5. 5 5. 5. 5. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,.,... 7 9 0 0 0 0 1 +Nat. Rev. nat. N Na Nat Nat. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 8 ...,-(). 8 4 0 0 0 0 1 +6. Cheng, 6. 6 6. 6. 6. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,...- 6 7 0 0 0 0 1 +mutation profiling mutation m mu mut muta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 (-): 4 8 0 0 0 0 1 +hybridization capture-based hybridization h hy hyb hybr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 -- 2 8 0 0 0 0 1 +assay for assay a as ass assa BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 ...., 5 8 0 0 0 0 1 +251-264 (2015). 251-264 2 25 251 251- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 -(). 4 2 0 0 0 0 1 +7. Redig, 7. 7 7. 7. 7. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..,.. 7 10 0 0 0 0 1 +trial design trial t tr tri tria BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 5 8 ...., 5 8 0 0 0 0 1 +975-977 (2015). 975-977 9 97 975 975- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 -(). 4 2 0 0 0 0 1 +8. Hyman, 8. 8 8. 8. 8. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..,,..,. 10 7 0 0 0 0 1 +genome-driven oncology. genome-driven g ge gen geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 -.,-(). 7 6 0 0 0 0 1 +9. Zehir, 9. 9 9. 9. 9. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,.. 4 9 0 0 0 0 1 +from prospective from f fr fro from BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 ,.. 3 8 0 0 0 0 1 +Med. 23, med. M Me Med Med. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 8 .,-(). 6 3 0 0 0 0 1 +10. Cuppen, 10. 1 10 10. 10. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..- 5 7 0 0 0 0 1 +transcriptome sequencing transcriptome t tr tra tran BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 . 1 8 0 0 0 0 1 +Oncol. 6, oncol. O On Onc Onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 8 .,(). 5 3 0 0 0 0 1 +11. Turnbull, 11. 1 11 11. 11. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..: 5 9 0 0 0 0 1 +genome sequencing genome g ge gen geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 8 ....,(). 8 8 0 0 0 0 1 +12. ICGC/TCGA 12. 1 12 12. 12. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 ./-. 4 8 0 0 0 0 1 +Pan-cancer analysis pan-cancer P Pa Pan Pan- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 8 -.,-(). 7 8 0 0 0 0 1 +13. Bailey, 13. 1 13 13. 13. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,... 5 8 0 0 0 0 1 +driver genes driver d dr dri driv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 5 8 .,-(). 6 7 0 0 0 0 1 +14. Wang, 14. 1 14 14. 14. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 8 .,..- 5 8 0 0 0 0 1 +molecular profiling molecular m mo mol mole BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 no 0 8 0 0 0 0 1 +cancer. Nat. cancer. c ca can canc BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 8 ...,-(). 8 5 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 0 - 1 10 0 1 1 0 0 +1876 1876 1876 1 18 187 1876 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 5 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 5 0 ://././--- 10 10 0 1 0 0 1 +15. Gerstung, 15. 1 15 15. 15. BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..,. 6 9 0 0 0 0 1 +Nature 578, nature N Na Nat Natu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 0 ,-(). 5 3 0 0 0 0 1 +16. Gerlinger, 16. 1 16 16. 16. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 9 0 0 0 0 1 +cell renal cell c ce cel cell BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 . 1 8 0 0 0 0 1 +Nat. Genet. nat. N Na Nat Nat. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 0 ..,-(). 7 4 0 0 0 0 1 +17. Gibson, 17. 1 17 17. 17. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,... 5 9 0 0 0 0 1 +endometrial carcinoma endometrial e en end endo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 no 0 7 0 0 0 0 1 +metastasis. Nat. metastasis. m me met meta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 ...,-(). 8 6 0 0 0 0 1 +18. Yates, 18. 1 18 18. 18. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,... 5 9 0 0 0 0 1 +and relapse. and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 .,-(). 6 6 0 0 0 0 1 +19. André, 19. 1 19 19. 19. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..-, 6 8 0 0 0 0 1 +receptor-positive advanced receptor-positive r re rec rece BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 -....., 7 9 0 0 0 0 1 +1929-1940 (2019). 1929-1940 1 19 192 1929 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 5 0 -(). 4 2 0 0 0 0 1 +20. Varkaris, 20. 2 20 20. 20. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..- 5 9 0 0 0 0 1 +on-target resistance on-target o on on- on-t BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 - 1 8 0 0 0 0 1 +secondary PIK3CA secondary s se sec seco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ..,-(). 7 8 0 0 0 0 1 +21. Fell, 21. 2 21 21. 21. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,... 5 9 0 0 0 0 1 +candidate, a candidate, c ca can cand BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ,. 2 9 0 0 0 0 1 +J. Med. j. J J. J. J. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 5 0 ...,-(). 8 5 0 0 0 0 1 +22. Canon, 22. 2 22 22. 22. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..() 6 9 0 0 0 0 1 +anti-tumour immunity. anti-tumour a an ant anti BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 -.,-(). 7 7 0 0 0 0 1 +23. Mateo, 23. 2 23 23. 23. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..---, 8 9 0 0 0 0 1 +phosphoinositide 3 phosphoinositide p ph pho phos BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 -, 2 9 0 0 0 0 1 +advanced solid advanced a ad adv adva BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ...,-(). 8 8 0 0 0 0 1 +24. Chopra, 24. 2 24 24. 24. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 8 0 0 0 0 1 +deficiency and deficiency d de def defi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 no 0 9 0 0 0 0 1 +breast cancer. breast b br bre brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ...,(). 7 6 0 0 0 0 1 +25. Farmer, 25. 2 25 25. 25. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 9 0 0 0 0 1 +cells as cells c ce cel cell BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 .,-(). 6 8 0 0 0 0 1 +26. Fong, 26. 2 26 26. 26. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,...(-) 8 9 0 0 0 0 1 +tumors from tumors t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 .....,- 7 9 0 0 0 0 1 +(2009). (2009). (2009). ( (2 (20 (200 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 5 0 (). 3 1 0 0 0 0 1 +27. Konstantinopoulos, 27. 2 27 27. 27. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,... 5 8 0 0 0 0 1 +BRCAness that brcaness B BR BRC BRCA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 0 no 0 8 0 0 0 0 1 +and with and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 .. 2 9 0 0 0 0 1 +Clin. Oncol. clin. C Cl Cli Clin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 0 ..,-(). 7 4 0 0 0 0 1 +28. Purwar, 28. 2 28 28. 28. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 9 0 0 0 0 1 +and platinum and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 : 1 8 0 0 0 0 1 +meta-analysis of meta-analysis m me met meta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 -. 2 9 0 0 0 0 1 +World J. world W Wo Wor Worl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 5 0 ...,(). 7 5 0 0 0 0 1 +29. Everall, 29. 2 29 29. 29. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 9 0 0 0 0 1 +alteration and alteration a al alt alte BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 no 0 8 0 0 0 0 1 +from 10,983 from f fr fro from BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ,.://. 6 8 0 0 0 0 1 +org/10.1101/2023.06.07.23290970 (2023). org/10.1101/2023.06.07.23290970 o or org org/ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 0 5 0 /./...(). 9 5 0 0 0 0 1 +30. Marabelle, 30. 3 30 30. 30. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 9 0 0 0 0 1 +with outcomes with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 no 0 8 0 0 0 0 1 +with pembrolizumab: with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 : 1 8 0 0 0 0 1 +multicohort, open-label, multicohort, m mu mul mult BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 ,-,-. 5 8 0 0 0 0 1 +Oncol. 21, oncol. O On Onc Onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 5 0 .,-(). 6 4 0 0 0 0 1 +31. Chakravarty, 31. 3 31 31. 31. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..: 5 9 0 0 0 0 1 +base. JCO base. b ba bas base BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 ...://././.. 12 8 0 0 0 0 1 +(2017). (2017). (2017). ( (2 (20 (201 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 5 0 (). 3 1 0 0 0 0 1 +32. Shimada, 32. 3 32 32. 32. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.,,..,,..,.. 14 9 0 0 0 0 1 +shinyDepMap, a shinydepmap, s sh shi shin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 , 1 9 0 0 0 0 1 +functional connections functional f fu fun func BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 5 0 . 1 8 0 0 0 0 1 +10, e57116 10, 1 10 10, 10, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 ,(). 4 2 0 0 0 0 1 +33. Mitsopoulos, 33. 3 33 33. 33. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,..: 5 9 0 0 0 0 1 +research and research r re res rese BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 5 0 .. 2 8 0 0 0 0 1 +49, D1074-D1082 49, 4 49 49, 49, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 ,-(). 5 3 0 0 0 0 1 +34. Filippakopoulos, 34. 3 34 34. 34. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.. 4 8 0 0 0 0 1 +bromodomains. Nature bromodomains. b br bro brom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 .,-(). 6 6 0 0 0 0 1 +35. Zhao, 35. 3 35 35. 35. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 5 0 .,.,,.,,.,.- 12 9 0 0 0 0 1 +inhibitors of inhibitors i in inh inhi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 --( 3 8 0 0 0 0 1 +inhibitors) in inhibitors) i in inh inhi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 5 0 )...., 6 10 0 0 0 0 1 +1038-1052 (2015). 1038-1052 1 10 103 1038 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 5 0 -(). 4 2 0 0 0 0 1 +36. Burns, 36. 3 36 36. 36. BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..,,.,,..,.. 14 9 0 0 0 0 1 +Myb-related CDC5 myb-related M My Myb Myb- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 --. 3 8 0 0 0 0 1 +Proc. Natl proc. P Pr Pro Proc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 ...,-(). 8 6 0 0 0 0 1 +37. Freedman, 37. 3 37 37. 37. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,...- 6 9 0 0 0 0 1 +guide cancer guide g gu gui guid BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 : 1 8 0 0 0 0 1 +survey of survey s su sur surv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ... 3 8 0 0 0 0 1 +https://doi.org/10.1200/PO.18.00169 (2018). https://doi.org/10.1200/po.18.00169 h ht htt http BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 6 6 ://././..(). 12 6 0 0 0 0 1 +38. National 38. 3 38 38. 38. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .(, 3 8 0 0 0 0 1 +February 2023); february F Fe Feb Febr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 1 0 0 6 6 );://...// 10 7 0 0 0 0 1 +national-genomic-test-directories/ national-genomic-test-directories/ national-genomic-test-directories/ n na nat nati BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 6 6 ---/ 4 4 0 0 0 0 1 +39. Michaeli, 39. 3 39 39. 39. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..,.,- 8 9 0 0 0 0 1 +survival and survival s su sur surv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 no 0 8 0 0 0 0 1 +and Drug and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 no 0 8 0 0 0 0 1 +new cancer new n ne new new BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ,-....,- 8 8 0 0 0 0 1 +(2022). (2022). (2022). ( (2 (20 (202 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 6 (). 3 1 0 0 0 0 1 +40. Kim, 40. 4 40 40. 40. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..- 5 9 0 0 0 0 1 +cancer-associated mutations cancer-associated c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 -... 4 8 0 0 0 0 1 +40, 874-884 40, 4 40 40, 40, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 ,-(). 5 2 0 0 0 0 1 +41. Xiao, 41. 4 41 41. 41. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.. 4 9 0 0 0 0 1 +with whole-genome with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 --.. 4 6 0 0 0 0 1 +Biotechnol. 39, biotechnol. B Bi Bio Biot BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,-(). 6 4 0 0 0 0 1 +42. Ansari-Pour, 42. 4 42 42. 42. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .-,..- 6 9 0 0 0 0 1 +with breast with w wi wit with BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 - 1 8 0 0 0 0 1 +distinct genomic distinct d di dis dist BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ...,(). 7 7 0 0 0 0 1 +43. Hoang, 43. 4 43 43. 43. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,... 5 9 0 0 0 0 1 +exposure as exposure e ex exp expo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 -... 4 8 0 0 0 0 1 +Med. 5, med. M Me Med Med. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,(). 5 3 0 0 0 0 1 +44. Prasad, 44. 4 44 44. 44. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.:-. 6 9 0 0 0 0 1 +537, S63 537, 5 53 537 537, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 ,(). 4 2 0 0 0 0 1 +45. Cibulskis, 45. 4 45 45. 45. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.. 4 9 0 0 0 0 1 +in impure in i in in in BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 6 6 ... 3 8 0 0 0 0 1 +31, 213-219 31, 3 31 31, 31, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 ,-(). 5 2 0 0 0 0 1 +46. Jumper, 46. 4 46 46. 46. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.. 4 9 0 0 0 0 1 +AlphaFold. Nature alphafold. A Al Alp Alph BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,-(). 6 5 0 0 0 0 1 +47. Faure, 47. 4 47 47. 47. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,... 5 8 0 0 0 0 1 +landscapes of landscapes l la lan land BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 .,- 3 8 0 0 0 0 1 +(2022). (2022). (2022). ( (2 (20 (202 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 6 (). 3 1 0 0 0 0 1 +48. Singh, 48. 4 48 48. 48. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.,,..,,..,. 13 10 0 0 0 0 1 +of covalent of o of of of BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ....,- 6 7 0 0 0 0 1 +(2011). (2011). (2011). ( (2 (20 (201 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 6 (). 3 1 0 0 0 0 1 +49. Sakamoto, 49. 4 49 49. 49. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,...: 6 9 0 0 0 0 1 +proteins to proteins p pr pro prot BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 -- 2 8 0 0 0 0 1 +and degradation. and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ....,- 6 7 0 0 0 0 1 +(2001). (2001). (2001). ( (2 (20 (200 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 6 (). 3 1 0 0 0 0 1 +50. Brady, 50. 5 50 50. 50. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..,,..,. 10 9 0 0 0 0 1 +insights from insights i in ins insi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 . 1 9 0 0 0 0 1 +Genet. 38, genet. G Ge Gen Gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,-(). 6 3 0 0 0 0 1 +51. Gross, 51. 5 51 51. 51. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.,,.,. 8 6 0 0 0 0 1 +immunoglobulin-T-cell receptor immunoglobulin-t-cell i im imm immu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 6 6 -- 2 7 0 0 0 0 1 +functional receptors functional f fu fun func BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 -.. 3 8 0 0 0 0 1 +Acad. Sci. acad. A Ac Aca Acad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 ..,-(). 7 5 0 0 0 0 1 +52. June, 52. 5 52 52. 52. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..,',..,,..,,. 16 9 0 0 0 0 1 +Milone, M. milone, M Mi Mil Milo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 ,... 4 7 0 0 0 0 1 +Science 359, science S Sc Sci Scie BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 6 6 ,-(). 5 4 0 0 0 0 1 +53. Hundal, 53. 5 53 53. 53. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..-:- 7 9 0 0 0 0 1 +identifying tumor identifying i id ide iden BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ..,(). 6 7 0 0 0 0 1 +54. Sarkizova, 54. 5 54 54. 54. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.. 4 9 0 0 0 0 1 +I epitope i I I I I BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 6 6 .. 2 8 0 0 0 0 1 +Biotechnol. 38, biotechnol. B Bi Bio Biot BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,-(). 6 4 0 0 0 0 1 +55. Schwarze, 55. 5 55 55. 55. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,..: 5 8 0 0 0 0 1 +a microcosting a a a a a BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 6 6 no 0 8 0 0 0 0 1 +center in center c ce cen cent BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 6 6 ...,-(). 8 8 0 0 0 0 1 +56. Do, 56. 5 56 56. 56. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 .,.,. 5 7 0 0 0 0 1 +formalin-fixed tissues: formalin-fixed f fo for form BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 6 6 -:. 3 8 0 0 0 0 1 +Clin. Chem. clin. C Cl Cli Clin BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 ..,-(). 7 4 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 6 0 - 1 10 0 1 1 0 0 +1877 1877 1877 1 18 187 1877 BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 6 0 no 0 10 0 1 0 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 6 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 6 0 ://././--- 10 10 0 1 0 0 1 +57. Wong, 57. 5 57 57. 57. BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 0 .,... 5 9 0 0 0 0 1 +formalin-fixed tumours formalin-fixed f fo for form BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 6 0 - 1 9 0 0 0 0 1 +massively parallel massively m ma mas mass BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 0 .., 3 7 0 0 0 0 1 +(2014). (2014). (2014). ( (2 (20 (201 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 0 (). 3 1 0 0 0 0 1 +58. Li, 58. 5 58 58. 58. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 0 .,.. 4 9 0 0 0 0 1 +cancer genomes. cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 0 .,-(). 6 6 0 0 0 0 1 +59. Kosugi, 59. 5 59 59. 59. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 0 .,.. 4 10 0 0 0 0 1 +detection algorithms detection d de det dete BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 0 . 1 8 0 0 0 0 1 +Biol. 20, biol. B Bi Bio Biol BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 0 .,(). 5 3 0 0 0 0 1 +60. Amarasinghe, 60. 6 60 60. 60. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 0 .,... 5 8 0 0 0 0 1 +long-read sequencing long-read l lo lon long BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 0 -.., 4 7 0 0 0 0 1 +(2020). (2020). (2020). ( (2 (20 (202 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 6 0 (). 3 1 0 0 0 0 1 +Publisher's note publisher's P Pu Pub Publ BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 5 ' 1 8 0 0 0 0 1 +jurisdictional claims jurisdictional j ju jur juri BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 6 5 . 1 10 0 0 0 0 1 +Open Access open O Op Ope Open BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 6 6 no 0 8 0 0 0 0 1 +Attribution 4.0 attribution A At Att Attr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 6 6 .,,, 4 9 0 0 0 0 1 +adaptation, distribution adaptation, a ad ada adap BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ,, 2 9 0 0 0 0 1 +as long as a as as as BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 () 2 10 0 0 0 0 1 +source, provide source, s so sou sour BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ,, 2 9 0 0 0 0 1 +if changes if i if if if BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 . 1 9 0 0 0 0 1 +article are article a ar art arti BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ', 2 9 0 0 0 0 1 +indicated otherwise indicated i in ind indi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 . 1 10 0 0 0 0 1 +included in included i in inc incl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 ' 1 9 0 0 0 0 1 +use is use u us use use BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 no 0 9 0 0 0 0 1 +use, you use, u us use use, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 , 1 9 0 0 0 0 1 +holder. To holder. h ho hol hold BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 6 6 .,://. 6 9 0 0 0 0 1 +org/licenses/by/4.0/. org/licenses/by/4.0/. org/licenses/by/4.0/. o or org org/ BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS CONTAINSDIGITS 0 0 0 0 0 0 0 0 6 6 ///./. 6 3 0 0 0 0 1 +© The © © © © © BLOCKSTART PAGEEND NEWFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 7 11 () 2 10 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 1 1 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 7 0 ://././--- 10 10 0 1 0 0 1 +Methods Methods methods M Me Met Meth BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 0 0 1 +The 100kGP the T Th The The BLOCKSTART PAGEIN NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 0 0 1 +The analysed the T Th The The BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 - 1 8 0 0 0 0 1 +patients with patients p pa pat pati BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 (.) 3 8 0 0 0 0 1 +through 13 through t th thr thro BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 ( 1 8 0 0 0 0 1 +Fig. 9). fig. F Fi Fig Fig. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 .). 3 9 0 0 0 0 1 +all participants. all a al all all BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 .- 2 9 0 0 0 0 1 +data derived data d da dat data BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 -,- 3 9 0 0 0 0 1 +from 10,470 from f fr fro from BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 ,(,,,,,- 8 9 0 0 0 0 1 +rectal, 440 rectal, r re rec rect BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 ,,,, 4 9 0 0 0 0 1 +1,045 renal 1,045 1 1, 1,0 1,04 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 7 0 ,,,,,,, 7 10 0 0 0 0 1 +454 ovarian, 454 4 45 454 454 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 7 0 ,,,,, 5 9 0 0 0 0 1 +testicular and testicular t te tes test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 )(-). 5 9 0 0 0 0 1 +clinicopathology information clinicopathology c cl cli clin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 - 1 9 0 0 0 0 1 +mentary Table mentary m me men ment BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 , 1 9 0 0 0 0 1 +per cancer per p pe per per BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 (.),,, 6 9 0 0 0 0 1 +mutation annotation mutation m mu mut muta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 - 1 8 0 0 0 0 1 +mentary Note mentary m me men ment BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 . 1 9 0 0 0 0 1 +dMMR and dmmr d dM dMM dMMR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 0 no 0 8 0 0 0 0 1 +by mSINGS by b by by by BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 (),,. 5 7 0 0 0 0 1 +Identification and identification I Id Ide Iden BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 2 no 0 10 0 0 0 0 1 +Cancer driver cancer C Ca Can Canc BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 2 no 0 9 0 0 0 0 1 +using the using u us usi usin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 2 (). 3 9 0 0 0 0 1 +the sensitivity the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 2 no 0 9 0 0 0 0 1 +well-established driver well-established w we wel well BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 2 -- 2 10 0 0 0 0 1 +age and age a ag age age BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 2 no 0 10 0 0 0 0 1 +the Integrated the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 2 no 0 9 0 0 0 0 1 +Metastatic Events metastatic M Me Met Meta BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 2 no 0 9 0 0 0 0 1 +MSK Cancer msk M MS MSK MSK BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 7 2 (),.- 5 9 0 0 0 0 1 +tionary timings tionary t ti tio tion BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 2 no 0 9 0 0 0 0 1 +MutationTimeR (Supplementary mutationtimer M Mu Mut Muta BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 2 (). 3 6 0 0 0 0 1 +Actionability of actionability A Ac Act Acti BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 3 no 0 10 0 0 0 0 1 +We first we W We We We BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 3 no 0 8 0 0 0 0 1 +Precision Oncology precision P Pr Pre Prec BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 3 no 0 8 0 0 0 0 1 +implications of implications i im imp impl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 ,. 2 9 0 0 0 0 1 +marketed drugs marketed m ma mar mark BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 no 0 9 0 0 0 0 1 +driver gene driver d dr dri driv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 3 , 1 9 0 0 0 0 1 +evidence. OncoKB evidence. e ev evi evid BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 .- 2 8 0 0 0 0 1 +porting the porting p po por port BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 3 no 0 9 0 0 0 0 1 +given drug. given g gi giv give BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 . 1 1 0 0 0 0 1 +To undertake to T To To To BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 3 no 0 8 0 0 0 0 1 +cancer type, cancer c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 , 1 9 0 0 0 0 1 +seed a seed s se see seed BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 , 1 10 0 0 0 0 1 +which is which w wh whi whic BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 , 1 8 0 0 0 0 1 +IMeX consortium imex I IM IMe IMeX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 3 ,. 2 9 0 0 0 0 1 +proteins with proteins p pr pro prot BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 3 ' 1 9 0 0 0 0 1 +Cancer Protein cancer C Ca Can Canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 3 . 1 9 0 0 0 0 1 +lineage specificity lineage l li lin line BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 3 no 0 9 0 0 0 0 1 +server (Supplementary server s se ser serv BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 3 (). 3 4 0 0 0 0 1 +Reporting summary reporting R Re Rep Repo BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 7 4 no 0 10 0 0 0 0 1 +Further information further F Fu Fur Furt BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 4 no 0 10 0 0 0 0 1 +Portfolio Reporting portfolio P Po Por Port BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 4 . 1 7 0 0 0 0 1 +Data availability data D Da Dat Data BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 4 no 0 10 0 0 0 0 1 +Summary statistics summary S Su Sum Summ BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 4 - 1 9 0 0 0 0 1 +tary Tables tary t ta tar tary BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 4 . 1 10 0 0 0 0 1 +All sample-specific all A Al All All BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 4 -, 2 8 0 0 0 0 1 +Genomes Project genomes G Ge Gen Geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 4 no 0 9 0 0 0 0 1 +England Clinical england E En Eng Engl BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 0 0 0 0 0 0 7 4 () 2 9 0 0 0 0 1 +individual's data individual's i in ind indi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 4 '(://.- 7 9 0 0 0 0 1 +land.co.uk/research/pan-cancer-and-molecular-oncology-communit land.co.uk/research/pan-cancer-and-molecular-oncology-communit land.co.uk/research/pan-cancer-and-molecular-oncology-communit l la lan land BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 4 ..//----- 9 8 0 0 0 0 1 +y). The y). y y) y). y). BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 4 ). 2 9 0 0 0 0 1 +network and network n ne net netw BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 5 ://.- 5 8 0 0 0 0 1 +sengland.co.uk/research/academic/join-gecip. The sengland.co.uk/research/academic/join-gecip. s se sen seng BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ..///-. 7 8 0 0 0 0 1 +an online an a an an an BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 5 ,',- 4 9 0 0 0 0 1 +pletion of pletion p pl ple plet BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 - 1 9 0 0 0 0 1 +fication of fication f fi fic fica BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 .://. 5 8 0 0 0 0 1 +genomicsengland.co.uk/research/academic for genomicsengland.co.uk/research/academic g ge gen geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ..//. 5 8 0 0 0 0 1 +The Genomics the T Th The The BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 5 no 0 8 0 0 0 0 1 +figshare at figshare f fi fig figs BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ://././...(.). 14 10 0 0 0 0 1 +analysis of analysis a an ana anal BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 - 1 9 0 0 0 0 1 +ics England ics i ic ics ics BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 (://.. 6 8 0 0 0 0 1 +co.uk/understanding-genomics/data). The co.uk/understanding-genomics/data). c co co. co.u BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ./-/).,- 8 8 0 0 0 0 1 +ject publication ject j je jec ject BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ://.- 5 8 0 0 0 0 1 +icsengland.co.uk/about-gecip/publications. Samples icsengland.co.uk/about-gecip/publications. i ic ics icse BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ../-/. 6 8 0 0 0 0 1 +used in used u us use used BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 // 2 9 0 0 0 0 1 +shared_allGeCIPs/pancancer_drivers/results/. A shared_allgecips/pancancer_drivers/results/. s sh sha shar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ///.- 5 9 0 0 0 0 1 +coding mutations coding c co cod codi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 / 1 9 0 0 0 0 1 +re_gecip/shared_allGeCIPs/pancancer_drivers/results/. The re_gecip/shared_allgecips/pancancer_drivers/results/. r re re_ re_g BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ////. 5 8 0 0 0 0 1 +and OncoKB and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 ://. 4 10 0 0 0 0 1 +sanger.ac.uk/actionability and sanger.ac.uk/actionability s sa san sang BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ../://../ 9 8 0 0 0 0 1 +Genes#sections=Tx, respectively. genes#sections=tx, G Ge Gen Gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 5 #,. 3 8 0 0 0 0 1 +are available are a ar are are BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 ://./. 6 9 0 0 0 0 1 +for Cancer for f fo for for BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 5 ://...// 8 9 0 0 0 0 1 +national-genomic-test-directories/. Lists national-genomic-test-directories/. n na nat nati BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ---/.- 6 9 0 0 0 0 1 +ies were ies i ie ies ies BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 (://...// 9 8 0 0 0 0 1 +home), IntOGen home), h ho hom home BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 5 ),(://../) 10 9 0 0 0 0 1 +Genome Atlas genome G Ge Gen Geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 5 ()-.. 5 9 0 0 0 0 1 +Somatic mutations somatic S So Som Soma BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 5 no 0 8 0 0 0 0 1 +in VEP in i in in in BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 5 .. 2 1 0 0 0 0 1 +Code availability code C Co Cod Code BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 8 no 0 10 0 0 0 0 1 +Details and details D De Det Deta BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 8 no 0 9 0 0 0 0 1 +https://intogen.readthedocs.io/en/latest/index.html. The https://intogen.readthedocs.io/en/latest/index.html. h ht htt http BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 1 7 8 ://..///.. 10 9 0 0 0 0 1 +code to code c co cod code BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 8 no 0 10 0 0 0 0 1 +research environment research r re res rese BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 8 (://-.../ 9 9 0 0 0 0 1 +access/) under access/) a ac acc acce BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 8 /)/////. 8 10 0 0 0 0 1 +The link the T Th The The BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 8 no 0 9 0 0 0 0 1 +network and network n ne net netw BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 7 8 ://.- 5 9 0 0 0 0 1 +sengland.co.uk/research/academic/join-gecip. The sengland.co.uk/research/academic/join-gecip. s se sen seng BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 8 ..///-. 7 9 0 0 0 0 1 +the canSAR the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 8 no 0 9 0 0 0 0 1 +(https://doi.org/10.5281/zenodo.8329054) (ref. (https://doi.org/10.5281/zenodo.8329054) ( (h (ht (htt BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 7 8 (://././.)(.). 14 7 0 0 0 0 1 +References References references R Re Ref Refe BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 9 no 0 10 0 0 0 0 1 +61. Davies, 61. 6 61 61. 61. BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,.. 4 9 0 0 0 0 1 +deficiency based deficiency d de def defi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 9 ...,- 5 9 0 0 0 0 1 +(2017). (2017). (2017). ( (2 (20 (201 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 7 9 (). 3 1 0 0 0 0 1 +62. Salipante, 62. 6 62 62. 62. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,..,,..,,..,,.. 16 9 0 0 0 0 1 +& Pritchard, & & & & & BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 7 9 ,.. 3 8 0 0 0 0 1 +generation sequencing. generation g ge gen gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 9 ...,-(). 8 7 0 0 0 0 1 +63. Nguyen, 63. 6 63 63. 63. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,.. 4 9 0 0 0 0 1 +from prospective from f fr fro from BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 9 ,., 3 9 0 0 0 0 1 +563-575 (2022). 563-575 5 56 563 563- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 -(). 4 2 0 0 0 0 1 +64. Tate, 64. 6 64 64. 64. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,...: 6 9 0 0 0 0 1 +cancer. Nucleic cancer. c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 9 ..,-(). 7 6 0 0 0 0 1 +65. Orchard, 65. 6 65 65. 65. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,..- 5 8 0 0 0 0 1 +curation platform curation c cu cur cura BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 9 . 1 9 0 0 0 0 1 +Acids Res. acids A Ac Aci Acid BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 9 .,-(). 6 4 0 0 0 0 1 +66. Hornbeck, 66. 6 66 66. 66. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,...,:, 8 9 0 0 0 0 1 +recalibrations. Nucleic recalibrations. r re rec reca BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 9 ..,-(). 7 7 0 0 0 0 1 +67. Caulfield, 67. 6 67 67. 67. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,..[]. 7 9 0 0 0 0 1 +figshare https://doi.org/10.6084/m9.figshare.4530893.v7 figshare f fi fig figs BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 7 9 ://././...(). 13 8 0 0 0 0 1 +68. Lärkeryd, 68. 6 68 68. 68. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,./-:..(..). 13 10 0 0 0 0 1 +Zenodo https://doi.org/10.5281/zenodo.8329054 zenodo Z Ze Zen Zeno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 9 ://././.(). 11 7 0 0 0 0 1 +69. Shannon, 69. 6 69 69. 69. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 7 9 .,..: 5 8 0 0 0 0 1 +integrated models integrated i in int inte BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 9 . 1 8 0 0 0 0 1 +Res. 13, res. R Re Res Res. BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 9 .,-(). 6 3 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 7 0 ://././--- 10 10 0 1 0 0 1 +Acknowledgements Acknowledgements acknowledgements A Ac Ack Ackn BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 10 0 1 0 0 1 +Funding was funding F Fu Fun Fund BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 (), 3 8 0 0 0 0 1 +Research UK research R Re Res Rese BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 7 0 (/). 4 8 0 0 0 0 1 +A.S. is a.s. A A. A.S A.S. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 7 0 ..() 4 9 0 0 0 0 1 +Academic Clinical academic A Ac Aca Acad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 , 1 8 0 0 0 0 1 +Biomedical Research biomedical B Bi Bio Biom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 0 , 1 10 0 0 0 0 1 +the Academy the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 9 0 0 0 0 1 +Award (227000/Z/23/Z). award A Aw Awa Awar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 (///). 6 9 0 0 0 0 1 +supported by supported s su sup supp BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 8 0 0 0 0 1 +Marsden NHS marsden M Ma Mar Mars BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 0 0 0 0 0 0 7 0 . 1 9 0 0 0 0 1 +This research this T Th Thi This BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 no 0 8 0 0 0 0 1 +findings generated findings f fi fin find BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 ,., 3 8 0 0 0 0 1 +Genomes Project genomes G Ge Gen Geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 0 ( 1 9 0 0 0 0 1 +owned company owned o ow own owne BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 ). 2 8 0 0 0 0 1 +100,000 Genomes 100,000 1 10 100 100, BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 7 0 , 1 9 0 0 0 0 1 +Research and research R Re Res Rese BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 7 0 ., 2 9 0 0 0 0 1 +and the and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 . 1 9 0 0 0 0 1 +The 100,000 the T Th The The BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 7 0 , 1 8 0 0 0 0 1 +collected by collected c co col coll BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 7 0 . 1 9 0 0 0 0 1 +Genomics England genomics G Ge Gen Geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 7 0 no 0 9 0 0 0 0 1 +WGS for wgs W WG WGS WGS BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 7 0 -. 2 8 0 0 0 0 1 +Author contributions author A Au Aut Auth BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +B.K., A.S. b.k., B B. B.K B.K. BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 ..,.......,..,... 17 9 0 0 0 0 1 +D.C. performed d.c. D D. D.C D.C. BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 .....,..,..,...,.., 19 10 0 0 0 0 1 +R.C., A.J.G., r.c., R R. R.C R.C. BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 7 ..,...,..,.... 14 9 0 1 0 0 1 +and statistical and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 7 ...,..,.... 11 10 0 1 0 0 1 +manuscript; all manuscript; m ma man manu BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 7 ;, 2 9 0 1 0 0 1 +manuscript. manuscript. manuscript. m ma man manu BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 7 . 1 1 0 1 0 0 1 +Competing interests competing C Co Com Comp BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 9 no 0 10 0 1 0 0 1 +The authors the T Th The The BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 9 . 1 10 0 1 0 0 1 +Additional information additional A Ad Add Addi BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 9 no 0 10 0 0 0 0 1 +Extended data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 9 no 0 10 0 0 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9. https://doi.org/10.1038/s41588-024-01785-9. https://doi.org/10.1038/s41588-024-01785-9. h ht htt http BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 9 ://././---. 11 9 0 0 0 0 1 +Supplementary information supplementary S Su Sup Supp BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 9 no 0 10 0 0 0 0 1 +contains supplementary contains c co con cont BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 9 no 0 10 0 0 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9. https://doi.org/10.1038/s41588-024-01785-9. https://doi.org/10.1038/s41588-024-01785-9. h ht htt http BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 9 ://././---. 11 9 0 0 0 0 1 +Correspondence and correspondence C Co Cor Corr BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 10 no 0 10 0 0 0 0 1 +Richard Houlston. richard R Ri Ric Rich BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 1 0 0 0 0 0 0 8 10 . 1 2 0 0 0 0 1 +Peer review peer P Pe Pee Peer BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 10 . 1 9 0 0 0 0 1 +and Jo and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 10 no 0 10 0 0 0 0 1 +work. Peer work. w wo wor work BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 10 .. 2 6 0 0 0 0 1 +Reprints and reprints R Re Rep Repr BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 11 no 0 10 0 0 0 0 1 +www.nature.com/reprints. www.nature.com/reprints. www.nature.com/reprints. w ww www www. BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 8 11 ../. 4 4 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 0 ://././--- 10 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +500 500 500 5 50 500 500 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +1000 1000 1000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 1 no 0 10 0 0 0 0 1 +1500 1500 1500 1 15 150 1500 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 1 no 0 10 0 1 0 0 1 +2000 2000 2000 2 20 200 2000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 2 no 0 10 0 1 0 0 1 +Bladder Bladder bladder B Bl Bla Blad BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 7 0 0 0 0 1 +Breast Breast breast B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 6 0 0 0 0 1 +Colorectum Colorectum colorectum C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +Kidney Kidney kidney K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 6 0 0 0 0 1 +Lung Lung lung L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 4 0 0 0 0 1 +Melanoma Melanoma melanoma M Me Mel Mela BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 8 0 0 0 0 1 +Oesophagus Oesophagus oesophagus O Oe Oes Oeso BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +Ovary Ovary ovary O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 5 0 0 0 0 1 +Pancreas Pancreas pancreas P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 8 0 0 0 0 1 +Prostate Prostate prostate P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 8 0 0 0 0 1 +Testis Testis testis T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 2 no 0 6 0 0 0 0 1 +Uterus Uterus uterus U Ut Ute Uter BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 2 no 0 6 0 0 0 0 1 +Site Site site S Si Sit Site BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +Number Number number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +10000 10000 10000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 0 0 0 1 +20000 20000 20000 2 20 200 2000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 0 0 0 1 +30000 30000 30000 3 30 300 3000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +40000 40000 40000 4 40 400 4000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +50000 50000 50000 5 50 500 5000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +Bladder Bladder bladder B Bl Bla Blad BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 7 0 0 0 0 1 +Breast Breast breast B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 6 0 0 0 0 1 +Colorectum Colorectum colorectum C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +Kidney Kidney kidney K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 6 0 0 0 0 1 +Lung Lung lung L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 4 0 0 0 0 1 +Melanoma Melanoma melanoma M Me Mel Mela BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 8 0 0 0 0 1 +Oesophagus Oesophagus oesophagus O Oe Oes Oeso BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +Ovary Ovary ovary O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 5 0 0 0 0 1 +Pancreas Pancreas pancreas P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 8 0 0 0 0 1 +Prostate Prostate prostate P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 8 0 0 0 0 1 +Testis Testis testis T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 6 0 0 0 0 1 +Uterus Uterus uterus U Ut Ute Uter BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 6 0 0 0 0 1 +Site Site site S Si Sit Site BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +Number Number number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 7 no 0 10 0 0 0 0 1 +Genomics England genomics G Ge Gen Geno BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 7 no 0 10 0 1 0 0 1 +NHS England nhs N NH NHS NHS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 7 no 0 10 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 7 .-. 3 10 0 0 0 0 1 +panel: the panel: p pa pan pane BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 7 :;:. 4 7 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 0 ://././--- 10 10 0 1 0 0 1 +55 55 55 5 55 55 55 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +61 61 61 6 61 61 61 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +27 27 27 2 27 27 27 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +241 241 241 2 24 241 241 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +56 56 56 5 56 56 56 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +51 51 51 5 51 51 51 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +34 34 34 3 34 34 34 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +305 305 305 3 30 305 305 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +2001 2001 2001 2 20 200 2001 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 0 no 0 10 0 1 0 0 1 +305 305 305 3 30 305 305 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +2324 2324 2324 2 23 232 2324 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 0 no 0 10 0 1 0 0 1 +117 117 117 1 11 117 117 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +95 95 95 9 95 95 95 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +111 111 111 1 11 111 111 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +126 126 126 1 12 126 126 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +60 60 60 6 60 60 60 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +64 64 64 6 64 64 64 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +34 34 34 3 34 34 34 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +91 91 91 9 91 91 91 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +52 52 52 5 52 52 52 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +133 133 133 1 13 133 133 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +157 157 157 1 15 157 157 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +49 49 49 4 49 49 49 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +61 61 61 6 61 61 61 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +53 53 53 5 53 53 53 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +201 201 201 2 20 201 201 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +872 872 872 8 87 872 872 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +68 68 68 6 68 68 68 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +105 105 105 1 10 105 105 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +24 24 24 2 24 24 24 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +677 677 677 6 67 677 677 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +25 25 25 2 25 25 25 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +382 382 382 3 38 382 382 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 1 0 0 1 +26 26 26 2 26 26 26 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +35 35 35 3 35 35 35 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 6 0 1 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +100 100 100 1 10 100 100 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +1000 1000 1000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 0 0 0 1 +10000 10000 10000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 0 0 0 1 +100000 100000 100000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 0 0 0 1 +1000000 1000000 1000000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 1 0 0 1 +10000000 10000000 10000000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 4 no 0 10 0 1 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 4 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 4 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 -- 2 7 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 -- 2 6 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 4 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 5 0 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 8 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 5 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 8 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 8 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 9 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 9 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 9 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 10 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 5 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 5 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 4 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 4 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 8 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 6 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 - 1 7 0 0 0 0 1 +SNV Mutation snv S SN SNV SNV BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 4 no 0 9 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 10 ... 3 10 0 0 0 0 1 +SNV, single snv, S SN SNV SNV, BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 10 ,. 2 2 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 1 ://././--- 10 10 0 1 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEEND NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 4 ... 3 10 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 8 0 ://././--- 10 10 0 1 0 0 1 +Recep_L_domain Recep_L_domain recep_l_domain R Re Rec Rece BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +Furin-like Furin-like furin-like F Fu Fur Furi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 0 - 1 7 0 0 0 0 1 +GF_recep_IV GF_recep_IV gf_recep_iv G GF GF_ GF_r BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +PK_Tyr_Ser-Thr PK_Tyr_Ser-Thr pk_tyr_ser-thr P PK PK_ PK_T BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 0 - 1 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 4 0 0 0 0 1 +150 150 150 1 15 150 150 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +300 300 300 3 30 300 300 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +450 450 450 4 45 450 450 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +600 600 600 6 60 600 600 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +750 750 750 7 75 750 750 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +900 900 900 9 90 900 900 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 8 0 0 0 0 1 +1050 1050 1050 1 10 105 1050 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 0 no 0 10 0 0 0 0 1 +1200 1200 1200 1 12 120 1200 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 0 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +5 5 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +15 15 15 1 15 15 15 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +20 20 20 2 20 20 20 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +25 25 25 2 25 25 25 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +30 30 30 3 30 30 30 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 0 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 0 no 0 2 0 0 0 0 1 +7 0 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 0 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 0 no 0 1 0 0 0 0 1 +7 0 7 7 7 7 7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 7 0 0 0 0 1 +1 0 1 1 1 1 1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 0 . 1 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 0 no 0 2 0 0 0 0 1 +7 1 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 0 . 1 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 0 no 0 2 0 0 0 0 1 +7 1 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 0 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 3 0 0 0 0 1 +7 1 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +y s y y y y y BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 2 0 0 0 0 1 +7 1 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 1 0 0 0 0 1 +7 4 7 7 7 7 7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 7 0 0 0 0 1 +5 1 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 2 0 0 0 0 1 +7 4 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +7 5 7 7 7 7 7 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 2 0 0 0 0 1 +7 4 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +7 5 7 7 7 7 7 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 1 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 1 no 0 1 0 0 0 0 1 +7 4 7 7 7 7 7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 7 0 0 0 0 1 +5 2 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 1 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +5 2 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 no 0 7 0 0 0 0 1 +7 5 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +5 1 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +7 5 7 7 7 7 7 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 2 no 0 10 0 0 0 0 1 +5 1 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 . 1 2 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 7 0 0 0 0 1 +7 5 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 . 1 10 0 0 0 0 1 +la la la l la la la BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 3 no 0 2 0 0 0 0 1 +7 6 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +6 8 6 6 6 6 6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +s C s s s s s BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 4 0 0 0 0 1 +y s y y y y y BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 . 1 10 0 0 0 0 1 +la la la l la la la BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 3 no 0 2 0 0 0 0 1 +7 6 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +6 9 6 6 6 6 6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .S p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 . 1 10 0 0 0 0 1 +e r7 e e e e e BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 8 0 0 0 0 1 +6 8 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +y s y y y y y BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .S p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 . 1 10 0 0 0 0 1 +e r7 e e e e e BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 3 no 0 5 0 0 0 0 1 +6 8 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 3 no 0 10 0 0 0 0 1 +p .S p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 . 1 10 0 0 0 0 1 +e r7 e e e e e BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 2 0 0 0 0 1 +6 8 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +p .P p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 . 1 10 0 0 0 0 1 +ro ro ro r ro ro ro BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 8 4 no 0 3 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 4 no 0 3 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +s T s s s s s BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +ln ln ln l ln ln ln BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 8 4 no 0 2 0 0 0 0 1 +P ro p P P P P BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 4 0 0 0 0 1 +A s a A A A A BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +p .P p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 . 1 10 0 0 0 0 1 +ro ro ro r ro ro ro BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 8 4 no 0 3 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 4 no 0 3 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +s G s s s s s BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +H H h H H H H BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 6 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 4 no 0 6 0 0 0 0 1 +P ro p P P P P BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 4 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 4 no 0 1 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +A s a A A A A BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 8 4 no 0 10 0 0 0 0 1 +T y t T T T T BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 2 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .T p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 8 0 0 0 0 1 +h r7 h h h h h BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 8 0 0 0 0 1 +9 0 9 9 9 9 9 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +e t e e e e e BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 8 5 no 0 2 0 0 0 0 1 +8 3 8 8 8 8 8 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 5 no 0 8 0 0 0 0 1 +ln ln ln l ln ln ln BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +Inframe deletion inframe I In Inf Infr BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 9 0 0 0 0 1 +Inframe insertion inframe I In Inf Infr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 10 0 0 0 0 1 +Missense Missense missense M Mi Mis Miss BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 5 0 0 0 0 1 +Nonsynonymous Nonsynonymous nonsynonymous N No Non Nons BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 7 0 0 0 0 1 +VUS VUS vus V VU VUS VUS BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 5 no 0 2 0 0 0 0 1 +Mutation count mutation M Mu Mut Muta BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +AA position aa A AA AA AA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +EGFR (ENST00000275493) egfr E EG EGF EGFR BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 () 2 10 0 0 0 0 1 +Recep_L_domain Recep_L_domain recep_l_domain R Re Rec Rece BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +Furin-like Furin-like furin-like F Fu Fur Furi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 - 1 7 0 0 0 0 1 +GF_recep_IV GF_recep_IV gf_recep_iv G GF GF_ GF_r BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +PK_Tyr_Ser-Thr PK_Tyr_Ser-Thr pk_tyr_ser-thr P PK PK_ PK_T BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 8 6 - 1 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 4 0 0 0 0 1 +150 150 150 1 15 150 150 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +300 300 300 3 30 300 300 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +450 450 450 4 45 450 450 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +600 600 600 6 60 600 600 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +750 750 750 7 75 750 750 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +900 900 900 9 90 900 900 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 8 0 0 0 0 1 +1050 1050 1050 1 10 105 1050 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 6 no 0 10 0 0 0 0 1 +1200 1200 1200 1 12 120 1200 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 8 6 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +4 4 4 4 4 4 4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +6 6 6 6 6 6 6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +8 8 8 8 8 8 8 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +12 12 12 1 12 12 12 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 6 . 1 3 0 0 0 0 1 +e u e e e e e BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 6 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 8 6 . 1 3 0 0 0 0 1 +rg rg rg r rg rg rg BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 6 no 0 2 0 0 0 0 1 +1 0 1 1 1 1 1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 6 . 1 10 0 0 0 0 1 +rg rg rg r rg rg rg BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 6 no 0 2 0 0 0 0 1 +1 0 1 1 1 1 1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 6 . 1 10 0 0 0 0 1 +rg rg rg r rg rg rg BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 6 no 0 3 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +y s y y y y y BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +p .T p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 6 . 1 5 0 0 0 0 1 +h r2 h h h h h BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 6 no 0 5 0 0 0 0 1 +6 3 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +la la la l la la la BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +2 8 2 2 2 2 2 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +la la la l la la la BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +2 8 2 2 2 2 2 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +la la la l la la la BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +2 8 2 2 2 2 2 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +3 0 3 3 3 3 3 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .T p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 5 0 0 0 0 1 +h r3 h h h h h BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 no 0 5 0 0 0 0 1 +6 3 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .T p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 5 0 0 0 0 1 +h r3 h h h h h BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 no 0 5 0 0 0 0 1 +6 3 6 6 6 6 6 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .P p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +ro ro ro r ro ro ro BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +5 9 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 7 . 1 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 7 no 0 2 0 0 0 0 1 +5 9 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +p .S p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 . 1 10 0 0 0 0 1 +e r6 e e e e e BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +4 5 4 4 4 4 4 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +y s y y y y y BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 8 no 0 2 0 0 0 0 1 +7 7 7 7 7 7 7 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 8 no 0 3 0 0 0 0 1 +9 3 9 9 9 9 9 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +ly ly ly l ly ly ly BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +Missense Missense missense M Mi Mis Miss BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 no 0 5 0 0 0 0 1 +VUS VUS vus V VU VUS VUS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 no 0 2 0 0 0 0 1 +Inframe insertion inframe I In Inf Infr BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +Mutation count mutation M Mu Mut Muta BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +AA position aa A AA AA AA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +EGFR (ENST00000275493) egfr E EG EGF EGFR BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 () 2 10 0 0 0 0 1 +Lung adenocarcinoma lung L Lu Lun Lung BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +GBM, IDH gbm, G GB GBM GBM, BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 , 1 10 0 0 0 0 1 +PI3K_rbd PI3K_rbd pi3k_rbd P PI PI3 PI3K BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 8 no 0 6 0 0 0 0 1 +PI3_PI4_kinase PI3_PI4_kinase pi3_pi4_kinase P PI PI3 PI3_ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +PI3K_C2 PI3K_C2 pi3k_c2 P PI PI3 PI3K BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 8 no 0 5 0 0 0 0 1 +PI3K_p85B PI3K_p85B pi3k_p85b P PI PI3 PI3K BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 8 no 0 6 0 0 0 0 1 +PI3Ka PI3Ka pi3ka P PI PI3 PI3K BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 8 no 0 4 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 4 0 0 0 0 1 +125 125 125 1 12 125 125 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +250 250 250 2 25 250 250 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +375 375 375 3 37 375 375 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +500 500 500 5 50 500 500 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +625 625 625 6 62 625 625 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +750 750 750 7 75 750 750 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +875 875 875 8 87 875 875 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 8 0 0 0 0 1 +1000 1000 1000 1 10 100 1000 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 8 no 0 10 0 0 0 0 1 +1068 1068 1068 1 10 106 1068 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 8 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +20 20 20 2 20 20 20 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +30 30 30 3 30 30 30 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +40 40 40 4 40 40 40 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 8 . 1 10 0 0 0 0 1 +rg rg rg r rg rg rg BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 8 no 0 5 0 0 0 0 1 +8 8 8 8 8 8 8 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +ln ln ln l ln ln ln BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 10 0 0 0 0 1 +rg rg rg r rg rg rg BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 3 0 0 0 0 1 +9 3 9 9 9 9 9 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .L p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 4 0 0 0 0 1 +y s y y y y y BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 10 0 0 0 0 1 +ln ln ln l ln ln ln BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +p .T p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 . 1 3 0 0 0 0 1 +h r1 h h h h h BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 9 no 0 3 0 0 0 0 1 +0 2 0 0 0 0 0 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 no 0 1 0 0 0 0 1 +1 0 1 1 1 1 1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 9 no 0 8 0 0 0 0 1 +Missense Missense missense M Mi Mis Miss BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 5 0 0 0 0 1 +VUS VUS vus V VU VUS VUS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +Inframe deletion inframe I In Inf Infr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 9 0 0 0 0 1 +Frameshift Frameshift frameshift F Fr Fra Fram BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 6 0 0 0 0 1 +Inframe insertion inframe I In Inf Infr BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +Mutation count mutation M Mu Mut Muta BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +AA position aa A AA AA AA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +PIK3CA (ENST00000263967) pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 9 () 2 10 0 0 0 0 1 +Uterine adenocarcinoma uterine U Ut Ute Uter BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +PI3K_rbd PI3K_rbd pi3k_rbd P PI PI3 PI3K BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 10 no 0 6 0 0 0 0 1 +PI3_PI4_kinase PI3_PI4_kinase pi3_pi4_kinase P PI PI3 PI3_ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +PI3K_C2 PI3K_C2 pi3k_c2 P PI PI3 PI3K BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 10 no 0 5 0 0 0 0 1 +PI3K_p85B PI3K_p85B pi3k_p85b P PI PI3 PI3K BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 10 no 0 6 0 0 0 0 1 +PI3Ka PI3Ka pi3ka P PI PI3 PI3K BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 10 no 0 4 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 4 0 0 0 0 1 +125 125 125 1 12 125 125 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +250 250 250 2 25 250 250 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +375 375 375 3 37 375 375 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +500 500 500 5 50 500 500 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +625 625 625 6 62 625 625 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +750 750 750 7 75 750 750 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +875 875 875 8 87 875 875 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 8 0 0 0 0 1 +1000 1000 1000 1 10 100 1000 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 10 no 0 10 0 0 0 0 1 +1068 1068 1068 1 10 106 1068 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 10 no 0 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +50 50 50 5 50 50 50 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +100 100 100 1 10 100 100 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +150 150 150 1 15 150 150 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +200 200 200 2 20 200 200 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +250 250 250 2 25 250 250 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +p .A p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 3 0 0 0 0 1 +s n s s s s s BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +p .C p p p p p BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 3 0 0 0 0 1 +y s y y y y y BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 no 0 9 0 0 0 0 1 +p .G p p p p p BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 3 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 10 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 10 0 0 0 0 1 +lu lu lu l lu lu lu BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 9 10 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +p .G p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 10 0 0 0 0 1 +ln ln ln l ln ln ln BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 10 no 0 2 0 0 0 0 1 +5 4 5 5 5 5 5 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +p .H p p p p p BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 10 . 1 10 0 0 0 0 1 +is is is i is is is BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 10 no 0 2 0 0 0 0 1 +1 0 1 1 1 1 1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 10 no 0 10 0 0 0 0 1 +Missense Missense missense M Mi Mis Miss BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 5 0 0 0 0 1 +VUS VUS vus V VU VUS VUS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 2 0 0 0 0 1 +Inframe deletion inframe I In Inf Infr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +Frameshift Frameshift frameshift F Fr Fra Fram BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 6 0 0 0 0 1 +Nonsynonymous Nonsynonymous nonsynonymous N No Non Nons BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 8 0 0 0 0 1 +Mutation count mutation M Mu Mut Muta BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +AA position aa A AA AA AA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +PIK3CA (ENST00000263967) pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 11 () 2 10 0 0 0 0 1 +Breast ductal breast B Br Bre Brea BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +a a a a a a a BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +b b b b b b b BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 0 0 0 0 0 0 9 11 no 0 10 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 11 .:() 4 9 0 0 0 0 1 +EGFR mutations egfr E EG EGF EGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 11 ;() 3 9 0 0 0 0 1 +mutations in mutations m mu mut muta BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 11 . 1 10 0 0 0 0 1 +specific mutations specific s sp spe spec BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 11 no 0 9 0 0 0 0 1 +smRegions is smregions s sm smR smRe BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 11 (-.) 4 10 0 0 0 0 1 +multiple cancer multiple m mu mul mult BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 11 . 1 2 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 9 0 ://././--- 10 10 0 1 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 -- 2 6 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 10 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 10 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 -- 2 7 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 9 .-. 3 10 0 0 0 0 1 +performed using performed p pe per perf BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 . 1 2 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 9 0 ://././--- 10 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +5 5 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +15 15 15 1 15 15 15 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +20 20 20 2 20 20 20 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 -- 2 7 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 -- 2 6 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 9 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 10 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 4 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 8 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 6 0 0 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 5 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +Tumour type tumour T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +Number Number number N Nu Num Numb BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 7 .- 2 9 0 0 0 0 1 +tumour specific tumour t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 7 ,. 2 9 0 0 0 0 1 +Analysis restricted analysis A An Ana Anal BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +type. Oncogenicity type. t ty typ type BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 .. 2 10 0 0 0 0 1 +median number median m me med medi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 . 1 9 0 0 0 0 1 +represents the represents r re rep repr BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 . 1 8 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 9 0 ://././--- 10 10 0 1 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +APC APC apc A AP APC APC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +KMT2C KMT2C kmt2c K KM KMT KMT2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +VHL VHL vhl V VH VHL VHL BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +ACVR2A ACVR2A acvr2a A AC ACV ACVR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +RNF43 RNF43 rnf43 R RN RNF RNF4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +PBRM1 PBRM1 pbrm1 P PB PBR PBRM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +NF1 NF1 nf1 N NF NF1 NF1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +MAP3K1 MAP3K1 map3k1 M MA MAP MAP3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +TCF7L2 TCF7L2 tcf7l2 T TC TCF TCF7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +TGFBR2 TGFBR2 tgfbr2 T TG TGF TGFB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +SETD2 SETD2 setd2 S SE SET SETD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +CDH1 CDH1 cdh1 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +SOX9 SOX9 sox9 S SO SOX SOX9 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +GATA3 GATA3 gata3 G GA GAT GATA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +CDKN2A CDKN2A cdkn2a C CD CDK CDKN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +FAT1 FAT1 fat1 F FA FAT FAT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +CTNNB1 CTNNB1 ctnnb1 C CT CTN CTNN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +SPEN SPEN spen S SP SPE SPEN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +NRAS NRAS nras N NR NRA NRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +CASP8 CASP8 casp8 C CA CAS CASP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +EP300 EP300 ep300 E EP EP3 EP30 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +NOTCH1 NOTCH1 notch1 N NO NOT NOTC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +TET2 TET2 tet2 T TE TET TET2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +STK11 STK11 stk11 S ST STK STK1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +BCOR BCOR bcor B BC BCO BCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +SMARCA4 SMARCA4 smarca4 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +ARID1B ARID1B arid1b A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +FGFR3 FGFR3 fgfr3 F FG FGF FGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +BAP1 BAP1 bap1 B BA BAP BAP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +HLA-A HLA-A hla-a H HL HLA HLA- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +HLA-B HLA-B hla-b H HL HLA HLA- BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 - 1 7 0 0 0 0 1 +ERBB3 ERBB3 erbb3 E ER ERB ERBB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +SF3B1 SF3B1 sf3b1 S SF SF3 SF3B BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +NFE2L2 NFE2L2 nfe2l2 N NF NFE NFE2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +ELF3 ELF3 elf3 E EL ELF ELF3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +MTOR MTOR mtor M MT MTO MTOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +BRCA1 BRCA1 brca1 B BR BRC BRCA BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +SMAD2 SMAD2 smad2 S SM SMA SMAD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +CBFB CBFB cbfb C CB CBF CBFB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +FGFR2 FGFR2 fgfr2 F FG FGF FGFR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +KDM6A KDM6A kdm6a K KD KDM KDM6 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PPP2R1A PPP2R1A ppp2r1a P PP PPP PPP2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +AMER1 AMER1 amer1 A AM AME AMER BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +KEAP1 KEAP1 keap1 K KE KEA KEAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +STAG2 STAG2 stag2 S ST STA STAG BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PDE4DIP PDE4DIP pde4dip P PD PDE PDE4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +SMAD3 SMAD3 smad3 S SM SMA SMAD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +ESR1 ESR1 esr1 E ES ESR ESR1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +MUC20 MUC20 muc20 M MU MUC MUC2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +XPO1 XPO1 xpo1 X XP XPO XPO1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +KIT KIT kit K KI KIT KIT BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 1 1 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +FCGR3A FCGR3A fcgr3a F FC FCG FCGR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +ACVR1 ACVR1 acvr1 A AC ACV ACVR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +XCL2 XCL2 xcl2 X XC XCL XCL2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +ANKRD36 ANKRD36 ankrd36 A AN ANK ANKR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +CNTNAP3 CNTNAP3 cntnap3 C CN CNT CNTN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +IGSF3 IGSF3 igsf3 I IG IGS IGSF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PCBP1 PCBP1 pcbp1 P PC PCB PCBP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PNRC2 PNRC2 pnrc2 P PN PNR PNRC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +SEC22B SEC22B sec22b S SE SEC SEC2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +SLC35G5 SLC35G5 slc35g5 S SL SLC SLC3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +CHD4 CHD4 chd4 C CH CHD CHD4 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +PANCANCER (Oncogenic) pancancer P PA PAN PANC BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 () 2 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +1000 1000 1000 1 10 100 1000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 8 no 0 10 0 0 0 0 1 +2000 2000 2000 2 20 200 2000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 1 0 0 0 9 8 no 0 10 0 0 0 0 1 +3000 3000 3000 3 30 300 3000 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +Clonal (NA) clonal C Cl Clo Clon BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 8 0 0 0 0 1 +Clonal (early) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 10 0 0 0 0 1 +Clonal (late) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 9 0 0 0 0 1 +Subclonal Subclonal subclonal S Su Sub Subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 6 0 0 0 0 1 +NA NA na N NA NA NA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 9 .. 2 10 0 0 0 0 1 +mutations across mutations m mu mut muta BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 9 9 -. 2 3 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 9 0 ://././--- 10 10 0 1 0 0 1 +a) a) a) a a) a) a) BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 0 ) 1 10 0 1 0 0 1 +c) c) c) c c) c) c) BLOCKSTART PAGEIN SAMEFONT LOWERFONT 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 0 ) 1 10 0 0 0 0 1 +b) b) b) b b) b) b) BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 1 ) 1 10 0 1 0 0 1 +d) d) d) d d) d) d) BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 9 1 ) 1 10 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +RB1 RB1 rb1 R RB RB1 RB1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 5 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +LRRC4C LRRC4C lrrc4c L LR LRR LRRC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +AKAP9 AKAP9 akap9 A AK AKA AKAP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PKHD1L1 PKHD1L1 pkhd1l1 P PK PKH PKHD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +ANK1 ANK1 ank1 A AN ANK ANK1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 6 0 0 0 0 1 +BCL7A BCL7A bcl7a B BC BCL BCL7 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +CDH10 CDH10 cdh10 C CD CDH CDH1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +PDGFRA PDGFRA pdgfra P PD PDG PDGF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 8 0 0 0 0 1 +PREX2 PREX2 prex2 P PR PRE PREX BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 0 0 0 1 +Lung-LargeCell (Oncogenic) lung-largecell L Lu Lun Lung BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 -() 3 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +5 5 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 2 no 0 10 0 1 0 0 1 +15 15 15 1 15 15 15 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 2 no 0 2 0 1 0 0 1 +Clonal (NA) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 () 2 8 0 1 0 0 1 +Clonal (early) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 () 2 10 0 1 0 0 1 +Clonal (late) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 () 2 9 0 1 0 0 1 +Subclonal Subclonal subclonal S Su Sub Subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 no 0 6 0 1 0 0 1 +NA NA na N NA NA NA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 9 2 no 0 2 0 1 0 0 1 +NF2 NF2 nf2 N NF NF2 NF2 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 4 0 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 5 0 0 0 0 1 +KLF4 KLF4 klf4 K KL KLF KLF4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 5 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 7 0 0 0 0 1 +SMARCB1 SMARCB1 smarcb1 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 8 0 0 0 0 1 +SMO SMO smo S SM SMO SMO BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 3 no 0 4 0 0 0 0 1 +USP17L22 USP17L22 usp17l22 U US USP USP1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 10 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 3 no 0 4 0 0 0 0 1 +TRAF7 TRAF7 traf7 T TR TRA TRAF BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 6 0 0 0 0 1 +ZSCAN5A ZSCAN5A zscan5a Z ZS ZSC ZSCA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 3 no 0 8 0 0 0 0 1 +CNS-Menin (Oncogenic) cns-menin C CN CNS CNS- BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 4 -() 3 10 0 1 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 4 no 0 10 0 0 0 0 1 +5 5 5 5 5 5 5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 4 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 4 no 0 10 0 1 0 0 1 +15 15 15 1 15 15 15 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 4 no 0 2 0 1 0 0 1 +Clonal (NA) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 4 () 2 8 0 1 0 0 1 +Clonal (early) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 4 () 2 10 0 1 0 0 1 +Clonal (late) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 4 () 2 9 0 1 0 0 1 +Subclonal Subclonal subclonal S Su Sub Subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 4 no 0 6 0 1 0 0 1 +NA NA na N NA NA NA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 9 4 no 0 2 0 1 0 0 1 +KIT KIT kit K KI KIT KIT BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP NODIGIT 0 1 1 0 0 0 0 0 9 5 no 0 6 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 5 no 0 8 0 0 0 0 1 +MUC20 MUC20 muc20 M MU MUC MUC2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 5 no 0 10 0 0 0 0 1 +NRAS NRAS nras N NR NRA NRAS BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 5 no 0 8 0 0 0 0 1 +RAC1 RAC1 rac1 R RA RAC RAC1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 5 no 0 8 0 0 0 0 1 +BIRC6 BIRC6 birc6 B BI BIR BIRC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 5 no 0 10 0 0 0 0 1 +KLF4 KLF4 klf4 K KL KLF KLF4 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 5 no 0 8 0 0 0 0 1 +EP300 EP300 ep300 E EP EP3 EP30 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 5 no 0 10 0 0 0 0 1 +SPEN SPEN spen S SP SPE SPEN BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 5 no 0 8 0 0 0 0 1 +Testis-GCT (Oncogenic) testis-gct T Te Tes Test BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 6 -() 3 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +4 4 4 4 4 4 4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +6 6 6 6 6 6 6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +8 8 8 8 8 8 8 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 6 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 6 no 0 2 0 0 0 0 1 +Clonal (NA) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 6 () 2 8 0 0 0 0 1 +Clonal (early) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 6 () 2 10 0 0 0 0 1 +Clonal (late) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 6 () 2 9 0 0 0 0 1 +Subclonal Subclonal subclonal S Su Sub Subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 6 no 0 6 0 0 0 0 1 +NA NA na N NA NA NA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 9 6 no 0 2 0 0 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 6 0 0 0 0 1 +CIC CIC cic C CI CIC CIC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 7 no 0 5 0 0 0 0 1 +FUBP1 FUBP1 fubp1 F FU FUB FUBP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 7 0 0 0 0 1 +NIPBL NIPBL nipbl N NI NIP NIPB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 7 no 0 7 0 0 0 0 1 +NOTCH1 NOTCH1 notch1 N NO NOT NOTC BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 8 0 0 0 0 1 +IDH2 IDH2 idh2 I ID IDH IDH2 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 6 0 0 0 0 1 +TCF12 TCF12 tcf12 T TC TCF TCF1 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 7 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 8 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 8 0 0 0 0 1 +SMARCA4 SMARCA4 smarca4 S SM SMA SMAR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 10 0 0 0 0 1 +ZBTB20 ZBTB20 zbtb20 Z ZB ZBT ZBTB BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 8 0 0 0 0 1 +ATRX ATRX atrx A AT ATR ATRX BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 7 no 0 6 0 0 0 0 1 +BCOR BCOR bcor B BC BCO BCOR BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 7 no 0 6 0 0 0 0 1 +PBRM1 PBRM1 pbrm1 P PB PBR PBRM BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 7 no 0 7 0 0 0 0 1 +CNS-Oligo (Oncogenic) cns-oligo C CN CNS CNS- BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 8 -() 3 10 0 0 0 0 1 +0 0 0 0 0 0 0 BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +10 10 10 1 10 10 10 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +20 20 20 2 20 20 20 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 8 no 0 10 0 0 0 0 1 +30 30 30 3 30 30 30 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 9 no 0 10 0 0 0 0 1 +40 40 40 4 40 40 40 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +Clonal (NA) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 8 0 0 0 0 1 +Clonal (early) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 10 0 0 0 0 1 +Clonal (late) clonal C Cl Clo Clon BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 () 2 9 0 0 0 0 1 +Subclonal Subclonal subclonal S Su Sub Subc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 9 9 no 0 6 0 0 0 0 1 +NA NA na N NA NA NA BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 9 9 no 0 2 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 9 .. 2 10 0 0 0 0 1 +driver genes driver d dr dri driv BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 9 9 :);););). 9 7 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 9 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 9 0 ://././--- 10 10 0 1 0 0 1 +RUNX1 RUNX1 runx1 R RU RUN RUNX BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +IFNG IFNG ifng I IF IFN IFNG BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +PRKCD PRKCD prkcd P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +ASXL1 ASXL1 asxl1 A AS ASX ASXL BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +APC APC apc A AP APC APC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +HNF4A HNF4A hnf4a H HN HNF HNF4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +PRKCI PRKCI prkci P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +HDAC6 HDAC6 hdac6 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +CDK1 CDK1 cdk1 C CD CDK CDK1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +HLA-B HLA-B hla-b H HL HLA HLA- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 - 1 10 0 1 0 0 1 +BTK BTK btk B BT BTK BTK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +BCL2 BCL2 bcl2 B BC BCL BCL2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +MT-ND4 MT-ND4 mt-nd4 M MT MT- MT-N BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 - 1 10 0 0 0 0 1 +ERBB4 ERBB4 erbb4 E ER ERB ERBB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +PLG PLG plg P PL PLG PLG BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 0 no 0 10 0 0 0 0 1 +ALK ALK alk A AL ALK ALK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +BCL9 BCL9 bcl9 B BC BCL BCL9 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +SPTA1 SPTA1 spta1 S SP SPT SPTA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +EP300 EP300 ep300 E EP EP3 EP30 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +KIT KIT kit K KI KIT KIT BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 1 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +AMER1 AMER1 amer1 A AM AME AMER BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +PIK3CB PIK3CB pik3cb P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +MC4R MC4R mc4r M MC MC4 MC4R BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 7 0 1 0 0 1 +TNRC6B TNRC6B tnrc6b T TN TNR TNRC BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +CDK2 CDK2 cdk2 C CD CDK CDK2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +ESR1 ESR1 esr1 E ES ESR ESR1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +MAPK11 MAPK11 mapk11 M MA MAP MAPK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +THRB THRB thrb T TH THR THRB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +PSMA3 PSMA3 psma3 P PS PSM PSMA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 1 0 0 1 +RPS27 RPS27 rps27 R RP RPS RPS2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +TOP2B TOP2B top2b T TO TOP TOP2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +ARID1A ARID1A arid1a A AR ARI ARID BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +ERBB2 ERBB2 erbb2 E ER ERB ERBB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +MAPK14 MAPK14 mapk14 M MA MAP MAPK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +BCR BCR bcr B BC BCR BCR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +RPL13 RPL13 rpl13 R RP RPL RPL1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +FRK FRK frk F FR FRK FRK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +MAP3K21 MAP3K21 map3k21 M MA MAP MAP3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +AKT1 AKT1 akt1 A AK AKT AKT1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 1 no 0 10 0 0 0 0 1 +MTOR MTOR mtor M MT MTO MTOR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +SMG1 SMG1 smg1 S SM SMG SMG1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +TOP1 TOP1 top1 T TO TOP TOP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +NTRK1 NTRK1 ntrk1 N NT NTR NTRK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +PTGIR PTGIR ptgir P PT PTG PTGI BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +PPARD PPARD ppard P PP PPA PPAR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +CHEK1 CHEK1 chek1 C CH CHE CHEK BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +MAP3K1 MAP3K1 map3k1 M MA MAP MAP3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +HDAC9 HDAC9 hdac9 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +TOP2A TOP2A top2a T TO TOP TOP2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +INSR INSR insr I IN INS INSR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 9 2 no 0 10 0 0 0 0 1 +GLP1R GLP1R glp1r G GL GLP GLP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 9 2 no 0 10 0 1 0 0 1 +ACVR2A ACVR2A acvr2a A AC ACV ACVR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +ATM ATM atm A AT ATM ATM BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +MMP1 MMP1 mmp1 M MM MMP MMP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +CYP17A1 CYP17A1 cyp17a1 C CY CYP CYP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +VDR VDR vdr V VD VDR VDR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +RET RET ret R RE RET RET BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +SYK SYK syk S SY SYK SYK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +PPARA PPARA ppara P PP PPA PPAR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +SRC SRC src S SR SRC SRC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +CTNNB1 CTNNB1 ctnnb1 C CT CTN CTNN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +CYP11A1 CYP11A1 cyp11a1 C CY CYP CYP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +CDK4 CDK4 cdk4 C CD CDK CDK4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +PDGFRA PDGFRA pdgfra P PD PDG PDGF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +MAP3K11 MAP3K11 map3k11 M MA MAP MAP3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +ITK ITK itk I IT ITK ITK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +CTNND1 CTNND1 ctnnd1 C CT CTN CTNN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +TCF7L2 TCF7L2 tcf7l2 T TC TCF TCF7 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +IL6 IL6 il6 I IL IL6 IL6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +RARG RARG rarg R RA RAR RARG BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +KDR KDR kdr K KD KDR KDR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +GCGR GCGR gcgr G GC GCG GCGR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 10 0 1 0 0 1 +SMAD1 SMAD1 smad1 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +PRKCA PRKCA prkca P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +RAF1 RAF1 raf1 R RA RAF RAF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +RPLP0 RPLP0 rplp0 R RP RPL RPLP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +EEF2 EEF2 eef2 E EE EEF EEF2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +FLT3 FLT3 flt3 F FL FLT FLT3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +ZFP36L2 ZFP36L2 zfp36l2 Z ZF ZFP ZFP3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 1 0 0 1 +OLIG2 OLIG2 olig2 O OL OLI OLIG BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +CSNK1A1 CSNK1A1 csnk1a1 C CS CSN CSNK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +NR3C1 NR3C1 nr3c1 N NR NR3 NR3C BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +RARB RARB rarb R RA RAR RARB BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 no 0 8 0 0 0 0 1 +ADRB3 ADRB3 adrb3 A AD ADR ADRB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 1 0 0 1 +TGFBR1 TGFBR1 tgfbr1 T TG TGF TGFB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +ROCK1 ROCK1 rock1 R RO ROC ROCK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +HDAC1 HDAC1 hdac1 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +CSNK1E CSNK1E csnk1e C CS CSN CSNK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +HLA-A HLA-A hla-a H HL HLA HLA- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +HDAC4 HDAC4 hdac4 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +MGAM MGAM mgam M MG MGA MGAM BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +EPHA2 EPHA2 epha2 E EP EPH EPHA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +MTNR1B MTNR1B mtnr1b M MT MTN MTNR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 1 0 0 1 +CHD4 CHD4 chd4 C CH CHD CHD4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +PRKCE PRKCE prkce P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +JAK2 JAK2 jak2 J JA JAK JAK2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +PRKD1 PRKD1 prkd1 P PR PRK PRKD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +NCF1 NCF1 ncf1 N NC NCF NCF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +WEE1 WEE1 wee1 W WE WEE WEE1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +HTR6 HTR6 htr6 H HT HTR HTR6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 1 0 0 1 +PABPC1 PABPC1 pabpc1 P PA PAB PABP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 1 0 0 1 +ABL1 ABL1 abl1 A AB ABL ABL1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +TYMS TYMS tyms T TY TYM TYMS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +ESR2 ESR2 esr2 E ES ESR ESR2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +IL1R1 IL1R1 il1r1 I IL IL1 IL1R BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +AVPR2 AVPR2 avpr2 A AV AVP AVPR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 1 0 0 1 +IDH1 IDH1 idh1 I ID IDH IDH1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +PCBP1 PCBP1 pcbp1 P PC PCB PCBP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 4 no 0 10 0 1 0 0 1 +EGFR EGFR egfr E EG EGF EGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +FYN FYN fyn F FY FYN FYN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +LCK LCK lck L LC LCK LCK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 no 0 10 0 0 0 0 1 +PAK1 PAK1 pak1 P PA PAK PAK1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +AXL AXL axl A AX AXL AXL BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +PEX5 PEX5 pex5 P PE PEX PEX5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +EZH2 EZH2 ezh2 E EZ EZH EZH2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +TP53 TP53 tp53 T TP TP5 TP53 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +YES1 YES1 yes1 Y YE YES YES1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +PGR PGR pgr P PG PGR PGR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +VEGFA VEGFA vegfa V VE VEG VEGF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +ADORA1 ADORA1 adora1 A AD ADO ADOR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 1 0 0 1 +BLK BLK blk B BL BLK BLK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +DDB1 DDB1 ddb1 D DD DDB DDB1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +JUN JUN jun J JU JUN JUN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 1 0 0 10 5 no 0 10 0 0 0 0 1 +CYP19A1 CYP19A1 cyp19a1 C CY CYP CYP1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +CSF1R CSF1R csf1r C CS CSF CSF1 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 7 0 0 0 0 1 +EPCAM EPCAM epcam E EP EPC EPCA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +OXTR OXTR oxtr O OX OXT OXTR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +SMARCA4 SMARCA4 smarca4 S SM SMA SMAR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +DUSP16 DUSP16 dusp16 D DU DUS DUSP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +CREBBP CREBBP crebbp C CR CRE CREB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +IKBKB IKBKB ikbkb I IK IKB IKBK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +GNAS GNAS gnas G GN GNA GNAS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +TSHR TSHR tshr T TS TSH TSHR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 no 0 8 0 0 0 0 1 +SSTR2 SSTR2 sstr2 S SS SST SSTR BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +TUBB TUBB tubb T TU TUB TUBB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +SMN1 SMN1 smn1 S SM SMN SMN1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 5 no 0 10 0 0 0 0 1 +NRAS NRAS nras N NR NRA NRAS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +XPO1 XPO1 xpo1 X XP XPO XPO1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +ADRB2 ADRB2 adrb2 A AD ADR ADRB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +FLT1 FLT1 flt1 F FL FLT FLT1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +GNRHR GNRHR gnrhr G GN GNR GNRH BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +LYN LYN lyn L LY LYN LYN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +SMN2 SMN2 smn2 S SM SMN SMN2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +AR AR ar A AR AR AR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +HDAC3 HDAC3 hdac3 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +HSP90AA1 HSP90AA1 hsp90aa1 H HS HSP HSP9 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +ALOX12 ALOX12 alox12 A AL ALO ALOX BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +PDPK1 PDPK1 pdpk1 P PD PDP PDPK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +RPL14 RPL14 rpl14 R RP RPL RPL1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +FAM83B FAM83B fam83b F FA FAM FAM8 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +MAP2K2 MAP2K2 map2k2 M MA MAP MAP2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +ZBTB7A ZBTB7A zbtb7a Z ZB ZBT ZBTB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +IGF1R IGF1R igf1r I IG IGF IGF1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +MAP2K4 MAP2K4 map2k4 M MA MAP MAP2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +PIK3CG PIK3CG pik3cg P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +IL2 IL2 il2 I IL IL2 IL2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +RNF43 RNF43 rnf43 R RN RNF RNF4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +MAP2K1 MAP2K1 map2k1 M MA MAP MAP2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +PAK4 PAK4 pak4 P PA PAK PAK4 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +ABCB1 ABCB1 abcb1 A AB ABC ABCB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +RXRA RXRA rxra R RX RXR RXRA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +ACVR1 ACVR1 acvr1 A AC ACV ACVR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +RPS20 RPS20 rps20 R RP RPS RPS2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +RRM2B RRM2B rrm2b R RR RRM RRM2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +FNTA FNTA fnta F FN FNT FNTA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +PARP1 PARP1 parp1 P PA PAR PARP BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +MME MME mme M MM MME MME BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +TGIF1 TGIF1 tgif1 T TG TGI TGIF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +PTK6 PTK6 ptk6 P PT PTK PTK6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +UBE2N UBE2N ube2n U UB UBE UBE2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +BCL9L BCL9L bcl9l B BC BCL BCL9 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +FNTB FNTB fntb F FN FNT FNTB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +DNMT1 DNMT1 dnmt1 D DN DNM DNMT BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +MET MET met M ME MET MET BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 1 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +DRD1 DRD1 drd1 D DR DRD DRD1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +FGFR2 FGFR2 fgfr2 F FG FGF FGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +RPS6 RPS6 rps6 R RP RPS RPS6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +MGA MGA mga M MG MGA MGA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +PRKCQ PRKCQ prkcq P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +PPARG PPARG pparg P PP PPA PPAR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +SMAD2 SMAD2 smad2 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +TBXA2R TBXA2R tbxa2r T TB TBX TBXA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 1 0 0 1 +FGFR3 FGFR3 fgfr3 F FG FGF FGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +RPS26 RPS26 rps26 R RP RPS RPS2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +ARID1B ARID1B arid1b A AR ARI ARID BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +TGFB1 TGFB1 tgfb1 T TG TGF TGFB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +GSK3B GSK3B gsk3b G GS GSK GSK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +HCK HCK hck H HC HCK HCK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +FGFR1 FGFR1 fgfr1 F FG FGF FGFR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +JAK3 JAK3 jak3 J JA JAK JAK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +RPS27A RPS27A rps27a R RP RPS RPS2 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PSPC1 PSPC1 pspc1 P PS PSP PSPC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +BRAF BRAF braf B BR BRA BRAF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +CDK9 CDK9 cdk9 C CD CDK CDK9 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +MMP7 MMP7 mmp7 M MM MMP MMP7 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +RPS3 RPS3 rps3 R RP RPS RPS3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +CDK6 CDK6 cdk6 C CD CDK CDK6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +ADORA2A ADORA2A adora2a A AD ADO ADOR BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 1 0 0 1 +HDAC2 HDAC2 hdac2 H HD HDA HDAC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +KRAS KRAS kras K KR KRA KRAS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +SMAD3 SMAD3 smad3 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PLK1 PLK1 plk1 P PL PLK PLK1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PDGFRB PDGFRB pdgfrb P PD PDG PDGF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PIK3CA PIK3CA pik3ca P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PRKCZ PRKCZ prkcz P PR PRK PRKC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PTGER4 PTGER4 ptger4 P PT PTG PTGE BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 1 0 0 1 +FBXW7 FBXW7 fbxw7 F FB FBX FBXW BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +PIK3CD PIK3CD pik3cd P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +SMAD4 SMAD4 smad4 S SM SMA SMAD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +CSNK2A1 CSNK2A1 csnk2a1 C CS CSN CSNK BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PTEN PTEN pten P PT PTE PTEN BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +RPS6KB1 RPS6KB1 rps6kb1 R RP RPS RPS6 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PARP2 PARP2 parp2 P PA PAR PARP BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 7 0 0 0 0 1 +PTGER2 PTGER2 ptger2 P PT PTG PTGE BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 1 0 0 1 +SIN3A SIN3A sin3a S SI SIN SIN3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +ERBB3 ERBB3 erbb3 E ER ERB ERBB BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +TNF TNF tnf T TN TNF TNF BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PRKDC PRKDC prkdc P PR PRK PRKD BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +SOX9 SOX9 sox9 S SO SOX SOX9 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +JAK1 JAK1 jak1 J JA JAK JAK1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PTGS2 PTGS2 ptgs2 P PT PTG PTGS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +TNNC1 TNNC1 tnnc1 T TN TNN TNNC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +EPAS1 EPAS1 epas1 E EP EPA EPAS BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PIK3R1 PIK3R1 pik3r1 P PI PIK PIK3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +RBM10 RBM10 rbm10 R RB RBM RBM1 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +CDK5 CDK5 cdk5 C CD CDK CDK5 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +RARA RARA rara R RA RAR RARA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +CCND1 CCND1 ccnd1 C CC CCN CCND BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +ELF3 ELF3 elf3 E EL ELF ELF3 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +TUBA1B TUBA1B tuba1b T TU TUB TUBA BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +PNRC2 PNRC2 pnrc2 P PN PNR PNRC BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 9 no 0 10 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 10 .. 2 9 0 0 0 0 1 +Nodes acting nodes N No Nod Node BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 10 -. 2 10 0 0 0 0 1 +are as are a ar are are BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 10 :,;, 4 9 0 0 0 0 1 +green contiguous green g gr gre gree BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 10 10 ;,;, 4 9 0 0 0 0 1 +zigzag; direct zigzag; z zi zig zigz BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 11 ;,;-, 5 10 0 0 0 0 1 +line; direct line; l li lin line BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 11 ;-,;, 5 9 0 0 0 0 1 +contiguous arrow; contiguous c co con cont BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 11 ;,. 3 9 0 0 0 0 1 +using Cytoscape using u us usi usin BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 11 . 1 2 0 0 0 0 1 +Nature Genetics nature N Na Nat Natu BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 no 0 10 0 1 1 0 0 +Article Article article A Ar Art Arti BLOCKSTART PAGEIN NEWFONT HIGHERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 no 0 10 0 1 0 0 1 +https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 https://doi.org/10.1038/s41588-024-01785-9 h ht htt http BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 NOCAPS CONTAINSDIGITS 0 0 0 0 1 0 0 1 10 0 ://././--- 10 10 0 1 0 0 1 +Connective-SS Connective-SS connective-ss C Co Con Conn BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 1 - 1 10 0 0 0 0 1 +CNS-GBM-IDHmut CNS-GBM-IDHmut cns-gbm-idhmut C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 1 -- 2 10 0 0 0 0 1 +Connective-Leiomyo Connective-Leiomyo connective-leiomyo C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 1 - 1 10 0 0 0 0 1 +CNS-Oligo CNS-Oligo cns-oligo C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 1 - 1 10 0 0 0 0 1 +CNS-Astro CNS-Astro cns-astro C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 1 - 1 10 0 0 0 0 1 +Lung-SmallCell Lung-SmallCell lung-smallcell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 - 1 10 0 0 0 0 1 +Kidney-ChRCC Kidney-ChRCC kidney-chrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 - 1 10 0 0 0 0 1 +CNS-GBM-IDHwt CNS-GBM-IDHwt cns-gbm-idhwt C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 -- 2 10 0 0 0 0 1 +Bladder-TCC Bladder-TCC bladder-tcc B Bl Bla Blad BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 - 1 10 0 0 0 0 1 +CNS-Menin CNS-Menin cns-menin C CN CNS CNS- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 2 - 1 10 0 0 0 0 1 +Lung-LargeCell Lung-LargeCell lung-largecell L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 - 1 10 0 0 0 0 1 +Kidney-PRCC Kidney-PRCC kidney-prcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 - 1 10 0 0 0 0 1 +Liver-HCC Liver-HCC liver-hcc L Li Liv Live BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 - 1 10 0 0 0 0 1 +Connective-Osteosarc Connective-Osteosarc connective-osteosarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 - 1 10 0 0 0 0 1 +Uterus-AdenoCA Uterus-AdenoCA uterus-adenoca U Ut Ute Uter BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 3 - 1 10 0 0 0 0 1 +Connective-Liposarc Connective-Liposarc connective-liposarc C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Ovary-AdenoCA Ovary-AdenoCA ovary-adenoca O Ov Ova Ovar BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Connective-SCS Connective-SCS connective-scs C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Connective-Chondro Connective-Chondro connective-chondro C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Connective-Myxofibro Connective-Myxofibro connective-myxofibro C Co Con Conn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Skin-Melanoma Skin-Melanoma skin-melanoma S Sk Ski Skin BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 4 - 1 10 0 0 0 0 1 +Prost-AdenoCA Prost-AdenoCA prost-adenoca P Pr Pro Pros BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 - 1 10 0 0 0 0 1 +Kidney-CCRCC Kidney-CCRCC kidney-ccrcc K Ki Kid Kidn BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 - 1 10 0 0 0 0 1 +Breast-DuctalCA Breast-DuctalCA breast-ductalca B Br Bre Brea BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 - 1 10 0 0 0 0 1 +ColoRect-AdenoCA ColoRect-AdenoCA colorect-adenoca C Co Col Colo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 - 1 10 0 0 0 0 1 +Testis-GCT Testis-GCT testis-gct T Te Tes Test BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 5 - 1 10 0 0 0 0 1 +Breast-LobularCA Breast-LobularCA breast-lobularca B Br Bre Brea BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 - 1 10 0 0 0 0 1 +Eso-AdenoCA Eso-AdenoCA eso-adenoca E Es Eso Eso- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 - 1 10 0 0 0 0 1 +Mes-Mesothelioma Mes-Mesothelioma mes-mesothelioma M Me Mes Mes- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 - 1 10 0 1 0 0 1 +Stomach-AdenoCA Stomach-AdenoCA stomach-adenoca S St Sto Stom BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 - 1 10 0 1 0 0 1 +Lung-SCC Lung-SCC lung-scc L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 6 - 1 10 0 1 0 0 1 +HeadNeck-SCC HeadNeck-SCC headneck-scc H He Hea Head BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 - 1 10 0 1 0 0 1 +BileDuct-AdenoCA BileDuct-AdenoCA bileduct-adenoca B Bi Bil Bile BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 - 1 10 0 1 0 0 1 +Lung-AdenoCA Lung-AdenoCA lung-adenoca L Lu Lun Lung BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 - 1 10 0 1 0 0 1 +Panc-AdenoCA Panc-AdenoCA panc-adenoca P Pa Pan Panc BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 - 1 10 0 1 0 0 1 +0.00 0.00 0.00 0 0. 0.0 0.00 BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 . 1 10 0 0 0 0 1 +0.25 0.25 0.25 0 0. 0.2 0.25 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 . 1 10 0 0 0 0 1 +0.50 0.50 0.50 0 0. 0.5 0.50 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 . 1 10 0 0 0 0 1 +0.75 0.75 0.75 0 0. 0.7 0.75 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 . 1 10 0 0 0 0 1 +1.00 1.00 1.00 1 1. 1.0 1.00 BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 0 0 0 0 10 7 . 1 10 0 0 0 0 1 +Tumour Purity tumour T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +Tumour Group tumour T Tu Tum Tumo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 8 no 0 10 0 0 0 0 1 +Extended Data extended E Ex Ext Exte BLOCKSTART PAGEIN NEWFONT LOWERFONT 1 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 9 ... 3 10 0 0 0 0 1 +the lowest the t th the the BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 1 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 9 .. 2 6 0 0 0 0 1 +1 1 1 1 1 1 1 BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 10 0 no 0 10 0 1 0 0 0 +nature portfolio nature n na nat natu BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 0 no 0 10 1 0 1 1 0 +April 2023 april A Ap Apr Apri BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 1 0 0 0 1 0 0 10 0 no 0 10 0 0 0 0 0 +Corresponding author(s): corresponding C Co Cor Corr BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 (): 3 10 1 1 0 0 1 +Last updated last L La Las Last BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 ():, 4 10 1 1 0 0 1 +Reporting Summary reporting R Re Rep Repo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 10 0 no 0 10 1 0 0 0 1 +Nature Portfolio nature N Na Nat Natu BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 . 1 10 1 0 0 0 1 +in reporting. in i in in in BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 10 0 .,. 3 8 1 0 0 0 1 +Statistics Statistics statistics S St Sta Stat BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 1 no 0 10 0 0 0 0 1 +For all for F Fo For For BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 1 ,,,,. 5 10 0 0 0 0 1 +n/a Confirmed n/a n n/ n/a n/a BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 1 / 1 10 0 0 0 0 1 +The exact the T Th The The BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 1 ()/, 4 10 0 0 0 0 1 +A statement a A A A A BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 10 2 no 0 10 0 0 0 0 1 +The statistical the T Th The The BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 2 ()-- 4 10 0 0 0 0 1 +Only common only O On Onl Only BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 2 ;. 2 10 0 0 0 0 1 +A description a A A A A BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 10 3 no 0 10 0 0 0 0 1 +A description a A A A A BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 10 3 , 1 10 0 0 0 0 1 +A full a A A A A BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 1 0 1 0 0 0 0 0 10 3 (..)(..) 8 10 0 0 0 0 1 +AND variation and A AN AND AND BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 1 0 0 0 0 0 10 3 (..)(..) 8 7 0 0 0 0 1 +For null for F Fo For For BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 4 ,(..,,),, 9 10 0 0 0 0 1 +Give P give G Gi Giv Give BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 5 . 1 10 0 0 0 0 1 +For Bayesian for F Fo For For BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 5 , 1 10 0 0 0 0 1 +For hierarchical for F Fo For For BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 5 , 1 10 0 0 0 0 1 +Estimates of estimates E Es Est Esti BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 5 (..','), 8 10 0 0 0 0 1 +Our web our O Ou Our Our BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 6 . 1 10 0 0 0 0 1 +Software and software S So Sof Soft BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +Policy information policy P Po Pol Poli BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 6 no 0 10 0 0 0 0 1 +Data collection data D Da Dat Data BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 6 . 1 10 0 0 0 0 1 +Research Environment research R Re Res Rese BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 10 7 /////. 6 10 0 0 0 0 1 +Data analysis data D Da Dat Data BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 7 no 0 10 0 0 0 0 1 +Details and details D De Det Deta BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 7 (://..///.). 12 10 0 0 0 0 1 +to perform to t to to to BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 7 //// 4 9 0 0 0 0 1 +code/. The code/. c co cod code BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 /.:// 5 8 0 0 0 0 1 +www.genomicsengland.co.uk/research/academic/join-gecip. The www.genomicsengland.co.uk/research/academic/join-gecip. w ww www www. BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 ...///-. 8 9 0 0 0 0 1 +Zenodo (https://zenodo.org/record/8329054). zenodo Z Ze Zen Zeno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 (://.//). 9 3 0 0 0 0 1 +Additional packages/softwware additional A Ad Add Addi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 7 /: 2 2 0 0 0 0 1 +VerifyBamID v1.1.3 verifybamid V Ve Ver Veri BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 ..://.// 8 4 0 0 0 0 1 +Ccube v1 ccube C Cc Ccu Ccub BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 ://.// 6 3 0 0 0 0 1 +Isaac aligner isaac I Is Isa Isaa BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 0 0 0 0 0 0 10 7 ...://.// 9 4 0 0 0 0 1 +Strelka v2.4.7 strelka S St Str Stre BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 ..://.// 8 3 0 0 0 0 1 +bcftools v1.9 bcftools b bc bcf bcft BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 .://..//. 9 4 0 0 0 0 1 +alleleCount-FixVAF v4.1.0 allelecount-fixvaf a al all alle BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 -..://.//- 10 5 0 0 0 0 1 +VEP v101 vep V VE VEP VEP BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 ://.//- 7 3 0 0 0 0 1 +CADD v1.6 cadd C CA CAD CADD BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 1 0 0 0 0 0 0 10 7 .://.//-/ 9 3 0 0 0 0 1 +OncoKb v3.11 oncokb O On Onc Onco BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 .://../- 8 3 0 0 0 0 1 +trackViewer v1.38.2 trackviewer t tr tra trac BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 ..://.// 8 4 0 0 0 0 1 +mSINGS = msings m mS mSI mSIN BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 7 ://.///// 9 4 0 0 0 0 1 +HRDetect = hrdetect H HR HRD HRDe BLOCKEND PAGEEND SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 7 ://.//- 7 3 0 0 0 0 1 +2 2 2 2 2 2 2 BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 10 0 no 0 10 0 1 0 0 0 +nature portfolio nature n na nat natu BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 0 no 0 10 0 0 1 0 0 +April 2023 april A Ap Apr Apri BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 1 0 0 0 1 0 0 10 0 no 0 10 0 0 0 0 0 +Battenberg v2.2.8 battenberg B Ba Bat Batt BLOCKSTART PAGEIN NEWFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 0 ..://./-/ 9 8 0 1 0 0 1 +Delly v0.7.9= delly D De Del Dell BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 0 0 0 0 0 0 10 0 ..://.// 8 7 0 1 0 0 1 +Lumpy v0.2.13 lumpy L Lu Lum Lump BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 0 ..://.//-/ 10 8 0 1 0 0 1 +Manta v1.5.0 manta M Ma Man Mant BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 0 ..://.// 8 6 0 1 0 0 1 +GATK v.4.4.0 gatk G GA GAT GATK BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 0 ...://.// 9 7 0 1 0 0 1 +BEDOPS v2.4.2 bedops B BE BED BEDO BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 10 0 ..://.// 8 6 0 1 0 0 1 +bedtools v2.3.0 bedtools b be bed bedt BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 10 0 ..://..///. 11 10 0 1 0 0 1 +MutationTimeR v0.99.2 mutationtimer M Mu Mut Muta BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 10 0 ..://./-/ 9 9 0 1 0 0 1 +For manuscripts for F Fo For For BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 10 1 , 1 10 0 0 0 0 1 +reviewers. We reviewers. r re rev revi BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 10 1 .(..).. 7 9 0 0 0 0 1 +Data Data data D Da Dat Data BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 2 no 0 10 0 0 0 0 1 +Policy information policy P Po Pol Poli BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 2 no 0 3 0 0 0 0 1 +All manuscripts all A Al All All BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 2 .,: 3 10 0 0 0 0 1 +-Accession codes, -accession - -A -Ac -Acc BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 2 -,, 3 8 0 0 0 0 1 +-A description -a - -A -A -A BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 ALLCAP NODIGIT 0 0 0 0 0 0 0 0 11 2 - 1 5 0 0 0 0 1 +-For clinical -for - -F -Fo -For BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 2 -, 2 10 0 0 0 0 1 +Summary statistics summary S Su Sum Summ BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 3 .- 2 9 0 0 0 0 1 +specific WGS specific s sp spe spec BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 , 1 9 0 0 0 0 1 +Partnership (GeCIP) partnership P Pa Par Part BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 3 ()'(://...//-). 15 9 0 0 0 0 1 +a member a a a a a BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 1 0 1 0 0 0 0 0 11 3 ://...///-. 11 9 0 0 0 0 1 +process involves process p pr pro proc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 ,',, 4 10 0 0 0 0 1 +approval by approval a ap app appr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 .://...//. 10 8 0 0 0 0 1 +agreement can agreement a ag agr agre BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 ://./////. 10 9 0 0 0 0 1 +place within place p pl pla plac BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 11 3 (://.../-/)., 13 8 0 0 0 0 1 +publication policies publication p pu pub publ BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 ://.../-/. 10 8 0 0 0 0 1 +Genomics England genomics G Ge Gen Geno BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 3 /////.- 7 9 0 0 0 0 1 +available at available a av ava avai BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 /////.:// 9 8 0 0 0 0 1 +cancer.sanger.ac.uk/actionability and cancer.sanger.ac.uk/actionability c ca can canc BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 3 .../://../#,. 13 9 0 0 0 0 1 +https://cansar.ai/. The https://cansar.ai/. h ht htt http BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 1 11 3 ://./.://...//---/. 19 9 0 0 0 0 1 +drivers from drivers d dr dri driv BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 3 (://...//),(://../) 19 9 0 0 0 0 1 +Genome Atlas genome G Ge Gen Geno BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 3 ()-.. 5 9 0 0 0 0 1 +Research involving research R Re Res Rese BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 11 8 ,, 2 10 0 0 0 0 1 +Policy information policy P Po Pol Poli BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 .,(/), 6 10 0 0 0 0 1 +and sexual and a an and and BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 8 ,. 2 3 0 0 0 0 1 +Reporting on reporting R Re Rep Repo BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Sex was sex S Se Sex Sex BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 ,/ 2 10 0 0 0 0 1 +sequencing. Where sequencing. s se seq sequ BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 8 .. 2 5 0 0 0 0 1 +Reporting on reporting R Re Rep Repo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 11 9 ,, 2 10 0 0 0 0 1 +other socially other o ot oth othe BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 9 no 0 7 0 0 0 0 1 +groupings groupings groupings g gr gro grou BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 9 no 0 3 0 0 0 0 1 +Reported race, reported R Re Rep Repo BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 ,,. 3 10 0 0 0 0 1 +Population characteristics population P Po Pop Popu BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 no 0 10 0 0 0 0 1 +Information relating information I In Inf Info BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 . 1 10 0 0 0 0 1 +treatment information treatment t tr tre trea BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 9 . 1 4 0 0 0 0 1 +Recruitment Recruitment recruitment R Re Rec Recr BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 no 0 10 0 0 0 0 1 +Clinical and clinical C Cl Cli Clin BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 (),' 4 10 0 0 0 0 1 +and Analysis and a an and and BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 9 (-)() 5 9 0 0 0 0 1 +Environment. Environment. environment. E En Env Envi BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 9 . 1 1 0 0 0 0 1 +Ethics oversight ethics E Et Eth Ethi BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 no 0 10 0 0 0 0 1 +The 100,000 the T Th The The BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 , 1 10 0 0 0 0 1 +Committee on committee C Co Com Comm BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 ,// 3 5 0 0 0 0 1 +Note that note N No Not Note BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 . 1 10 0 0 0 0 1 +Field-specific reporting field-specific F Fi Fie Fiel BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 - 1 10 0 0 0 0 1 +Please select please P Pl Ple Plea BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 .,. 3 10 0 0 0 0 1 +Life sciences life L Li Lif Life BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 no 0 2 0 0 0 0 1 +Behavioural & behavioural B Be Beh Beha BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 11 no 0 6 0 0 0 0 1 +Ecological, evolutionary ecological, E Ec Eco Ecol BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 , 1 10 0 0 0 0 1 +For a for F Fo For For BLOCKSTART PAGEEND SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 ,.//---. 8 10 0 1 0 0 1 +3 3 3 3 3 3 3 BLOCKSTART PAGESTART NEWFONT HIGHERFONT 0 0 NOCAPS ALLDIGIT 1 0 0 0 0 0 0 0 11 0 no 0 10 0 1 0 0 0 +nature portfolio nature n na nat natu BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 0 no 0 10 0 0 1 0 0 +April 2023 april A Ap Apr Apri BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 1 0 0 0 1 0 0 11 0 no 0 10 0 0 0 0 0 +Life sciences life L Li Lif Life BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 0 no 0 10 0 1 0 0 1 +All studies all A Al All All BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 0 . 1 10 0 1 0 0 1 +Sample size sample S Sa Sam Samp BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 11 0 no 0 10 0 1 0 0 1 +10,478 samples 10,478 1 10 10, 10,4 BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 ALLCAP CONTAINSDIGITS 0 0 0 0 1 0 0 0 11 0 ,.. 3 10 0 1 0 0 1 +chosen based chosen c ch cho chos BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 0 /. 2 9 0 1 0 0 1 +Data exclusions data D Da Dat Data BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 1 . 1 10 0 0 0 0 1 +samples were samples s sa sam samp BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS NODIGIT 0 1 1 0 0 0 0 0 11 1 . 1 9 0 0 0 0 1 +the clinical the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 (,,-,).,/,(.) 13 9 0 0 0 0 1 +on availability on o on on on BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 ,,, 3 10 0 0 0 0 1 +18 years 18 1 18 18 18 BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS ALLDIGIT 0 0 0 0 0 0 0 0 11 1 ./(.) 5 9 0 0 0 0 1 +tumour sample tumour t tu tum tumo BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 ., 2 8 0 0 0 0 1 +represented more represented r re rep repr BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 . 1 9 0 0 0 0 1 +individual, we individual, i in ind indi BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 ,.-. 4 9 0 0 0 0 1 +these criteria, these t th the thes BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 1 ,,. 3 4 0 0 0 0 1 +Replication Replication replication R Re Rep Repl BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 4 no 0 10 0 0 0 0 1 +This study this T Th Thi This BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 4 ,, 2 10 0 0 0 0 1 +great majority great g gr gre grea BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 4 .. 2 9 0 0 0 0 1 +Randomization This randomization R Ra Ran Rand BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 5 . 1 10 0 0 0 0 1 +Blinding Blinding blinding B Bl Bli Blin BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 5 no 0 10 0 0 0 0 1 +This study this T Th Thi This BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 6 -., 3 10 0 0 0 0 1 +and processing and a an and and BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 6 . 1 4 0 0 0 0 1 +Reporting for reporting R Re Rep Repo BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 1 1 0 0 0 0 0 11 6 , 1 10 0 0 0 0 1 +We require we W We We We BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 6 ,.,, 4 9 0 0 0 0 1 +system or system s sy sys syst BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 0 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 6 .,. 3 10 0 0 0 0 1 +Materials & materials M Ma Mat Mate BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 7 no 0 10 0 0 0 0 1 +n/a Involved n/a n n/ n/a n/a BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 7 / 1 10 0 0 0 0 1 +Antibodies Antibodies antibodies A An Ant Anti BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 7 no 0 10 0 0 0 0 1 +Eukaryotic cell eukaryotic E Eu Euk Euka BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Palaeontology and palaeontology P Pa Pal Pala BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Animals and animals A An Ani Anim BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Clinical data clinical C Cl Cli Clin BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Dual use dual D Du Dua Dual BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Plants Plants plants P Pl Pla Plan BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Methods Methods methods M Me Met Meth BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +n/a Involved n/a n n/ n/a n/a BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 NOCAPS NODIGIT 0 0 0 0 0 0 0 0 11 8 / 1 10 0 0 0 0 1 +ChIP-seq ChIP-seq chip-seq C Ch ChI ChIP BLOCKSTART PAGEIN SAMEFONT LOWERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 8 - 1 10 0 0 0 0 1 +Flow cytometry flow F Fl Flo Flow BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +MRI-based neuroimaging mri-based M MR MRI MRI- BLOCKSTART PAGEIN SAMEFONT SAMEFONTSIZE 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 8 - 1 10 0 0 0 0 1 +Novel plant novel N No Nov Nove BLOCKSTART PAGEIN SAMEFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 no 0 10 0 0 0 0 1 +Describe the describe D De Des Desc BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 8 ., 2 9 0 0 0 0 1 +gene editing, gene g ge gen gene BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 1 0 0 0 0 0 0 11 8 ,/-.,, 6 10 0 0 0 0 1 +number of number n nu num numb BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 8 .-, 3 9 0 0 0 0 1 +the editor the t th the the BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 8 ,,() 4 9 0 0 0 0 1 +was applied. was w wa was was BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 8 . 1 0 0 0 0 0 1 +Seed stocks seed S Se See Seed BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 no 0 10 0 0 0 0 1 +Report on report R Re Rep Repo BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 10 .,. 3 10 0 0 0 0 1 +plant specimens plant p pl pla plan BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 10 ,,. 3 8 0 0 0 0 1 +Authentication Authentication authentication A Au Aut Auth BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 0 0 0 0 0 0 11 11 no 0 10 0 0 0 0 1 +Describe any describe D De Des Desc BLOCKSTART PAGEIN NEWFONT LOWERFONT 0 1 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 . 1 9 0 0 0 0 1 +assess the assess a as ass asse BLOCKIN PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 11 ,,(..-,, 8 10 0 0 0 0 1 +off-target gene off-target o of off off- BLOCKEND PAGEIN SAMEFONT SAMEFONTSIZE 0 1 NOCAPS NODIGIT 0 0 1 0 0 0 0 0 11 11 -). 3 2 0 0 0 0 1 +Plants Plants plants P Pl Pla Plan BLOCKSTART PAGEIN NEWFONT HIGHERFONT 0 0 INITCAP NODIGIT 0 0 1 0 0 0 0 0 11 11 no 0 10 0 0 0 0 1 + diff --git a/grobid-trainer/resources/dataset/segmentation/corpus/tei/4_10.1128_spectrum.02630-23.training.segmentation.tei.xml b/grobid-trainer/resources/dataset/segmentation/corpus/tei/4_10.1128_spectrum.02630-23.training.segmentation.tei.xml index 1060a026f7..2f12de9f45 100644 --- a/grobid-trainer/resources/dataset/segmentation/corpus/tei/4_10.1128_spectrum.02630-23.training.segmentation.tei.xml +++ b/grobid-trainer/resources/dataset/segmentation/corpus/tei/4_10.1128_spectrum.02630-23.training.segmentation.tei.xml @@ -88,7 +88,7 @@ care during the pandemic (38). Similarly, the decline in reported LTC-BSI, including Gram-negative organisms such as E. coli, may be due to under-detection during the early part of the pandemic as a result of well-documented challenges in meeting care needs in Ontario LTCs during the early pandemic and directives to care for persons in the community due to issues related to hospital capacity (39). Certain limitations should be acknowledged. First, while patients with bacteremia are typically quite unwell and seek medical attention, the incidence of positive blood cultures would not have captured all true bacteremia episodes, especially as pandemic-related factors may have prevented patients from accessing care and increased palliative supports in LTCs that may have reduced transfers to acute care settings. Second, limiting our analysis to blood culture data allowed us to generally discern true infection among a large data set while avoiding contaminant bacteria from non-sterile cultures. However, individual chart review is required to definitively discern infection from contaminants even among blood cultures, and certain contaminant culture results may have been misclassified as true BSI; this limitation also applies to our classification of persistent and intermittent CoNS BSI. Furthermore, without other corresponding cultures, we were unable to determine the diagnoses underlying BSI (e.g., S. pneumoniae BSI secondary to meningitis vs pneumonia). Last, since our analysis was limited to the first year of the pandemic, our findings do not represent the effects of more recent phases of the pandemic. Our findings serve to highlight certain future priorities. First, our findings related to blood culture contamination emphasize the need for institution-level surveillance and quality improvement initiatives, such as phlebotomy and central venous catheter protocols, to monitor and prevent potentially harmful and costly consequences of care, especially during times of healthcare and public health crises. Second, the potentially undetected BSI in LTCs underscores the need for equitable healthcare to ensure that vulnerable individuals are adequately cared for in a pandemic context. Last, the observed changes in the microbiology and resistance profiles of BSI provide hypotheses for prospective research to better characterize the modifiable factors in clinical care (e.g., empiric antimicrobials) and infection prevention and control measures (e.g., isolation procedures, room sharing) that may underlie our findings and how these can be optimized in advance of future pandemics. In summary, we found that pandemic-related factors led to changes in the detection, incidence, and microbiology of BSI and that these effects differed by patient setting. Future studies should aim to characterize the specific modifiable factors that underlie the relationship between emerging viral pandemics and the ever-present challenges of invasive bacterial infections and antimicrobial resistance. -
ACKNOWLEDGMENTS Parts of these materials are based on data and information compiled and provided by the Ontario Ministry of Health (MOH), the Canadian Institute for Health Information (CIHI), Ontario Health (OH), and the Ontario Ministry of Health. This document also used data adapted from the Statistics Canada Postal CodeOM Conversion File, which is based on data licensed from Canada Post Corporation, and/or data adapted from the Ontario Ministry of Health Postal Code Conversion File, which contains data copied under license from Canada Post Corporation and Statistics Canada. The analyses, conclusions, opinions, and statements expressed herein are solely those of the authors and do not reflect those of the funding or data sources; no endorsement is intended or should be inferred. This work was supported by the Institute for Clinical Evaluative Sciences (ICES), which is funded by an annual grant from the Ontario Ministry of Health (MOH) and the Ministry of Long-Term Care (MLTC). This work was also supported by the Ontario Health Data Platform (OHDP), a Province of Ontario initiative to support Ontario's ongoing response to COVID-19 and its related impacts. This study also received funding from the Cana dian Institutes of Health Research. The analyses, conclusions, opinions, and statements expressed herein are solely those of the authors and do not reflect those of the funding
+
ACKNOWLEDGMENTS Parts of these materials are based on data and information compiled and provided by the Ontario Ministry of Health (MOH), the Canadian Institute for Health Information (CIHI), Ontario Health (OH), and the Ontario Ministry of Health. This document also used data adapted from the Statistics Canada Postal CodeOM Conversion File, which is based on data licensed from Canada Post Corporation, and/or data adapted from the Ontario Ministry of Health Postal Code Conversion File, which contains data copied under license from Canada Post Corporation and Statistics Canada. The analyses, conclusions, opinions, and statements expressed herein are solely those of the authors and do not reflect those of the funding or data sources; no endorsement is intended or should be inferred. This work was supported by the Institute for Clinical Evaluative Sciences (ICES), which is funded by an annual grant from the Ontario Ministry of Health (MOH) and the Ministry of Long-Term Care (MLTC). This work was also supported by the Ontario Health Data Platform (OHDP), a Province of Ontario initiative to support Ontario's ongoing response to COVID-19 and its related impacts. This study also received funding from the Cana dian Institutes of Health Research. The analyses, conclusions, opinions, and statements expressed herein are solely those of the authors and do not reflect those of the funding
Research Article Microbiology Spectrum diff --git a/grobid-trainer/resources/dataset/segmentation/corpus/tei/s11084-024-09647-4.training.segmentation.tei.xml b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s11084-024-09647-4.training.segmentation.tei.xml new file mode 100644 index 0000000000..92250a0a28 --- /dev/null +++ b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s11084-024-09647-4.training.segmentation.tei.xml @@ -0,0 +1,124 @@ + + + + + + + Vol.:(0123456789) Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Discover Life Research Green synthesis of Agaricus avensis-mediated silver nanoparticles for improved catalytic efficiency of tyrosine hydroxylase towards potential biomedical implications Sikander Ali 1 • Laraib Fatima 1 • Muhammad Usman Ahmad 1 • Qaiser Farid Khan 1 • Muhammad Umar Hayyat 2 • Zafar Siddiq 3 • Sanjaykumar Patel 4 • Tawaf Ali Shah 5 • Yousef A. Bin Jardan 6 • Youssouf Ali Younous 7 • Mohammed Bourhia 8 Received: 5 April 2024 / Accepted: 21 June 2024 © The Author(s) 2024 OPEN Abstract The present study deals with the bio-fabrication of AgA-AgNPs utilizing edible mushroom Agaricus arvensis as a reductant for improved stability and catalytic efficiency towards L-dopa production. The parameters optimized for achieving maxi-mum tyrosine hydroxylase (TH) activity were the mushroom biomass (2.5%, w/v), media for extraction (peptone-saline), and temperature (90 ℃). The activity of tyrosine hydroxylase (TH) was enhanced by its immobilization on AgNPs. The change in color from light yellow to dark brown confirmed the formation of AgA-AgNPs. In addition, the UV-Vis spectrum showed a surface plasmon resonance band at 260 nm. Fourier transform infrared (FTIR) indicated presence of functional groups, which play an important role in production of NPs. X-ray diffraction (XRD) confirmed the crystalline nature of mycosynthesized AgNPs and showed peaks corresponding to 38.8° (111), 46.5° (200), 64.1° (220), and 77.5 o (311). AgA-AgNPs exhibited -9.16 mv zeta potential. Scanning Electron Microscopy (SEM) images of AgA-AgNPs confirmed particle size between 88.49 ± 3.83 nm. Immobilized TH extracted from A. arvensis showed reusability at optimized temperature (20 ℃) for 3 cycles. A 2.54-fold higher production of L-dopa was examined with AgA-AgNPs. Furthermore, immobilized TH consumed more L-tyrosine i.e. 0.554 ± 0.022 mg/ml as compared to the free enzyme at 90 min of biotransformation. Hence, the immobilization of A. arvensis extracted TH on AgNPs increased its activity as well as its stability and catalytic efficiency. AgA-AgNPs has a potential of dopamine synthesis and can play a significant role in drug delivery or biomedi-cal applications. Highlights • Green synthesis of Ag-Nps mediated by Agaricus arvenesis + +
Supplementary Information The online version contains supplementary material available at https:// doi. org/ 10. 1007/ s11084-024-09647-4.
+ + * Sikander Ali, dr.sikanderali@gcu.edu.pk; * Youssouf Ali Younous, scientifcresearcher@gmail.com; Sanjaykumar Patel, Patelsanjay.pharma@gmail.com; Tawaf Ali Shah, tawafbiotech@yahoo.com | 1 Department of Microbiology, Institute of Biotechnology (IIB), Government College University Lahore, Lahore 54000, Pakistan. 2 Sustainable Development Study Centre, Government College University Lahore, Lahore 5400054000, Pakistan. 3 Department of Botany, Government College University Lahore, Lahore 54000, Pakistan. 4 Sigmapharm laboratory llc, Bensalem, Pennsylvania, USA. 5 College of Agriculture Engineering and Food Science, Shandong University of Technology, Zibo 255000, China. 6 Department of Pharmaceutics, College of Pharmacy, King Saud University, P.O. Box 11451, Riyadh, Saudi Arabia. 7 Evangelical College, BP 1200, N'Djamena, Chad. 8 Laboratory of Biotechnology and Natural Resources Valorization, Faculty of Sciences, Ibn Zohr University, 80060 Agadir, Morocco. Vol:.(1234567890) Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 • Improved production of L-dopa with AgA-AgNPs • High consumption of L-tyrosine using AgA-AgNPs Keywords Silver nanoparticles • Tyrosine hydroxylase • L-dopa • Biotransformation • Horse mushroom • AgA-AgNPs + + 1 Introduction Tyrosine hydroxylase (TH) is an aromatic amino acid hydroxylase and a member of tetrahydropterin dependent. TH required tetrahydrobiopterin known as BH 4 as a cofactor, nonheme iron ion, and molecular oxygen as an additional sub-strate [1]. In the biosynthesis of dopamine and other catecholamines, TH (EC. 1.14.16.2) speeds up the rate-limiting step. Hydroxyl group added at meta and ortho position of L-tyrosine (oxygen oxidoreductase, tyrosine 3'-monooxygenase) for producing L-dopa (3,4-dihydroxyphenyl-L-alaline) and other catecholamines [2]. Parkinson's disease (PD) is considered the most frequent neurodegenerative illness after Alzheimer's disease. PD is a human-specific, progressive, and aging-related disease. TH enzyme deficiency is suspected in PD [3]. The main symptom of the disease was spontaneous movement disorder, known to be caused by a neurochemical disorder that decreases the neurotransmitter dopamine [4]. It is also reported that PD as the second most common neurological disorder [5]. PD showed difficulties in diagnosis, treatment, and in drug delivery. In the treatment of Parkinson's disease levodopa (3,4-dihydroxyphenyl-L-alanine) was considered as standard therapeutic agent [6]. Levodopa is colorless, tasteless, slightly soluble in water, and odorless. Typically white, crystalline solid or powder with chemical formula C 9 H 11 NO 4 and molecular weight of 197.19 g/mol determined [7]. Dopa decarboxylase (E.C. 4.1.1.28) catalysis became the cause of dopamine production by the conversion of L-dopa. Therefore, the level of dopamine increased [8]. The most significant advancements in nanotechnology have been the manufacturing, exploitation, and employment of materials with sizes ranging from a few microns to individual atoms for usage in living organisms through biological prospects [9]. A previosu study, declared AgNPs as the most attractive nanomaterials in biomedicine. AgNPs possess antibacterial, antiviral, antioxidant, and anticancer properties with diverse applications in the field of medicinal biology, drug delivery, renewable energy, optics, electronics, material sciences [10]. Fungus derived nano particles are being used in the agriculture sector as biosensors, nano fertilizers and nano pesticide to promote plant growth [11]. Applications of NPs as Anti-oncological agent against glioblastoma have been reported by [12]. A study conducted by [13] silver highlights antibacterial effects of nanoparticles (AgNPs) from aqueous seed extract of Myristica fragrans. It confirms that biosynthesized AgNPs have strong antibacterial effect on S. typhi growth. It is also reported that antibacterial effect of green AgNPs produced from red algae Amphiroa rigida [14]. Various researchers have reported antibacterial effect [15] of Nps specifically AgNPs produced from different sources such as plants [16], microbes [17], fungus [18]. NPs synthesis includes phytofabrication physical and chemical preparation microbial synthesis [19], and biological means including bacteria, fungi, virus [20] and plant extract [21]. Nanoparticles are used for a variety of purposes, includ-ing medical therapeutic applications, energy storage in solar and oxide fuel batteries, optical devices, bactericidal agents, electronic devices, biological labeling, cosmetics, clothing, and anti-cancerous agents. Nanoparticles have received a lot of attention because of their outstanding qualities, which include antimicrobial activity, great resistance to oxidation, and high thermal conductivity [22]. Silver nanoparticles (AgNPs) are vital to nanomedicine and other fields related to nanoscience and nanotechnology. Electronics, biosensing, clothes, food industry, sunscreens, textiles, photonics, paints, cosmetics, electronics, antimicrobicides, and medical equipment all utilized AgNPs. AgNPs have ample utilization in a diverse range of consumer products like food, cloth, pastes, soaps, plastics, and textiles metal due to their wide range of antifungicidal and antibacterial effects [23]. Tyrosine hydroxylase (TH) catalyzes the rate-limiting step in the production of catecholamine's. This enzyme converts tyrosine to dopamine. TH deficiency is related to Parkinsonism. Tyrosine hydroxylase acts as a catalyst in the conversion of L-tyrosine into levodopa. It's important to maintain the structure and functionality of TH because it's a complicated and unstable enzyme. To improve enzyme stability and reduce L-dopa titer, enzyme immobilization has been suggested. The present study targeted the immobilization of tyrosine hydroxylase extracted from Agaricus arvensis on AgNPs for enhanced stability and improved catalytic efficiency towards L-dopa production. Immobilization of TH improved its activity. Moreover, stable and more L-dopa production was associated with immobilization. The activity of TH could be enhanced by its immobilization so that more and stable L-dopa could be produced. + + Vol.:(0123456789) Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 2 Materials and methods The premium-grade chemicals were employed to revolutionize this research and procured from different purveyors of Acros Organics (Belgium), Daejung Chemicals (South Korea), Fisher Scientific (U.S.), and Sigma-Aldrich (Germany). 2.1 Collection and pre-treatment of Agaricus arvensis biomass Agaricus arvensis commonly known as horse mushroom, collected from the Department of Botany, GC University Lahore. This mushroom was preserved in a citric-saline solution (10X, pH 7.0). The fruiting body of the mushroom was cleaned properly with deionized water before being divided into thin slices. The extra water and moisture were absorbed by Whatman filter paper No.1. 2.2 Preparation of mushroom extract A. arvensis washed several times with deionized water and sliced into several thin slices from the mushroom cap. A sliced mushroom of 1.25 g was weighed and boiled in 25 ml of distilled water on a hot plate (MSH: 20-A, wisd, wisestir, Ger-many) in a conical flask of 250 ml for 3 min. After boiling, the solution was allowed to cool down to room temperature. Afterwards, filtration was performed by using Whatman filter paper No.1 and underwent spectrophotometry at 575 nm with UV-V spectrophotometer (UV-9000, HT Company, Ilford, U.K.). The rest of the filtrate was stored at 4 °C and used as a reducing agent and stabilizer. The spectroscopy was performed 3 times so the average could be taken. The distilled water was operated as blank [24]. 2.3 Optimization of mushroom extract Different weights (% w/v) of mushrooms were enumerated in distilled water and peptone saline to find out the super-lative mushroom biomass. Mushroom biomass of 2 and 2.5% (w/v) was taken in 25 ml of distilled water and peptone saline. Later, TH assay was performed. Mushroom biomass of 2% w/v (0.5 g) and 2.5% w/v (0.625 g) was evaluated to investigate the efficient mushroom biomass. The evaluation of different extraction temperatures was preceded at 50, 60, 70, 80, 90, and 100 °C in a boiling water bath (WB-22 Wisebath, wisd, Wertgeum, Germany). TH assay was performed after extraction. Filtrates were analyzed by UV-visible spectrophotometry. 2.4 Aerobic biotransformation reaction The modified protocol was followed for aerobic biotransformation reactions for L-dopa synthesis from L-tyrosine using mushroom extract as a source of tyrosinase in the reaction mixture. Twenty-five milliliters of 50 mM acetate buffer (pH 3.5) comprising 2.5 mg/ml L-tyrosine, 5 mg/ml L-ascorbic acid along with 1 ml of mushroom extract was used. The reactions were performed aerobically at 50 ºC for 60 min and 80 rpm using a shaking water bath (WB-14, Memmert, Schwabach, Germany). The biochemical samples were collected and centrifuged (4000 rpm, 15 min) using a centrifuge (3K30, Sigma Laboratory Centrifuges). 2.5 Analytical techniques 2.5.1 Tyrosine hydroxylase enzyme activity assay The analytical technique followed the procedures laid down by [25, 26]. Supernatant (0.1 ml) was taken in a test tube. L-ascorbic acid (0.1 ml), EDTA (0.1 ml), and L-tyrosine (0.1 ml) with the addition of 2.6 ml phosphate buffer (pH 7.2, 50 mM) were added in a test tube. The components were fully combined and left at room temperature (30 °C) for 10 min. A 310nm measured till it becomes steady. The reduction in absorption was monitored every minute for a total of 5 min. One enzyme activity unit is equal to a ΔA265nm of 0.01 per min at 25 °C, pH 7.2 in 3 ml of reaction mixture that contains L-ascorbic acid and L-catechol. The following formula was used to measure enzyme activity: + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + 2.5.2 Catalytic efficiency and stability of TH The catalytic stability of tyrosine hydroxylase was estimated by TH assay with free enzyme extract as well as with immo-bilized enzyme. The reusability of immobilized tyrosinase was estimated by performing TH assay with 0.1 ml of immobi-lized AgNPs at 40 °C with the incubation time of 5, 10, 15, 20, 25 and 30 min. Afterward, the OD was taken at A 310nm. This was the first cycle. After the first cycle falcons were subjected to centrifugation (5000 rpm, 15 min). The supernatant was discarded. The pellets were used for TH assay. All the contents of the falcons were vortex and incubated for 5, 10, 15, 20, 25, and 30 min, in parallel. After incubation, the absorbance was taken. Two more cycles were performed by following the prior mentioned method. 2.5.3 L-Dopa synthesis and L-tyrosine consumption Free enzymes and immobilized enzymes produced after biotransformation were used for L-tyrosine consumption and L-dopa synthesis. The biotransformation was performed aerobically at 50 °C for 15, 30, 45, 60, 75, 90, 105, and 120 min using a shaking water bath (80 rpm). L-tyrosine consumption was estimated by taking one milliliter of supernatant with 1 ml of mercuric sulphate reagent. The tubes were kept for 10 min in a hot water-bath. After cooling, 1 ml of nitrite reagent along with 1 ml of distilled water was added to it. The volume was increased to 5 ml. At 545 nm, the OD was determined using a spectrophotometer (35). The amount of consumed L-tyrosine was determined from the equations viz. y = 0.2105 + 0.0008, 0.2105 = y + 0.0008, and X = y+0.0008 0.2105 . L-dopa synthesis was estimated by taking 1 ml of supernatant (free and immobilized enzyme) in a test tube with 1 ml of 0.5 N HCl along with 1 ml of nitrite molybdate reagent (NMR). Control was also run in parallel (35). One milliliter of 1 N NaOH became the cause of a crimson hue when added. With distilled water, the entire capacity was topped out to 5 ml. After 3 min at 545 nm, the OD was taken using a spectrophotometer. The amount of L-dopa produced was determined from the equations viz. 2.6 Statistical analysis Significant difference among three parallel replicates has been represented with mean ± standard deviation. Origin95 software was used to draw all the plots. XRD pattern was drawn using X' pert High Score. Size distribution histogram data was collected from ImageJ software. The p < 0.05 was considered significant [27]. 2.7 Green synthesis of silver nanoparticles (AgA-AgNPs) Nano-silver formation was observed when the cell-free extract of A. arvensis (3 ml) was mixed with 7 ml of AgNO 3 (24 mM). Mushroom extract with AgNO 3 was placed for 90 min at 70 °C and 120 rpm in a shaking water bath. The color of the reaction mixture changed from transparent (before the addition of supernatant) to light yellow (after the addition of supernatant) then dark brown to orange-red (after the incubation of 90 min). Maximum intensity after 90 min observed during the period of incubation, indicative of the formation of AgA-AgNPs. The change in the color of the reaction mixture corresponded to the synthesis of AgA-AgNPs. Control without silver ions showed no change in the color of the cell filtrates when incubated under the same conditions [8]. The green synthesized nanoparticles were centrifuged. To acquire the pellet, centrifugation was carried out for 20 min at 6000 rpm. After discarding the supernatant, the particle was rinsed twice, once with distilled water and once with ethanol. To evaporate the ethanol, the pellet was stored in the dark at 25 °C for the whole night. Using a pestle and mortar, the dry pellet was ground into a fine powder and stored for further study. Tyrosine hydroxylase activity (U∕mg) = ΔA310 nm∕min (test) -ΔA310 nm∕min (control) 0.01 mg enzyme∕reaction mixture y = 1.9945x + 0.0008, 1.9945 = y + 0.0005, and X = y + 0.0005 1.9945 + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 2.8 Characterization of AgNPs and AgA-AgNPs 2.8.1 UV-Visible spectroscopy (UV/VIS spectroscopy) A bio-reduction reaction revealed the solution's change in hue. A UV-Vis spectrophotometer was used to measure the immobilized AgNPs' surface plasmon resonance in a reaction mixture. UV-Vis spectroscopy was executed by means of a UV-Visible spectrophotometer (Cary 60, Versio 2) in the Nanotechnology lab, GC University Lahore using quartz cuvette at 25 ℃. The wavelength ranged from 200 to 800 nm. The sample was made under the previously mentioned, optimized condi-tions and diluted to a concentration of 10 ppm. Prior to measuring the sample, the UV-VIS spectrophotometer was calibrated in accordance with the manufacturer's instructions, and a baseline correction was performed [28]. 2.8.2 Fourier transform infrared spectroscopy (FTIR) The free silver nanoparticles and AgA-AgNPs solution freeze-dried overnight before analysis. With a few slight modifica-tions, the same procedure was employed for the synthesis of free AgNPs that was followed to create AgA-AgNPs. The func-tional groups with capping and reducing characteristics were identified by FTIR analysis. For FTIR analysis, liquid samples of biogenic AgA-AgNPs and free AgNPs were sent to CASP GC University in Lahore. The spectra were recorded using an FTIR spectrophotometer (Spectrum-100, Perkin-Elmer, and St. Louis, USA). Percentage transmittance evaluated at a range of 400-4000 cm -1 and 25 °C [29]. 2.8.3 X-Ray diffraction analysis (XRD) The crystalline nature of the biosynthesized silver nanoparticles was determined by operating continuous scanning in the range of 5-80° angles. The powder sample of AgA-AgNPs was sent to the Central Research Lab, Lahore College for Women University (LCWU) for XRD analysis. XRD machine (D8 discover, Bruker) in the 2θ range 5°-80° with scan speed 1 determined the crystalline nature of the AgA-AgNPs [22]. 2.8.4 Metallurgical microscopy AgA-AgNPs were subjected to metallurgical microscopy (5501W, Leica, Wetzlar, Germany) from the Center for Advanced Studies in Physics (CASP), GC University, Lahore. The powder form of AgA-AgNPs was mixed with a few drops of distilled then placed on a micro slide for microscopy. Metallurgical microscopy was conducted at 20X and 100X resolution. The light in the metallurgical microscope intermingled with the sample and created numerous optical signals [30]. 2.8.5 Zeta potential measurement The powdered sample of AgA-AgNPs was conveyed to Syed Babar Ali School of Science and Engineering, Lahore University of Management Sciences (LUMS) for Zeta potential analysis. The sample undergone sonication and was then examined by Zeta sizer Nano ZS instruments (Malvern Instruments Ltd, Zetasizer Ver. 7.10). The AgA-AgNPs' stability was illustrated by the zeta potential. A 2 mm adjustment was made to the measuring location. The test was conducted at a count rate of 253.3 kcps and in the room temperature range of -150 to 150 mV apparent zeta potential [31]. 2.8.6 Scanning electron microscopy (SEM) The dimensions, form, and surface morphology of AgA-AgNPs were examined using SEM, SEM was used to determine the shape and size distribution. AgA-AgNPs in powder form were sent to LCWU's Central Research Laboratory for SEM examina-tion. The scanning electron microscope (EVOLS10, ZEISS) observed the size distribution of biogenic AgNPs [32]. + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + 3 Results and discussion 3.1 Extraction of tyrosine hydroxylase from the pre-treated mushroom biomass 3.1.1 Evaluation of assay time for better TH activity The optimization of TH assay over different time intervals [supp.1] was evaluated and exhibited in Fig. 1. TH activity (U/mg) was estimated at 1, 2, 3, 4 and 5 min intervals. Spectrophotometry evaluated the results. Tyrosine hydroxylase was extracted from fresh edible mushroom Agaricus arvensis. The assay was performed after enzyme extraction with phosphate buffer having a pH of 7.2 [supp.2]. This pH minimizes the spontaneous oxidation of dopa to melanin, the rate of which increases with increasing pH [33]. The temperature of incubation was 30 ℃. The enzyme activity was 12.4 U/mg at 1 min time intervals recorded as the lowest enzyme activity. Enzyme activity was increased with an increase in time initially. The enzyme activity was 25.3 U/mg at 2 min time intervals. The highest enzyme activity was 55.7 U/mg obtained after 3 min. Subsequently, there was a visible decline in TH activity was recorded at 45.2 and 33.5 U/mg with 4 and 5 min, respectively. Therefore, the time interval of 3 min was optimized for TH assay [supp.3]. Similar results were reported when [34] optimized TH assay spectrometry after 5 min of incubation. However [33], reported 6 min optimal for TH assay spectrometry. 3.1.2 Optimization of mushroom biomass for TH extraction Figure 2 indicates the UV-Vis absorption spectrum of the optimization of mushroom biomass % (w/v) for TH extrac-tion. For this purpose, 2 and 2.5% (w/v) mushroom biomass were analyzed by using UV-VIS spectroscopy. The fruiting body of mushroom is sliced and heated for TH extraction. The homogeneously dispersed solutions were analyzed at different wavelengths between 200 and 800 nm. The peak obtained for 2% (w/v) mushroom biomass was lowered to 2.5% (w/v) mushroom biomass with an absorbance of 0.64 (a.u). The highest absorption peak was obtained for 0.625 g (2.5%, w/v) at 260 nm with an absorbance 0.69 (a.u). The absorbance was 1.07-fold higher than 2% mushroom biomass. Therefore, the spectrum indicated that 2.5% of mushroom biomass supported an efficacious extraction process. The TH activity was increased when a higher %, w/v mushroom biomass was used. The reason behind this is that more biologically active metabolites were available to increase the activity of enzymes [35]. In a similar study [36], reported 0.750 g of oyster mushroom (Pleurotus tuber-regium) for enzyme extraction. Moreover [37], reported the synthesis of AgNPs from Pleurotus florida, an edible mushroom. The extract of this mushroom was obtained using 5 g of P. florida. Fig. 1 Extraction of the Tyrosine hydroxylase (TH) and optimization assay over differ-ent time intervals + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 3.1.3 Optimization of extraction media Figure 3 shows UV-Vis absorption spectrum of the optimization of different extraction media for TH extraction from A. arvensis. The results were scrutinized using UV/Vis spectroscopy. The absorbance with distilled water was 0.73 (a.u) at 260 nm. The absorbance of mushroom extract with peptone-saline was 0.88 (a.u) at 260 nm. The absorbance of TH activity with peptone-saline as an extractant was 1.20-fold higher as compared to distilled water [supp.4]. After, 260 nm there was a sudden decline in the absorbance till 300 nm wavelength. The absorbance became steady after 300 nm. Therefore, peptone-saline was selected as the optimal extractant for TH extraction from A. arvensis. The findings of this work contradict with [29], who reported the extraction of TH from A. bisporus in distilled water as extractant. Moreover [8], worked on the extraction of TH from A. bisporus in distilled water as an extractant also. 3.1.4 Optimization of temperature for TH extraction UV-Vis spectrum for the optimization of temperature for TH extraction was examined. The results are shown in Fig. 4. The extraction of TH proceeded with 2.5% (w/v) A. arvensis biomass at 90 and 100 ℃ [supp.5]. The results were analyzed by UV-Vis spectroscopy. The peak for 90 ℃ was higher with the absorbance of 2.0 (a.u). The absorbance for 100 ℃ was 1.4 (a.u). The peak maxima were obtained at 260 nm for 90 ℃ with 1.42-fold higher absorbance as compared to 100 ℃. Enzymes are proteins in nature that have three-dimensional shapes and specific configurations. An increase in tempera-ture from optimum caused denaturation of the enzyme and lowered its enzyme activity [38]. However, A. bisporus boiled Fig. 2 UV-Vis absorption spectrum of the optimization of mushroom biomass for the Tyrosine hydroxylase (TH) extraction Fig. 3 UV-Vis spectrum of different extraction mediums on the activity of the Tyrosine hydroxylase (TH) + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + at 100 ℃ for TH extraction [39]. Jagadish et al. [40] reported the extraction of edible bachu mushroom with highest yield of polysaccharides at the temperature of 90℃. 3.2 Characterization of free and immobilized AgNPs 3.2.1 Comparative UV absorption spectra of AgA-AgNPs AgA-AgNPs were synthesized by reacting 7 ml of 24 mM AgNO 3 concentration along with 3 ml of A. arvensis extract level. Comparative AgA-AgNPs UV-Vis spectra were depicted in Fig. 5. The reaction contents were heated for 90 min in an orbital water bath for 120 rpm as reported by [8]. The AgA-AgNPs showed dark-brown colour due to the surface plas-mon resonance depicted by the NPs [41]. The color of reaction mixture was gained intensity with time due to excitation of surface plasmon vibrations in metallic NPs. The UV-Vis spectroscopy of AgA-AgNPs under optimized conditions were compared with free AgNPs [supp.6]. The free AgNPs were labelled as A and AgA-AgNPs were highlighted as B in Fig. 5. The free AgNPs depicted the peak at 285 nm. While the AgA-AgNPs showed peak at 260 nm. However, there was only AgNO 3 in water in case of free AgNPs. There were no AgNPs in the solution of free AgNPs. The absorbance was measured for only AgNO 3 [42]. The parameters of AgA-AgNPs synthesis were optimized to get AgA-AgNPs in large numbers. The results are in contrast with [43] who reported resishi mushroom based nanoparticles with UV-Vis at 400 nm. Aygun et al. [44] reported UV-Vis spectrum at 270-300 nm of green synthesized AgNPs fabricated from polyacrylamide (dextran-grafted). Moreover [8], synthesized AgNPs from A. bisporus reported peak at 420 nm. Fig. 4 UV-Vis spectrum of different temperatures on the activity of Tyrosine hydroxy-lase (TH) Fig. 5 Comparative UV Absorption Spectra of AgA-AgNPs + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 3.2.2 Fourier transform infrared (FTIR) spectroscopy The functional groups' roles in the production of AgA-AgNPs were made evident by a distinct FTIR spectrum. In this instance, FTIR analysis was performed to detect the presence of biomolecules in free AgNPs and AgA-AgNPs (Table 1). The FTIR spectra of immobilized AgA-AgNPs and free AgNPs were depicted in Fig. 6. Peaks of AgA-AgNPs were located at 612.94459, 1636.4399, 2123.79028 and 3330. 56226/cm . the peak at 612.94 cm -1 indicating C-H bending of alkynes [45]. The peak at 1636.43 cm -1 was ascribed to C = O stretching vibration which indicated that the amino and carboxyl groups were successfully modified [46]. Similarly, C≡C functional group was seen at 2123.79 cm -1 . Furthermore, it was also confirmed that the carbonyl group from protein and amino acids binds to AgNPs and behaves as stabilizing biomol-ecules [45]. A strong absorbance peak was observed at 3330.56 cm -1 was ascribed to the H-O-H bond suggesting the binding of silver ions with hydroxyl groups. Free AgNPs showed peaks at 592.12276, 1064.75703, 1392.53197, 1635.60102, 2980.46036, and 3345.67775/cm -1 . A peak at 592.12 cm demonstrated the nitrites' C-C-C-N group bonding [47]. The peak at 1064.75/cm -1 depicted C-H bond stretching of cellulose (63). The peaks at 1392.53, 1635.60 and 2980.46 /cm -1 indicated the -C-H-bending, carbonyl stretching, and C-H stretching of polyphenols, amide I group of proteins and alkanes [48]. The final peak, at 3345.67/cm, demonstrated the alkenes' C = C stretching. These peaks indicated the pres-ence of alkanes, alkenes, ketones and nitrites [49]. 3.2.3 X-Ray diffraction analysis (XRD) Silver nanoparticles are crystalline, as shown by XRD analysis. AgA-AgNPs were therefore analyzed using X-ray diffraction to determine their phase composition, structural alterations, and crystal structure. Figure 7 represents the XRD pattern of AgA-AgNPs. The range of angle 2 theta was 0 to 80°. The instrument was a copper anode and monitored at kα wave-length of 0.15406 nm. XRD verified that the silver nanoparticles are crystalline, similar observations were reported by [20]. The index of these peaks was found using the X'Pert high score. The X-ray diffraction pattern of freeze-dried silver nanoparticles exhibited peaks at 38.8, 46.5, 64.1 and 77.5 o corresponding to (111), (200), (220) and (311), respectively confirming the crystalline and face cubic center (fcc) nature of silver nanoparticles. The existence of another prominent peak in XRD pattern at around 32 degrees is probably because of the presence of phytochemical compounds [50]. Ledeti et al. [8] used A. bisporus to produce AgNPs and the angles of these mycosynthesized nanoparticles correspond to (111), (200) and (311), respectively. In another study [48], used the extract of Reishi mushroom for the synthesis of silver nanoparticles. The XRD analysis was carried out to confirm the crystalline nature of mycosynthesized AgNPs. The angles were found corresponding to (111), (200), (220), and (311) planes. The results were also correlated with [19], who reported silver nanoparticles synthesis from Pyrostegia venusta. They also found the planes of angles at (111), (200), (220) and (311) which depicted the formation of fcc AgNPs. 3.2.4 Metallurgical microscopy of AgNPs AgA-AgNPs undergone metallurgical microscopy. This microscopy involved imaging at high magnification. Magnification power of 20X and 100X were used to image AgA-AgNPs. Metallurgical analysis detects interior and surface flaws, provides information about shape, phase, composition analysis and alloy presence. Metallurgical microscopy of AgA-AgNPs was Table 1 FTIR spectrum peak analysis of A. arvensis extract, free AgNPs and AgA-AgNPs Sample Wavelength (cm -1 ) Bond stretching Functional groups Free AgNPs 592.12 C-C-C-N bonding Nitrites 1064.75 C-H stretching Cellulose 1392.53 -C-H-Bending Polyphenols 1635.60 Carbonyl stretching Amide I group of proteins 2980.46 C-H stretching Alkanes 3345.67 C = C stretching Alkenes AgA-AgNPs 612.94 C-H bending Alkanes 1636.43 Carbonyl stretching Amide group I of proteins 2123.79 C≡C Alkynes 3330.56 H-O-H stretching Hydroxyl group + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + shown in Fig. 8. Blackish spherical and irregular NPs confirmed the presence of AgA-AgNPs at 20X magnification [19]. The magnification of 100X revealed the agglomeration of mushroom-based silver nanoparticles. Metallurgical microscopy at 10X in correspondence with the results of [51] who investigated Mg-Ag alloys that were antibacterial biodegradable in nature. Uniform spreading of tungsten carbide NPs confirmed by metallurgical microscopy [52]. 3.2.5 Zeta potential Zeta potential analysis was done to estimate the stability of AgNPs. Zeta potential of AgA-AgNPs was estimated by per-forming Zetasizer analysis [53]. Zeta potential provided the information about stability and surface charge of colloidal Fig. 6 FTIR spectrum of free enzyme, free AgNPs and AgA-AgNPs + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + AgA-AgNPs (Fig. 9). The system was set at 25 °C for 12 zeta runs. The designed count rate was 199.4 kcps. However, the measurement position was 2 mm. Only a single peak appeared with a mean value of -9.16 mV. The calculated standard deviation was 6.80 mV. The mean value was the zeta potential of the sample. Zeta deviation was 6.80 mV with a conduc-tivity 0.0213 mS/cm. The cell description consisted of clear disposable zeta cells and the result quality was good. The occurrence of a sharp peak at -9.16 mV indicated stable AgNPs are negatively charged and dispersed in the medium, similar results were observed by [11]. In a similar study, (71) reported the synthesis of AgNPs from edible mushroom Flammulina velutipes. These green synthesized nanoparticles showed the zeta potential of -9.90 mV [54]. also found the Fig. 7 X-ray diffraction (XRD) patterns of AgA-AgNPs Fig. 8 Metallurgical micros-copy of AgNPs Fig. 9 Zeta potential distribu-tion of AgA-AgNPs + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + +
zeta potential of AgNPs at -8.5 mV when using Streptomyces albidoflavus for NPs synthesis. Mushroom mediated AgNPs were found relatively stable. The silver nanoparticles were also produced by using A. bisporus extract they showed the zeta potential of -7.23 mV. These fungus-mediated AgNPs were found stable and well dispersed in the medium [55]. Green synthesis of silver nanoparticles from the edible mushroom Pleurotus sajor-caju provided the zeta potential of -8.54 mV (74). [11] also reported that NPs stability was observed at negative value (-15.3 mV) in zeta potential. 3.2.6 Scanning electron microscopy (SEM) The morphology and particle size of biosynthesized AgA-AgNPs were analyzed by SEM (75). AgA-AgNPs SEM images were illustrated at 500X, 10,000X and 1.02 KX in Fig. 10. These images confirmed the formation of the irregular, spherical shape of AgA-AgNPs, similar observations were reported by [20]. Some agglomerates of AgA-AgNPs were also obtained of 112.6 and 228.8 µm width. The particles synthesized from A. arvensis extract were shown with different diameters. Moreover, A. arvensis gave rise to agglomerations of spherical or irregular AgA-AgNPs. Agglomeration between some particles might be because small nanoparticles are prone to agglomerate because of Van der Waals forces of attraction and can be avoided by controlling the capping agent concentration if needed [56] Imagej software was utilized to estimate the size of nanoparticles from SEM images. Moreover, Origin95 software proceeded to draw a size distribution histogram. Figure 11 depicted the size distribution histogram for AgA-AgNPs that collected the data from Imagej software. The aver-age mean size of AgA-AgNPs was found to be 88.49 ± 3.83 nm. The average mean size was found by applying Gaussian law. In a similar study, (34) reported the synthesis of AgNPs from mushroom A. bisporus. The size distribution histogram of these mycosynthesized NPs showed an average size of 103.57 nm. Loshchinina et al. [57] reported the synthesis of AgNPs from the fungus Cladosporium cladosporioides with a diameter 100 nm. Hulikere and Joshi [58] synthesized mushroom-mediated AgNPs and found the size from SEM up to 45 nm. 3.2.7 Evaluation of the reusability of AgA-AgNPs with different incubation time The reusability of AgA-AgNPs was evaluated with different incubation times [supp.7]. The results are shown in Fig. 12. Different time intervals were used for incubation including 5, 10, 15, 20, 25 and 30 min. The reusability of AgA-AgNPs was estimated in three cycles. The enzyme activity was estimated at each level. The enzyme activity was 108.2 U/mg obtained for the first cycle at 5 min of incubation. The enzyme activity decreased sharply after 5 min of incubation in the first cycle. A 1.14-fold higher activity was observed in the first cycle at 5 min of incubation in comparison with the second cycle. In the case of second cycle the enzyme activity was 32.2, 67.5 and 88.6 U/mg at 5, 10 and 15 min incuba-tion, respectively. The highest enzyme activity was obtained at 20 min and recorded as 94.3 U/mg. After 20 min the enzyme activity decreased sharply. Moreover, the third cycle showed enzyme activity of 44.9 U/mg and 62.7 U/mg at 5 and 10 min of incubation, respectively. The enzyme activity obtained at 15 min was 81.5 U/mg. After 15 min the enzyme activity decreased sharply till 30 min. The enzyme activity was 72.1 U/mg, 64.6 U/mg and 42. 7 U/mg at 20, 25 and 30 min, respectively in the third cycle. It was reported that immobilized tyrosinase from A. bisporus showed reusability repeatedly and continuously at 40 ℃ to produce L-dopa [59]. Munjal and Sawhney [59] reported improved TH reusability after its immobilization on magnetic NPs for five cycles. 3.2.8 Evaluation of the production of L-dopa The evaluation of the production of L-dopa using free enzymes and AgA-AgNPs over a wide range of different time intervals was examined [supp.8]. The results are depicted in Fig. 13. The time of biotransformation used for free and immobilized enzymes was 15, 30, 45, 60, 75, 90, 105 and 120 min. The L-Dopa production (mg/ml) was estimated for free enzyme and AgA-AgNPs at each level. The L-Dopa production for free enzyme and AgA-AgNPs was 0.018 mg/ml and 0.011 mg/ml, respectively at 15 min of biotransformation. L-Dopa production was increased as the time of biotransfor-mation was increased. The L-Dopa production was 0.088 mg/ml and 0.224 mg/ml at 90 min for free and immobilized enzyme, respectively. The L-Dopa production for AgA-AgNPs was 2.54-fold higher in comparison with the free enzyme. The L-Dopa production was decreased sharply after 90 min of biotransformation for both free enzyme and AgA-AgNPs. The L-Dopa production was 0.069 mg/ml and 0.054 mg/ml for free enzyme at 105 and 120 min, respectively. Moreover, for AgA-AgNPs the L-Dopa production was 0.115 mg/ml and 0.081 mg/ml at 105 and 120 min, respectively. Immobiliza-tion increases the stability of enzymes. Immobilized mushroom tyrosinase produces more L-dopa as compared to free
+ + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + tyrosinase. The production rate was 31-36 mg/l/h in 60 min batch [47]. Furthermore, more production of L-dopa from immobilized TH. Tyrosinase immobilization on PHA nanogranules give the highest thermostability at 55℃ [60]. 3.2.9 Evaluation of the consumption of L-tyrosine Evaluation of the consumption of L-tyrosine using free enzyme and AgA-AgNPs over a wide range of different intervals of time for biotransformation was examined [supp.9]. The results are depicted in Fig. 14. The time of biotransformation used for free and immobilized enzymes was 15, 30, 45, 60, 75, 90, 105 and 120 min. The consumption of L-tyrosine (mg/ ml) was estimated for free enzyme and AgA-AgNPs. The consumption of L-tyrosine for free enzyme was 0.065 mg/ml at Fig. 10 Scanning electron microscopy (SEM) of AgA-AgNPs + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + Fig. 11 Size distribution histo-gram for AgA-AgNPs Fig. 12 Evaluation of the reusability of AgA-AgNPs with different incubation times Fig. 13 Evaluation of the pro-duction of L-dopa using free enzyme, and AgA-AgNPs over different time intervals + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 15 min. Initially, the increase in biotransformation time became the cause of the increase in the consumption of L-Tyrosine. The highest L-Tyrosine consumption for the free enzyme was 0.312 mg/ml obtained at 90 min. There was a sharp decline in L-Tyrosine consumption after 90 min. In contrast, L-Tyrosine consumption for AgA-AgNPs was 0.155 mg/ml at 15 min. The highest L-Tyrosine consumption for AgA-AgNPs was 0.554 mg/ml obtained at 90 min. A 1.77-fold higher L-Tyrosine consumption was obtained for AgA-AgNPs in comparison with the free enzyme. Consumption of L-tyrosine was 0.450 mg/ ml and 0.341 mg/ml at 105 and 120 min, respectively. (82) reported more consumption of L-tyrosine from immobilized TH on chiral and non-chiral supports. Tan et al. [61] reported the maximum conversion of L-tyrosine to levodopa in 60 min by the fungus Aspergillus oryzae. 4 Conclusion The present work deals with the green synthesis of AgNPs form edible mushroom A. arvensis and the improved stability of immobilized TH with catalytic efficiency towards L-dopa production. Silver nanoparticles attract the most attention due to their vast bio-medicinal potential. Edible mushrooms contain several biologically active compounds that act as reducing and capping agents in the synthesis of AgNPs. The synthesis of mycosynthesized nanoparticles is easy, cheap, has simple synthesis steps, non-toxic and there's no use of hazardous chemicals. Different characterization by UV-VIS spectrophotometry, FTIR, XRD and SEM, supported the synthesis of AgA-Ag NPs. The immobilization of TH on AgNPs increased its activity as well as its stability and catalytic efficiency. Immobilized TH was found to produce more L-Dopa as compared to free enzyme. Furthermore, immobilized TH consumed more L-tyrosine as compared to free enzyme. The synthesis of green silver nanoparticles is favored because it is easy to produce with low toxicity. It also plays a vital role in human health and safety. Further, scale-up studies are required to improve the activity of TH to produce L-dopa. + +
Acknowledgements The authors would like to extend their sincere appreciation to the Researchers Supporting Project, King Saud University, Riyadh, Saudi Arabia for funding this work through the project number (RSP2024R457)
+ +
Author contributions Conceptualization, original draft writing, reviewing, and editing: Laraib Fatima, Sikander Ali, Muhammad Usman Ahmad, Qaiser Farid Khan. Formal analysis, investigations, funding acquisition, reviewing, and editing: Muhammad Umar Hayyat, Zafar Siddiq, Tawaf Ali Shah. Resources, data validation, data curation, and supervision: Yousef A. Bin Jardan, Sanjaykumar Patel, Youssouf Ali younous, Moham-med Bourhia.
+
Funding This work is financially supported by the Researchers Supporting Project (RSP2024R457). King Saud University, Riyadh, Saudi Arabia.
+ +
Data availability Data will be available upon request from the corresponding author.
+ +
Declarations Ethical approval and consent to participate Not applicable. Fig. 14 Evaluation of con-sumption of L-tyrosine using free enzyme and AgA-AgNPs over different time intervals for biotransformation
+ + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + +
Informed consent Not applicable. Competing interests The author declares that there is no competing interests. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adapta-tion, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/.
+ + References 1. Du D, Su Y, Shang Q, Chen C, Tang W, Zhang L, et al. Biomimetic synthesis of L-dopa inspired by tyrosine hydroxylase. J Inorg Biochem. 2022;234:111878. 2. Nagatsu T, Ikuko N. Tyrosine hydroxylase (TH), its cofactor tetrahydrobiopterin (BH4), other catecholamine-related enzymes, and their human genes in relation to the drug and gene therapies of Parkinson's disease (PD): historical overview and future prospects. J Neural Transm. 2016;123:1255-78. 3. Rausch WD, Wang F, Radad K. From the tyrosine hydroxylase hypothesis of Parkinson's disease to modern strategies: a short historical overview. J Neural Transm. 2022;129:487-95. 4. Nagatsu T, Nakashima A, Watanabe H, Ito S, Wakamatsu K. Neuromelanin in Parkinson's disease: tyrosine hydroxylase and tyrosinase. Int J Mol Sci. 2022;23:4176. 5. Ghazy E, Rahdar A, Barani M, Kyzas GZ. Nanomaterials for Parkinson disease: recent progress. J Mol Struct. 2021;1231:129698. 6. Baba Y, Futamura A, Kinno R, Nomoto S, Takahashi S, Yasumoto T, et al. The relationship between the distinct ratios of benserazide and carbidopa to levodopa and motor complications in Parkinson's disease: a retrospective cohort study. J Neurol Sci. 2022;437:120263. 7. O'Neil MJ. The Merck index: an encyclopedia of chemicals, drugs, and biologicals. 13th ed. Whitehouse Station, New Jersey, USA: Merck and Co., Inc.; 2001. 8. Ledeti I, Bolintineanu S, Vlase G, Circioban D, Ledeti A, Vlase T, et al. Compatibility study between anti parkinsonian drug Levodopa and excipients by FTIR spectroscopy, X-ray diffraction and thermal analysis. J Therm Anal Calorim. 2017;130:433-41. 9. Dhanasekaran D, Latha S, Saha S, Thajuddin N, Panneerselvam A. Extracellular biosynthesis, characterization and in-vitro antibacterial potential of silver nanoparticles using Agaricus bisporus. J Exp Nanosci. 2013;8:579-88. 10. Xu L, Yi WY, Huang J, Yuan CC, Xing WZ, Xie H. Silver nanoparticles: synthesis, medical applications and biosafety. Theranostics. 2020;10:8996. 11. Chakraborty B, Kumar RS, Abdulrahman A, Kotresha D, Muthuraj R, Pallavi SS, et al. Evaluation of antioxidant, antimicrobial and antipro-liferative activity of silver nanoparticles derived from Galphimia glauca leaf extract. J King Saud Univ Sci. 2021;33:101660. 12. Rudrappa M, Kumar RS, Nagaraja SK, Hiremath H, Gunagambhire PV, Almansour AI, et al. Myco-nanofabrication of silver nanoparticles by Penicillium brasilianum NP5 and their antimicrobial, photoprotective and anticancer effect on MDA-MB-231 breast cancer cell line. Antibiotics. 2023;12:567. 13. Rudrappa M, Rudayni HA, Assiri RA, Bepari A, Basavarajappa DS, Nagaraja SK, et al. Plumeria alba-mediated green synthesis of silver nanoparticles exhibits antimicrobial effect and anti-oncogenic activity against glioblastoma U118 MG cancer cell line. Nanomaterials. 2022;12:493. 14. Balakrishnan S, Sivaji I, Kandasamy S, et al. Biosynthesis of silver nanoparticles using Myristica fragrans seed (nutmeg) extract and its anti-bacterial activity against multidrug-resistant (MDR) Salmonella enterica serovar Typhi isolates. Environ Sci Pollut Res. 2017;24:14758-69. 15. Gopu M, Kumar P, Selvankumar T, et al. Green biomimetic silver nanoparticles utilizing the red algae Amphiroa rigida and its potent antibacterial, cytotoxicity and larvicidal efficiency. Bioprocess Biosyst Eng. 2021;44:217-23. 16. Muthusamy G, Thangasamy S, Raja M, et al. Biosynthesis of silver nanoparticles from Spirulina microalgae and its antibacterial activity. Environ Sci Pollut Res. 2017;24:19459-64. 17. Mythili R, Selvankumar T, Kamala-Kannan S, Sudhakar C, Ameen F, Al-Sabri A, et al. Utilization of market vegetable waste for silver nano-particle synthesis and its antibacterial activity. Mater Lett. 2018;225:101-4. 18. Chinnappan S, Kandasamy S, Arumugam S, et al. Biomimetic synthesis of silver nanoparticles using flower extract of Bauhinia purpurea and its antibacterial activity against clinical pathogens. Environ Sci Pollut Res. 2018;25:963-9. 19. Chakraborty B, Bhat MP, Basavarajappa DS, Rudrappa M, Nayaka S, Kumar RS, et al. Biosynthesis and characterization of polysaccharide-capped silver nanoparticles from Acalypha indica L. and evaluation of their biological activities. Environ Res. 2023;225:115614. 20. Bhat MP, Kumar RS, Almansour AI, Arumugam N, Dupadahalli K, Rudrappa M, et al. Characterization, antimicrobial activity and anticancer activity of Pyrostegia venusta leaf extract-synthesized silver nanoparticles against COS-7 cell line. Appl Nanosci. 2023;13:2303-14. 21. Bhat MP, Kumar RS, Rudrappa M, Basavarajappa DS, Swamy PS, Almansour AI, et al. Bio-inspired silver nanoparticles from Artocarpus lakoocha fruit extract and evaluation of their antibacterial activity and anticancer activity on human prostate cancer cell line. Appl Nanosci. 2023;13:3041-51. 22. Hasan S. A review on nanoparticles: their synthesis and types. Res J Recent Sci. 2015;4:1-3. 23. Zhang XF, Liu ZG, Shen W, Gurunathan S. Silver nanoparticles: synthesis, characterization, properties, applications, and therapeutic approaches. Int J Mol Sci. 2016;17:1-14. 24. Rauwel P, Rauwel E, Ferdov S, Singh MP. Silver nanoparticles: synthesis, properties, and applications. Adv Mater Sci Eng. 2015. https:// doi. org/ 10. 1155/ 2015/ 624394. + + Vol.:(0123456789) + + Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 Research + + 25. Owaid MN, Naeem GA, Muslim RF, Oleiwi RS. Synthesis, characterization and antitumor efficacy of silver nanoparticle from Agaricus bisporus pileus. Basidiomycota Wala J Sci Technol. 2020;17:75-87. 26. Arnow LE. Colorimetric determination of the components of L-3,4-dihydroxyphenylalanine-tyrosine mixture. J Biol Chem. 1937;118:531-7. 27. Bhatia NM, Bage R, Khade V, Ashtekar S, Bhatia M. Isolation, bioassay development and applications of tyrosine hydroxylase. Turk J Pharm Sci. 2019;10:4274. 28. Petkova GA, Zaruba K, Zvatora P, Kral V. Gold and silver nanoparticles for biomolecule immobilization and enzymatic catalysis. Nanoscale Res Lett. 2012;7:1-10. 29. Bhat R, Deshpande R, Ganachari SV, Huh DS, Venkataraman A. Photo-irradiated biosynthesis of silver nanoparticles using edible mushroom Pleurotus florida and their antibacterial activity studies. Bioinorg Chem Appl. 2011. https:// doi. org/ 10. 1155/ 2011/ 650979. 30. Aygun A, Ozdemir S, Gulcan M, Cellat K, Sen F. Synthesis and characterization of Reishi mushroom-mediated green synthesis of silver nanoparticles for the biochemical applications. J Pharm Biomed Anal. 2020;178:112970. 31. Daspattanaik ET. Metallography laboratory manual department of metallurgical engineering Orissa School of Mining Engineering, Keon-jhar experiment-1. 1956. 32. Doostmohammadi A, Monshi A, Salehi R, Fathi MH, Golniya Z, Daniels AU. Bioactive glass nanoparticles with negative zeta potential. Ceram Int. 2011;37:2311-6. 33. Liu Y, Hou C, Jiao T, Song J, Zhang X, Xing R. Self-assembled AgNP-containing nanocomposites constructed by electrospinning as efficient dye photo catalyst materials for wastewater treatment. Nanomaterials. 2018;8:35. 34. Winder AJ, Harris H. New assays for the tyrosine hydroxylase and dopa oxidase activities of tyrosinase. Eur J Biochem. 1991;198:317-26. 35. Zaidi KU, Ali AS, Ali SA. Purification and characterization of melanogenic enzyme tyrosinase from button mushroom. Enzyme Res. 2014;5:1-6. 36. Manzoor-ul-Haq VR, Singh D, Singh AK, Ninganagouda S, Hiremath J. Dried mushroom Agaricus bisporus mediated synthesis of silver nanoparticles from Bandipora District (Jammu and Kashmir) and their efficacy against methicillin resistant Staphylococcus aureus (MRSA) strains. Int J Nanosci Nanotechnol. 2015;5:1-8. 37. Bamigboye CO, Oloke JK, Burton M, Dames JF, Lateef A. Optimization of the process for producing biomass and exopolysaccharide from the king tuber oyster mushroom, Pleurotus tuber-regium (Agaricomycetes), for biotechnological applications. Int J Med Mushrooms. 2019;21:311-22. 38. Kameda E, Langone MAP, Coelho MAZ. Tyrosinase extract from Agaricus bisporus mushroom and its natural tissue for specific phenol removal. Environ Technol. 2006;27:1209-15. 39. Peterson ME, Daniel RM, Danson MJ, Eisenthal R. The dependence of enzyme activity on temperature: determination and validation of parameters. Biochem J. 2007;402:331-7. 40. Jagadish LK, Krishnan VV, Shenbhagaraman R, Kaviyarasan V. Comparitive study on the antioxidant, anticancer and antimicrobial property of Agaricus bisporus (JE Lange) Imbach before and after boiling. Afr J Biotechnol. 2009;8:654-61. 41. Awwad AM, Salem NM. Green synthesis of silver nanoparticles by Mulberry leaves extract. Nanoscale Res Lett. 2012;2:125-8. 42. XuJie H, Wei C. Optimization of extraction process of crude polysaccharides from wild edible Bachu mushroom by response surface methodology. Carbohydr Polym. 2008;72:67-74. 43. Narasimha G, Praveen B, Mallikarjuna K, Deva PRB. Mushrooms Agaricus bisporus mediated biosynthesis of sliver nanoparticles, charac-terization and their antimicrobial activity. Int J Nano Dimens. 2011;2:29-36. 44. Aygun A, Ozdemir S, Gulcan M, Cellat K, Sen F. Synthesis and characterization of Reishi Mushroom-mediated green synthesis of silver nanoparticles for biochemical applications. J Pharm Biomed Anal. 2019. https:// doi. org/ 10. 1016/j. jpba. 2019. 112970. 45. Anandalakshmi K, Venugobal J, Ramasamy V. Characterization of silver nanoparticles by green synthesis method using Pedalium murex leaf extract and their antibacterial activity. Appl Nanosci. 2016;6:399-408. 46. Kutsevol N, Chumachenko V, Rawiso M, Shyichuk A. Green synthesis of silver nanoparticles using dextran-graft-polyacrylamide as tem-plate. Micro Nano Lett. 2016;11:256-9. 47. Abdollahi K, Yazdani F, Panahi R. Covalent immobilization of tyrosinase onto cyanuric chloride crosslinked amine-functionalized super-paramagnetic nanoparticles: synthesis and characterization of the recyclable nanobiocatalyst. Int J Biol Macromol. 2017;94:396-405. 48. He Y, Wei F, Ma Z, Zhang H, Yang Q, Yao B, et al. Green synthesis of silver nanoparticles using seed extract of Alpinia katsumadai, and their antioxidant, cytotoxicity, and antibacterial activities. RSC Adv. 2017;7:39842-51. 49. Salayová A, Bedlovičová Z, Daneu N, Baláž M, Lukáčová Bujňáková Z, Balážová Ľ, et al. Green synthesis of silver nanoparticles with anti-bacterial activity using various medicinal plant extracts: Morphology and antibacterial efficacy. Nanomaterials. 2021;11:1005. 50. Jain S, Mehata MS. Medicinal plant leaf extract and pure flavonoid mediated green synthesis of silver nanoparticles and their enhanced antibacterial property. Sci Rep. 2017;7:15867. 51. Hu D, Gu X, Si W, Qin W, Jiao J, Hao Y. Biosynthesis of Silver nanoparticles using Bauhinia acuminate flower extract and their effect to promote osteogenesis of MSCs and improve meniscus injury healing. J Photochem Photobiol B. 2019;197:111536. 52. Tie D, Feyerabend F, Mueller W-D, Schade R, Liefeith K, Kainer KU, et al. Antibacterial biodegradable Mg-Ag alloys. Eur Cell Mater. 2013;25:284-98. 53. Ali LF, Soundararajan R, Jeyasurya S, Kovarthanam M, Prasath SN. Metallurgical assessment of AA7075-T6 with x wt% tungsten carbide nanoparticle surface composites processed by FSP route. Mater Today Proc. 2021;45:2152-8. 54. Faisal S, Khan MA, Jan H, Shah SA, Shah S, Rizwan M, et al. Edible mushroom (Flammulina velutipes) as biosource for silver nanoparticles: from synthesis to diverse biomedical and environmental applications. Nanotechnology. 2020;32:065101. 55. Prakasham RS, Kumar BS, Kumar YS, Shankar GG. Characterization of silver nanoparticles synthesized by using marine isolate Streptomyces albidoflavus. J Microbiol Biotechnol. 2012;22:614-21. 56. Mohanta YK, Singdevsachan SK, Parida UK, Panda SK, Mohanta TK, Bae H. Green synthesis and antimicrobial activity of silver nanoparticles using wild medicinal mushroom Ganoderma applanatum (Pers.) Pat. from Similipal Biosphere Reserve, Odisha, India. IET Nanobiotechnol. 2016;10:184-9. 57. Loshchinina EA, Vetchinkina EP, Kupryashina MA, Kursky VF, Nikitina VE. Nanoparticles synthesis by Agaricus soil basidiomycetes. J Biosci Bioeng. 2018;126:44-52. + + Vol:.(1234567890) + + Research Discover Life (2024) 54:4 | https://doi.org/10.1007/s11084-024-09647-4 + + 58. Hulikere MM, Joshi CG. Characterization, antioxidant and antimicrobial activity of silver nanoparticles synthesized using marine endo-phytic fungus-Cladosporium cladosporioides. Process Biochem. 2019;82:199-204. 59. Munjal N, Sawhney SK. Stability and properties of mushroom tyrosinase entrapped in alginate, polyacrylamide and gelatin gels. Enzyme Microb Technol. 2002;30:613-9. 60. Marín-Zamora ME, Rojas-Melgarejo F, García-Cánovas F, García-Ruiz PA. Stereospecificity of mushroom tyrosinase immobilized on a chiral and a nonchiral support. J Agric Food Chem. 2007;55:4569-75. 61. Tan D, Zhao J-P, Ran G-Q, Zhu X-L, Ding Y, Lu X-Y. Highly efficient biocatalytic synthesis of l-DOPA using in situ immobilized V errucomi-crobium spinosum tyrosinase on polyhydroxyalkanoate nano-granules. Appl Microbiol Biotechnol. 2019;103:5663-78. + +
Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
+ + + + diff --git a/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41467-024-52091-1.training.segmentation.tei.xml b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41467-024-52091-1.training.segmentation.tei.xml new file mode 100644 index 0000000000..2441f144ad --- /dev/null +++ b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41467-024-52091-1.training.segmentation.tei.xml @@ -0,0 +1,103 @@ + + + + + + + Article https://doi.org/10.1038/s41467-024-52091-1 Small LEA proteins mitigate air-water interface damage to fragile cryo-EM samples during plunge freezing Kaitlyn M. Abe 1 , Gan Li 1,2 , Qixiang He 1 , Timothy Grant 1,2 & Ci Ji Lim 1 Air-water interface (AWI) interactions during cryo-electron microscopy (cryo-EM) sample preparation cause significant sample loss, hindering structural biology research. Organisms like nematodes and tardigrades produce Late Embryogenesis Abundant (LEA) proteins to withstand desiccation stress. Here we show that these LEA proteins, when used as additives during plunge freezing, effectively mitigate AWI damage to fragile multi-subunit molecular samples. The resulting high-resolution cryo-EM maps are comparable to or better than those obtained using existing AWI damage mitigation methods. Cryogenic electron tomography reveals that particles are localized at specific interfaces, suggesting LEA proteins form a barrier at the AWI. This interaction may explain the observed sample-dependent preferred orientation of parti-cles. LEA proteins offer a simple, cost-effective, and adaptable approach for cryo-EM structural biologists to overcome AWI-related sample damage, potentially revitalizing challenging projects and advancing the field of struc-tural biology. + + The "resolution revolution" of cryogenic-electron microscopy (cryo-EM) marked a significant shift in the field of structural biology 1 . How-ever, the continued growth of cryo-EM single-particle analysis faces a critical problem, namely sample damage that occurs during grid preparation 2-9 . The standard method for cryo-EM single-particle ana-lysis sample preparation is plunge freezing, where small volumes of sample are applied onto a pretreated cryo-EM grid, blotted, and rapidly plunged into a cryogen such as liquid ethane (Fig. 1a). This process forms a thin layer (~10-100 nm) 5,10 of sample-embedded vitr-eous ice for transmission electron microscopy imaging 11,12 (Fig. 1b). Between the blotting and rapid freezing steps, the sample exists as a thin aqueous film with a high surface-to-volume ratio. During this transitional phase (typically lasting for seconds), the proteins in the aqueous solution collide with the air-water interface (AWI) thousands of times before finally being vitrified 5,9 . Adsorption to the AWI can destroy the protein's structural integrity, causing it to denature, or disintegrate 2,5,7,13 (Fig. 1c). In a scenario where the protein maintains its structure after AWI adsorp-tion, the sample interaction with the AWI may be biased towards certain regions, leading to preferred sample orientations and an ani-sotropic 3D reconstruction of the sample 2,3,14,15 . To mitigate the AWI problem, researchers have developed a variety of solutions. These include the addition of mild detergents to the sample 16,17 , using che-mical crosslinking 18-21 , and adsorbing or tethering samples to surfaces to prevent sample contact with the AWI 4,22-30 . More sophisticated techniques involve rapidly freezing the sample before the proteins can diffuse to the AWIs 30-35 . However, these methods are often technically challenging, cost-prohibitive and demonstrate sample-specific results. Here we show an AWI mitigation strategy that is accessible, cost-effective, and readily deployable in all cryo-EM facilities and research laboratories. Results AavLEA1 mitigates AWI damage to fragile cryo-EM samples during grid plunge freezing In search of a new solution to mitigate AWI damage, we explored the biological world, hypothesizing that cellular response mechanisms to desiccation stress could offer an evolved solution for mitigating + + Received: 17 February 2024 Accepted: 27 August 2024 Check for updates 1 Department of Biochemistry, University of Wisconsin-Madison, Madison, WI 53706, USA. 2 John and Jeanne Rowe Center for Research in Virology, Morgridge Institute for Research, Madison, WI 53715, USA. e-mail: ciji.lim@wisc.edu Nature Communications | (2024) 15:7705 1 1234567890():,; 1234567890():,; + + protein damage caused by AWI interaction. We identified late embry-ogenesis abundant (LEA) proteins 36-38 , specifically a group 3 LEA pro-tein, AavLEA1, from the roundworm (nematode) Aphelenchus avenae 39 as a potential candidate. Studies have indicated that AavLEA1, which has a molecular weight of ~16 kDa, prevents protein aggregation due to desiccation 39 . This is likely due to the formation of an AavLEA1 barrier which mitigates damage caused by direct interaction of the sample with the AWI 38 . We thus propose that AavLEA1 can be used as a sample additive to mitigate damage to protein samples caused by AWI inter-action during cryo-EM grid plunge freezing (Fig. 1d). The relatively small molecular mass of AavLEA1 (approximately 16 kDa) compared to a typical sample of interest (several hundred kDa) should allow Aav-LEA1 to reach the AWI faster than the larger samples. To evaluate the AWI damage mitigation effects of LEA proteins, we used two protein complexes that are AWI-sensitive as model sys-tems: human DNA polymerase-α-primase (PP) 40-42 and Polycomb repressive complex 2 (PRC2) 20,43,44 . It is important to note that in this study, both complexes were tested in their apo-state, and all data collection was performed using a 200 keV electron microscope with a direct electron detector (for details, please see the Methods section). Reported cryo-EM structures of apo-state PP complexes were solved using chemically crosslinked samples 42 , suggesting that the PP parti-cles fell apart due to AWI damage during plunge freezing. Another arguably more challenging structure to solve for cryo-EM single-par-ticle analysis is that of PRC2. Reported PRC2 cryo-EM structures were solved by highly specialized strategies using either chemically crosslinked samples on thin carbon-support grids 20,45 or biotinylated samples tethered onto Streptavidin-crystal grids 43,44 . We found that the addition of AavLEA1 to PP and PRC2 before freezing eliminates the need for the abovementioned methods, allowing us to solve their structures at comparable or higher resolu-tions (Fig. 2). The optimal addition amount was found to be between 1:8-1:40 molar ratio of the sample to the LEA proteins (Supplementary Figs. 1-3). The addition of AavLEA1 at a 1:40 PP:AavLEA1 molar ratio before plunge freezing led to considerably better grids than freezing the PP sample alone; with clear and homogeneously sized particles (Fig. 2a). Multiple high-resolution two-dimensional (2D) class averages of PP were obtained from these particles (Fig. 2b), and subsequent image processing led to a 3.0 Å global resolution map of the apo-state PP (Fig. 2c and Supplementary Fig. 3). This is the highest resolution cryo-EM map reported for the human apo-state PP; the previous X-ray structure was solved at 3.6 Å 46 and a chemically crosslinked cryo-EM structure determined at a 3.8 Å global resolution 42 . Most importantly, we demonstrated that AavLEA1 can be used to mitigate sample damage from AWI interactions during plunge freezing, resulting in high-resolution cryo-EM maps. Initially, we had some potential concerns with the AavLEA1 approach. Firstly, the addition of AavLEA1 could have led to an ele-vated background signal in the micrograph. Secondly, interaction with AavLEA1 could have distorted the sample conformation. Given that we obtained a 3.0 Å resolution cryo-EM map for human PP apo-state complex in the presence of excess AavLEA1 (sample:AavLEA1 of 1:40), we deduce that background AavLEA1 did not significantly affect image alignment or hinder high-resolution reconstruction. Additionally, we did not find any extra map density that would indicate AavLEA1 bind-ing to PP in a consistent manner, nor a significant change in the PP conformation; we calculated a RMSD of 1.2 Å when a refined model derived from the 3.0 Å cryo-EM map was aligned to a published crystal structure of an apo-state human PP (PDB: 5EXR) 46 (Supplementary Figs. 4, 5 and Table 1). In short, AavLEA1 addition did not alter the PP apo-state conformation. We saw similar results for PRC2 with the addition of AavLEA1 (1:40 PRC2:AavLEA1 molar ratio)-Adding AavLEA1 resulted in clear and homogeneously sized particles (Fig. 2d). Without additives, we saw smaller sized particles in the micrographs, indicating broken PRC2 complexes, consistent with previous studies 47 . Subsequent cryo-EM image processing led to a 3.8 Å global resolution map of PRC2 (Fig. 2e, f and Supplementary Fig. 6). This result further exemplifies the efficacy of AavLEA1 in facilitating the determination of high-resolution cryo-EM structures of protein samples sensitive to the air-water interface. A truncated form of LEA protein from tardigrade also mitigates AWI sample damage Encouraged by the success of using nematode AavLEA1 to mitigate AWI sample damage, we pondered whether LEA proteins from other organisms could provide comparable results. Tardigrades, also known as water bears, are tolerant of desiccation stress 48 , and the species Ramazzottius varieornatus has a group 3 LEA protein, RvLEAM 49 . Because RvLEAM has nine LEA-like motifs and is about 30 kDa in mass, we truncated it to ~15 kDa to increase its diffusion coefficient and match the size of AavLEA1 for ease of comparison (refer to the Meth-ods section for details). The truncated RvLEAM is hereafter termed RvLEAM short . Similar to AavLEA1, adding RvLEAM short to PP or PRC2 sample at a molar ratio of 1:6 sample:RvLEAM short before plunge freezing led to the appearance of monodisperse and discernable particles (Fig. 3). From datasets collected over a single night, we successfully reconstructed cryo-EM maps of human apo-state PP and PRC2 at a reported global resolution of 4.5 and 3.7 Å, respectively (Fig. 3c, f and Supplementary Figs. 7, 8). The final resolution of PP and RvLEAM short in this dataset is lower than our other PP dataset because significantly fewer movies Cryo-EM SPA grid preparation robot Cryo-EM SPA grid Example of regularly-spaced holey grid with vitrified ice Ideal sample distribution in thin film of vitrified ice Holey carbon film Holes for vitrified sample Carbon film Typical sample distribution in thin film of vitrified ice Air Water Preferred orientation Complex dissociation Protein denaturation Vitrified sample Rescued sample distribution in thin film of vitrified ice with LEA proteins LEA-water interface (LWI) forming a barrier at AWI LEA protein a b c d Severity of AWI damage to sample Fig. 1 | Cryo-EM sample grid preparation and potential role of LEA proteins on AWI damage mitigation. Cartoon illustration of the process and outcomes of preparing cryo-EM SPA grids and the hypothesized effects of LEA proteins on sample structural integrity. a Shows a Cryo-EM SPA grid preparation robot along-side a detailed view of a typical holey grid with vitrified ice, which is used for embedding protein samples. b-d Depict different states of protein sample dis-tribution within the vitrified ice. In panel (b), an ideal sample distribution is shown where proteins are evenly dispersed without any structural damage. c Illustrates the typical impact of air-water interface (AWI) damage on protein samples, leading to preferred orientation, complex dissociation, and protein denaturation. d Demonstrates how LEA proteins can mitigate sample damage by forming a barrier at the AWI, which significantly mitigates these damages and preserves protein integrity in vitrified ice. + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 2 + + were collected (see methods). Given that this is the second LEA protein we have tested that successfully rescued the cryo-EM structure determination of two challenging AWI-sensitive protein complexes, we believe group 3 LEA proteins, as a cryo-EM single-particle analysis sample additive, offers a promising and powerful method for struc-tural biologists to mitigate sample damage caused by AWI during plunge freezing. Samples with LEA protein addition distribute at vitrified ice surfaces While our prediction that LEA proteins mitigate AWI damage was correct, our initial hypothesis about the mechanism of LEA-mediated AWI damage mitigation proved inaccurate. We speculated that once the LEA proteins formed a barrier at the AWI, which we termed the LEA-water interface (LWI), the sample particles would remain in the aqu-eous layer. When imaged in vitreous ice after plunge freezing, we expected the projected views of the frozen particles to be randomly distributed (Fig. 1). However, a major underlying assumption was that there was no interaction between the sample and the LWI. If such interactions exist, they would manifest as a bias in the particle orien-tation (view projection) 6,17 . Our particle orientation distribution ana-lysis for the cryo-EM maps derived from the LEA protein datasets suggests this was the case (Fig. 4a and Supplementary Table 2). Cal-culations from the 3DFSC server 14 indicated that the PP maps show a good isotropic distribution, approaching perfect isotropy with a sphericity of 0.98 for those with AavLEA1 and 0.83 with RvLEAM short . Conversely, the PRC2 maps exhibited poorer particle orientation dis-tribution, regardless of the LEA protein used; sphericity values were 0.77 and 0.79 for maps with AavLEA1 and RvLEAM short , respectively. Overall, these results suggest that the samples interact with the LWI to varying degrees, dependent on the specific sample. If the samples are indeed interacting with the interface, the par-ticles should be distributed as plane(s). To test this, we used fiducial-less cryo-electron tomography (cryo-ET) analysis to visualize the par-ticle distribution of PP with AavLEA1 (1:40 molar ratio) and PRC2 with RvLEAM short (1:6 molar ratio) in our grids (Fig. 4b, c and Supplementary Movies 1, 2). In both cases, we saw most of the particles were dis-tributed within one or two planes in the vitrified ice, confirming that the samples were adsorbed to a surface in the presence of LEA proteins. Due to the small sizes of LEA proteins, we were unable to visualize them in our cryo-EM images directly, preventing us from determining their empirical coverage at the AWI. Consequently, we cannot rule out the possibility of incomplete LEA protein coverage, and that the par-ticle orientation bias could have resulted, in part or entirely, from interactions with exposed pockets of the AWI. If this is indeed the case, it is reassuring to note that these interactions with the AWI, in the presence of LEA proteins, did not significantly compromise the sam-ples' structural integrity, as demonstrated by the reconstructed high-resolution cryo-EM maps of the tested samples (Figs. 2, 3). Biochemical strategies to improve particle orientation dis-tribution of LEA datasets Given that interactions between the sample and LEA proteins at the LWI can contribute to the observed particle orientation bias, we aimed to explore strategies that influenced these interactions to achieve a desirable particle orientation outcome. Both AavLEA1 and RvLEAM short are predicted to form amphiphilic alpha-helical structures, with the hydrophobic face oriented towards the air at the AWI and the hydro-philic side (negatively charged) facing the aqueous solution 49,50 . Thus, the negatively charged, solution-facing side of the LWI could create a "sticky" surface that leads to the particle orientation bias observed in the LEA datasets. Past studies have demonstrated that electrostatic charge on a surface, whether AWI or carbon film, can influence sample particle orientation 51,52 . Using PRC2 and RvLEAM short as the model condition, a b c 90°1 00 Å 2D class averages Representative micrographs and their CTFs PP alone PP + AavLEA1 (1:40) Global resolution: 3.0 Å 100 Å d PRC2 alone PRC2 + AavLEA1 (1:40) 90°G lobal resolution: 3.8 Å 100 Å e f Representative micrographs and their CTFs 100 Å 2D class averages 90 nm 90 nm 90 nm 90 nm Fig. 2 | High-resolution cryo-EM structure determination of fragile human Polymerase alpha-Primase and Polycomb repressive complex 2 using nema-tode AavLEA1. Cryo-EM single-particle analysis of human polymerase α-primase complex (PP), (a-c), and polycomb repressive complex 2 (PRC2), panels (d-f), both with the addition of Nematode AavLEA1. a, d Display representative micrographs and CTFs-cropped up to the ice ring for the complexes both alone and with AavLEA1 added at a 1:40 ratio, highlighting improved sample preservation due to LEA protein addition. Representative micrographs were chosen out of 42 (a) top, 4403 (a) bottom, 5 (d) top, and 2843 (d) bottom. b, e Depict 2D class averages, illustrating defined and consistent particle shapes with visible protein features when AavLEA1 was used. Finally, c, f show reconstructed cryo-EM maps of the complexes from the AavLEA1 datasets, presented in two orientations. + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 3 + + we added a divalent cation, MgCl 2 , to the sample buffer to neutralize the negatively charged LWI surface, with the hope that this strategy would change the PRC2 particle orientation distribution. However, this approach did not improve the particle orientation distribution and instead made it worse with more limited views (Supplementary Fig. 9). Next, we investigated the effect of mild glutaraldehyde cross-linking on PRC2 prior to freezing with RvLEAM short to determine if this could improve particle orientation distribution. Our rationale was that the glutaraldehyde reaction would neutralize the positively charged groups on the surface of PRC2 and lead to particle orientation dis-tribution changes, as has been demonstrated by past studies 18,19,52 . Chemical crosslinking also has the benefit of stabilizing the complex for improved structural homogeneity 18,19 . We collected cryo-EM data-sets of crosslinked PRC2 with RvLEAM short at a 1:6 sample:LEA molar ratio; the PRC2 samples were crosslinked with glutaraldehyde for 2 and 10 min (Supplementary Fig. 10). Our analysis indicated that chemical crosslinking improved the orientation distribution of PRC2 particles (Fig. 5a and Supplementary Figs. 11, 12). The map sphericity increased from 0.79 in non-crosslinked samples to 0.83 after 2 min of crosslinking. Extending the crosslinking to 10 min further enhanced this value to 0.97 (Supplementary Table 2). This incremental improvement suggests that longer crosslinking durations may be slightly more effective. The 10 min crosslinked sample dataset enabled us to achieve a 3.1 Å global resolution cryo-EM map of the PRC2 complex (Fig. 5b). This map represents the highest resolution yet reported for the human PRC2 apo-state complex. Given that the map was reconstructed from a dataset collected on a 200 kV microscope, using a 300 kV microscope could potentially yield an even higher resolution. Our PRC2 model, built using this cryo-EM map, has a structure similar to that obtained through the streptavidin-biotin affinity EM grid approach 25,44 , with the RMSD between the two aligned structures being 0.89 Å (Supplementary Figs. 13, 14 and Supplemen-tary Table 3). A control 10 min crosslinked PRC2 cryo-EM dataset without RvLEAM short was also collected to determine the effect of adding LEA proteins crosslinked samples. While discernable and somewhat homogeneous particles were observed, the subsequent single-particle analysis revealed that most particles were broken subcomplexes of PRC2 (Supplementary Fig. 15), a result consistent with a previous study 47 . Nonetheless, we obtained a 4.3 Å cryo-EM map of an intact PRC2 complex (Supplementary Fig. 15), although the efficiency was modest; from 3274 movies, ~1.7 million particles were picked, but only about ~3% contributed to the final cryo-EM map reconstruction (Sup-plementary Fig. 15). In contrast, with the addition of RvLEAM short , ~14% of initially picked particles (~2.5 million particles) were utilized in the final reconstruction (Supplementary Fig. 12). Furthermore, particles from the crosslinked control dataset suffered from biased particle orientation, with a 3DFSC calculated sphericity value of 0.66. The inclusion of RvLEAM short improved the sphericity value to 0.97 (Sup-plementary Table 2). Overall, the above comparison suggests the addition of RvLEAM short enhanced the stability and particle orientation distribution of crosslinked PRC2 complexes. Comparative analysis of LEA proteins and CHAPSO as AWI damage mitigation strategies CHAPSO, a zwitterionic detergent, can mitigate AWI damage to protein samples during plunge freezing 17,53 . In our hands, it is an effective strategy for determining the high-resolution cryo-EM structures of PP-related complexes 40,54 . Hence, we wanted to compare LEA protein's efficiency in obtaining a high-resolution cryo-EM structure against that of CHAPSO. To this end, we determined a 3.4 Å cryo-EM map of apo-state PP using CHAPSO (Fig. 6a and Supplementary Fig. 16). By visual inspection, we found no discernable differences between the two cryo-EM maps or modeled structures (compared to the 40:1 AavLEA1:PP cryo-EM map, Supplementary Figs. 17, 18 and Table 1). However, three separate empirical analyses, Reslog 55 (Fig. 6b), per-particle spectral signal-to-noise (ppSSNR) 56 (Fig. 6c), and Rosenthal-Henderson 57 (Supplementary Fig. 19) plots, all pointed to the AavLEA1 dataset having the better particle image quality. It is possible that thicker ice in the CHAPSO dataset impacted particle image quality, explaining the observed differences. Nonetheless, our results demonstrate that Aav-LEA1, when used as a sample additive, can achieve cryo-EM map quality comparable to, or even better than, that obtained with detergents. A major advantage of using AavLEA1 over CHAPSO, or other detergents, is its effectiveness when cryo-EM samples are limited or unstable at high concentrations. CHAPSO and similar detergents typically require high sample concentrations 51,58 -over 4 mg/mL or ~13 μM for a 300 kDa protein sample-which can be challenging for precious samples. In contrast, with AavLEA1, we used only 1-1.5 μM of sample protein, which is more than ten times less than that required for CHAPSO or detergents in general. While the application of LEA a b c 100 Å 2D class averages Representative micrograph and CTF PP + RvLEAMshort (1:6) 100 Å d e f 100 Å Representative micrograph and CTF PRC2 + RvLEAMshort (1:6) 2D class averages 100 Å Global resolution: 4.5 Å Global resolution: 3.7 Å 90°9 0°9 0 nm 90 nm Fig. 3 | A truncated form of LEA protein from tardigrade also mitigates AWI sample damage. Cryo-EM single-particle analysis of protein complexes with RvLEAM short . a, d Display representative micrographs and CTFs-cropped up to the ice ring-out of the 1308 and 3896 collected respectively of the polymerase-primase complex (PP) and Polycomb repressive complex 2 (PRC2), each treated with RvLEAM short at a molar ratio of 1:6. b, e Show 2D class averages, which demonstrate the structural homogeneity and quality of the sample with RvLEAM short added. c, f Present the reconstructed cryo-EM maps of PP and PRC2, depicted in two orientations, achieving resolutions of 4.5 and 3.7 Å, respectively. + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 4 + + proteins can lead to an anisotropic distribution of particle orientations (see Result section: Samples with LEA proteins addition distribute at vitrified ice surfaces and Fig. 4b, c), this issue does not arise with the use of CHAPSO. The particles in the CHAPSO dataset have an even distribution of particle orientations (Supplementary Fig. 16 and Table 2). Consequently, the calculated sphericity value of the PP cryo-EM map from the CHAPSO dataset is 0.99. Discussion In summary, we have shown that two group three LEA proteins, Aav-LEA1 from nematodes and RvLEAM (truncated) from tardigrades, can mitigate sample damage caused by sample interaction with the AWI during cryo-EM plunge freezing. We demonstrated the effects on two model multi-subunit protein complexes, human PP and PRC2, in the apo-state, both challenging targets for cryo-EM analysis. By simply adding AavLEA1 or RvLEAM short to the samples before plunge freezing, we determined the cryo-EM structures of both PP and PRC2 at com-parable, or better resolution than those previously reported using more challenging and complicated anti-AWI damage strategies 20,42-44,47 . It is important to note that these fragile samples did not yield any discernable monodisperse particles using standard plunge freezing methods. Therefore, our results underscore the effectiveness of LEA proteins in revitalizing cryo-EM projects that would otherwise be deemed unfeasible. While our study demonstrates the effectiveness of LEA proteins in mitigating AWI damage for PP and PRC2 complexes, further investigation is needed to determine their applicability to other macromolecular assemblies, membrane pro-teins, or smaller protein complexes. The LEA proteins require lower sample concentration com-pared to other AWI mitigation solutions, such as Spotiton 31-33 or detergents 51,58,59 , offering a significant advantage when working with limited samples or those prone to aggregation at high concentra-tions. Another common solution for accommodating low sample concentrations is the use of cryo-EM grids with support films. However, the quality of these specialized EM grids can vary due to production batch reproducibility, and they can be technically a Density of particles (normalized) 10 -3 10 -2 10 -1 2 min crosslinked PRC2 Sphericity = 0.83 10 min crosslinked PRC2 Sphericity = 0.97 b 90°G lobal resolution: 3.1 Å 100 Å Fig. 5 | Chemical crosslinking enhances the orientation distribution of PRC2 particles in the presence of RvLEAM short . a Displays Mollweide projections of the particle orientation distribution for the Polycomb repressive complex 2 (PRC2) treated with chemical crosslinking for 2 and 10 min, demonstrating improved isotropy as evidenced by the increased sphericity values of 0.83 and 0.97, respectively. b Shows the high-resolution cryo-EM maps of PRC2 crosslinked for 10 min, presented in two orientations to highlight the detailed structural features achieved, with a global resolution of 3.1 Å. b 100 200 300 400 500 600 700 250 200 150 50 100 PRC2 + RvLEAMshort (1:6) c Ice contamination PR C2 par ticl es Vit rifi ed ice 100 100 200 300 400 500 600 700 180 140 20 60 PP + AavLEA1 (1:40) Ice contamination Hole edge Vitrifie d ice PP partic les a PP + AavLEA1 (1:40) PP + RvLEAMshort (1:6) PRC2 + AavLEA1 (1:40) PRC2 + RvLEAMshort (1:6) Sphericity = 0.98 Sphericity = 0.83 Sphericity = 0.77 Sphericity = 0.79 Density of particles (normalized) 10 -3 10 -2 10 -1 nm nm nm nm Fig. 4 | Samples with LEA protein addition distribute at vitrified ice surfaces. Particle orientation distribution and cryo-electron tomography (cryo-ET) analysis for samples with LEA proteins addition. a Displays Mollweide projections that compare the particle distribution for the polymerase α-primase complex (PP) and Polycomb repressive complex 2 (PRC2) with AavLEA1 (1:40) and RvLEAM short (1:6) added respectively. Corresponding sphericity values demonstrate the degree of isotropy achieved in the cryo-EM map under each condition. b, c Show cryo-ET cross-sectional analysis of the spatial distribution of PP and PRC2 particles within the grid holes, respectively. These plots highlight the location of particles relative to the edge of the holes and identify regions affected by ice contamination. The axes are expressed in pixels, with a scale of 4.4 Å per pixel. + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 5 + + challenging to produce in research laboratories. Unlike these methods, the application of LEA proteins does not require specia-lized grids and is compatible with standard cryo-EM holey grids. While the utilization of LEA proteins can lead to preferred particle orientation problems and varying degrees of anisotropy depending on the sample, this issue is not insurmountable. It can be mitigated by employing chemical crosslinking 18 or tilted-stage data collection strategies 14 . Additionally, given that the proteins adhere to LEA-water interfaces, the molar ratio between the sample and LEA pro-teins may not be a key optimization parameter for sample grid plunge freezing. Rather, the concentration of LEA proteins used is important. In our hands, a minimum of 6 µM LEA proteins was suf-ficient to mitigate AWI damage to fragile samples. We believe that LEA proteins represent a promising avenue for structural biologists to revisit cryo-EM projects previously hindered by AWI issues, particularly those that have exhausted conventional AWI mitigation strategies. These proteins can be produced in large quan-tities using standard bacterial expression systems and purification schemes, providing a sustainable and cost-effective alternative to methods that rely on more expensive and perishable materials and reagents. Most importantly, the accessibility and economic benefits of LEA proteins enable any structural biology laboratory or cryo-EM facility to readily adopt this method, potentially revolutionizing their approach to cryo-EM structure determination. Methods Expression and purification of AavLEA1 and RvLEAM short The expression plasmid for HIS-tagged AavLEA1 was sourced from the Addgene plasmid repository [pET15b-AavLEA1, a gift from Claude Férec (Addgene plasmid # 53093)] 60 . The expression plasmid for HIS-tagged RvLEAM short was constructed by inserting a truncated cDNA from pEThT-RvLEAM [pEThT-RvLEAM was a gift from Takekazu Kunieda (Addgene plasmid # 90033)] 49 into a pET15b vector. RvLEAM short encodes residues 58-181 of RvLEAM (A0A0E4AVP3.1). Both recombinant AavLEA1 and RvLEAM short were expressed in Escherichia coli BL21 (DE3) cells. A single bacterial colony containing the transformed plasmid was cultured overnight in 2 mL of Luria Ber-tani broth (LB) with 100 µg mL -1 carbenicillin at 37 °C. This starter culture was then used to inoculate 1 L of LB supplemented with the same antibiotic. At an optical density (A600) of 0.6, gene expression was induced using 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 16 h at 12 °C and shaken at 230 rpm. Cells were harvested by centrifugation, resuspended in lysis buf-fer (50 mM HEPES pH 7.5, 300 mM NaCl, 10 mM imidazole, 1 mM DTT or TCEP, 1 mM PMSF), and lysed via sonication. The cell debris was then removed by centrifugation. The clarified lysate was incubated with pre-equilibrated nickel-NTA resin (Qiagen, Germany) and stirred for 1 h at 4 °C. The protein-bound resin was washed three times with 50 mL of lysis buffer. Proteins were eluted with 10 mL of elution buffer (wash buffer supplemented with 250 mM imidazole) using a gravity flow column. The proteins were then concentrated to ~500 μL using a 3 kDa MWCO spin column and further purified on a Superdex 75 10/300 size-exclusion chromatography (SEC) column (Cytiva, USA) pre-equilibrated with SEC buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 1 mM TCEP, 10% glycerol). Eluted fractions were analyzed by SDS-PAGE. Chosen fractions were pooled, concentrated, snap-frozen in 5-10 µL aliquots, and stored at -80 °C until use. The protein con-centration of the aliquots was determined using the Beer-Lambert equation, with absorbance measurements obtained from a NanoDrop spectrophotometer (Thermo Fisher, USA) and extinction coefficients calculated based on their protein sequences. a b 90°G lobal resolution: 3.4 Å 100 Å c ResLog Analysis Per-particle spectra SNR Analysis Batch size (log scale) Spatial frequency (1/Å) 0.20 0.22 0.24 0.26 0.28 0.30 0.32 10 3 10 4 10 5 AavLEA1 (1:40) CHAPSO (4 mM) CHAPSO AavLEA1 Ln(ppSSNR) Spatial frequency (1/Å) 0.35 0.30 0.25 0.20 0.15 0.10 0.05 -18 -16 -14 -12 -10 -8 -6 -4 Fig. 6 | Comparative evaluation of LEA Proteins and CHAPSO as AWI damage mitigation strategies. a Showcases the reconstructed cryo-EM map of the polymerase α-primase complex, visualized in two orientations, achieving a global resolution of 3.4 Å. b, c Detail the ResLog and per-particle spectra SNR (ppSSNR) analyses respectively, comparing the effects of AavLEA1 and CHAPSO addition on particle image data and map reconstruction quality. The ResLog analysis in panel (b) illustrates the spatial frequency improvements associated with each additive, plotted against batch size on a logarithmic scale, indicating that AavLEA1 out-performs CHAPSO at higher spatial frequencies. c Displays the logarithm of ppSSNR, demonstrating that AavLEA1 maintains higher SNR values across the majority of the spatial frequencies tested. Source data are provided as a Source Data file. + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 6 + + Production of recombinant human DNA polymerase alpha-primase Recombinant human Polα-primase was expressed and purified as previously described 54 . Briefly, Trichoplusia ni (T.ni) cells (Expression System) were infected with four baculoviruses (POLA1, POLA2, PRIM1, and PRIM2) for the co-expression of human Polα-primase. The infec-ted T.ni cells were collected for protein purification after 66-68 h post-infection. The human Polα-primase was obtained using a tandem affinity approach. First, His-tagged POLA2, PRIM1, and PRIM2 were captured using Ni-NTA agarose resin (Qiagen). The elute was then subjected to a second pull-down using Strep-Tactin XT 4Flow-resin (IBA LifeScience) for strep-tagged POLA1. The purified Polα-primase complex was verified using SDS-PAGE analysis. Production of recombinant human polycomb repressive complex 2 Purified recombinant human polycomb repressive complex 2 (PRC2) protein complexes were generously provided by Dr. Tom Cech at the University of Colorado Boulder 44 . PRC2 cryo-EM sample glutaraldehyde crosslinking Approximately 2 µM of PRC2 was incubated with a 0.1% (v/v) final concentration of glutaraldehyde for 2-and 10-min intervals. After each interval, an aliquot was removed and quenched with 80 mM Tris-HCl to stop the reaction. SDS-PAGE was then used to assess the crosslinking efficiency of the PRC2 samples at each incubation time point. All samples were thawed just prior to cryo-EM grid preparation. Holey carbon cryo-EM grids, either Quantifoil R 1.2/1.3 300 mesh Au or C-flat R 1.2/1.3 300 mesh Au, were glow discharged using a PELCO EasiGlow glow-discharge unit (15 mA for 30 s with a 10-s hold). These treated grids were used within 30 minutes. Protein samples were diluted to the working concentration immediately before application to the grid. Where indicated, the sample (~3.5 μL) was supplemented with LEA proteins, CHAPSO, or MgCl 2 just before being applied to the glow-discharged grid. Typically, the high-concentration LEA protein stock was first diluted to an intermediate working solution using the sample buffer and then mixed with the sample (e.g., 2 μL of LEA with 2 μL of the sample). The grid was then blotted for 4 to 6 s at 4 °C and 95% humidity before being plunged frozen into liquid ethane using a Vitrobot Mark IV (Thermo Fisher, USA). For all conditions except those specified, 1-1.5 μM of PP or PRC2 were used with the indicated molar ratio of AavLEA1 or RvLEAMshort. For conditions with PP and 4 mM CHAPSO, 13.8 μM of PP was utilized. Cryo-EM data collection All data collections and screenings were conducted on a Talos Arctica 200 kV TEM (Thermo Fisher Scientific, USA) equipped with a Gatan BioQuantum K3 direct electron detector (Gatan, USA). Data screening and acquisition were managed using either EPU (Thermo Fisher, USA) or SerialEM 61 . All cryo-EM datasets were collected at a pixel size of 1.064 Å/pixel, with a total dose of 50 e -Å -2 distributed across 40 frames. The CDS counting mode was utilized along with a 20 eV energy filter slit. The defocus range was set between -1 and -2.5 μm in 0.25-μm intervals. Cryo-EM data processing For all datasets, image processing was carried out using cryoSPARC 62 . In brief, movies were subjected to patch motion correction, and the aligned micrographs had their contrast transfer function (CTF) esti-mated. The CTF values were utilized to select a subset of micrographs deemed suitable for high-resolution single-particle analysis. Detailed procedures for subsequent image processing steps specific to each dataset are outlined below: 1.5 μM PP, 12 μM AavLEA1 (1:8) dataset. A total of 2764 movies were collected. After micrograph curation 2112 movies remained and 1,724,984 particles were extracted and binned 4x binning (4.3 Å/pixel). After 2D classification, 785,653 particles proceeded to ab initio reconstruction and were sorted into four separated reference-free 3D classes. Particles underwent another round of ab initio modeling and separated into two classes. The intact complex was re-extracted at 1.1 Å/pixel and was sorted into one of the two classes (239,029 parti-cles, 75%). Non-uniform refinement of this class with per-particle CTF refinement resulted in a global resolution (reported at Fourier shell correlation of 0.143) of 3.6 Å. 1.5 μM PP, 60 μM AavLEA1 (1:40) dataset. A total of 4403 movies were collected. After micrograph curation, 500 movies were initi-ally used, with a total of 340,430 particles extracted at 4x binning. From 2D classification, 201,337 particles were selected and re-extracted at the original pixel size. Particles then proceeded to ab initio reconstruction and were sorted into four separated reference-free 3D classes. Two of the four classes resulted in intact particles, which were verified through non-uniform refinement of the com-bined classes using 165,472 particles, resulting in a 3.8 Å structure. Particles were extracted from the remaining 3771 movies and bin-ned 4x, resulting in 2,668,602 particles. These particles were then sorted into 2D classes, and the selected 1,438,074 particles under-went ab initio modeling. Selected particles underwent another round of ab initio modeling with two classes. One of the two classes showed intact particles, and those 1,009,026 particles were sent to non-uniform refinement yielding a 3.4 Å global resolution. CryoS-parc global and local CTF refinement jobs were run, followed by further filtering, resulting in 988,417 particles. These particles were then extracted at the original pixel size, 1.1 Å/pixel. All resulting particles underwent non-uniform refinement, reference motion correction, and heterogeneous refinement. 856,205 particles were used for a final non-uniform refinement, with a final global resolu-tion of 3.0 Å. 1 µM PP, 6 µM RvLEAM short (1:6) dataset. A total of 1308 movies were collected. Following micrograph curation, 335,907 particles were extracted from 1076 micrographs and binned 4x. About 125,231 par-ticles were extracted with 2D classification. These particles then pro-ceeded to ab initio reconstruction and split into 3D classes. The selected 74,198 particles were re-extracted at the original pixel size (1.1 Å/pixel) from 1071 micrographs. Particles underwent another round of 2D classification and ab initio 3D reconstruction. Selected particles underwent non-uniform refinement and had a final global resolution of 4.5 Å. The final resolution of this dataset is lower than our other PP datasets which is likely because this data collection contains only 1308 movies while other PP datasets have 2700 or more movies. 13.8 μM PP, 4 mM CHAPSO dataset. A total of 4567 movies were collected. Following micrograph curation, 1,832,455 particles were extracted from 4510 micrographs and binned 4x. Particles underwent 2D classification where and ab initio reconstruction. Selected particles were re-extracted at the original pixel size of 1.1 Å/pixel (744,824 par-ticles). Extracted particles were then sorted into 2D classes and underwent non-uniform refinement with per-particle CTF refinement and reference motion correction, with a final global resolution of 3.4 Å with 674,793 particles. 1.5 μM PRC2, 60 μM AavLEA1 (1:40) dataset. A total of 2843 movies were collected. Following micrograph curation, 687,121 particles were extracted from 1642 micrographs and binned 4x. Particles underwent 2D classification and ab initio reconstruction. Selected classes were re-extracted at the original pixel size, 1.1 Å/pixel, yielding 150,359 parti-cles. The re-extracted particles underwent non-uniform refinement + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 7 + + with per-particle CTF refinement and resulted in a global resolu-tion of 3.8 Å. 1 μM PRC2, 6.7 μM RvLEAM short (~1:6) dataset. A total of 3896 movies were collected. Following micrograph curation, 1,766,944 particles were extracted from 3637 micrographs and binned 4x. Particles were sorted into 2D classes followed by 3D classes via ab initio recon-struction. The selected 547,610 particles were re-extracted at 1.1 Å/ pixel and subjected to ab initio 3D reconstruction. The final 206,807 particles underwent non-uniform refinement with per-particle CTF refinement, resulting in a global resolution of 3.7 Å. 1 μM PRC2, 6.7 μM RvLEAM short (~1:6) 10 mM MgCl 2 dataset. A total of 4333 movies were collected. Following micrograph curation, 1,755,138 particles were extracted from 3759 micrographs and bin-ned 4x. Particles underwent two rounds of 2D classification. From here, 408,373 particles were selected and proceeded to ab initio 3D reconstruction. The resulting 406,148 particles were re-extracted from 3746 movies at the original pixel size (1.1 Å/pixel) and under-went another round of ab initio reconstruction. The final 102,181 particles proceeded to non-uniform refinement with a final global resolution was 4.2 Å. 1 μM PRC2 crosslinked 2 min, 6.7 μM RvLEAM short (~1:6) dataset. A total of 2981 movies were collected. Following micrograph curation, 982,264 particles were extracted from 2189 movies and binned 4x. Particles were sorted into 2D classes followed by 3D classes via ab initio reconstruction. Selected particles were re-extracted at the original pixel size (1.1 Å/pixel) and underwent ab initio reconstruction again. The resulting 534,068 particles were subjected to non-uniform refinement with per-particle CTF refinement, resulting in a global resolution of 3.5 Å. 1 μM PRC2 crosslinked 10 min, 6.7 μM RvLEAM short (~1:6) dataset. A total of 3432 movies were collected. Following micrograph curation, 2,084,816 particles were extracted from 3295 movies and binned 4x. Particles underwent 2D classification followed by ab initio 3D recon-struction. Selected particles were re-extracted at the original pixel size (1.1 Å/pixel). Particles underwent non-uniform refinement, resulting in a global resolution of 3.3 Å. Global CTF refinement, reference-based motion correction, and heterogeneous refinement jobs were run. 366,459 particles were used in this final round of non-uniform refine-ment, resulting in a global resolution of 3.1 Å. 1 μM PRC2 crosslinked 10 min dataset. A total of 3274 movies were collected. Following micrograph curation, 1,231,903 particles were extracted from 3274 movies and binned 4x. Particles underwent 2D classification followed by ab initio 3D reconstruction. Selected particles were re-extracted at the original pixel size (1.1 Å/pixel) and underwent a second batch of ab initio 3D reconstruction, reference-based motion correction non-uniform refinement. The final 51,494 particles resulted in a global resolution of 4.3 Å. Cryo-EM structure modeling and refinement The published apo-state models of Polymerase alpha-primase (PP, PDB: 5EXR) 46 and Polycomb Repressive Complex 2 (PRC2, PDB: 8FYH) 44 were used as initial models for real-space refinement against their respective cryo-EM maps using Phenix 63 . Structural alignments between the published models and the refined models were per-formed using the MatchMaker module in ChimeraX 64 . Refinement statistics and validation reports are provided in Supplementary Tables 1, 3 for PP and PRC2, respectively. Q-score 65 analysis was con-ducted for each refined model and reported in the abovementioned tables. Particle image quality and orientation distribution analysis ResLog plots were generated using the ResLog job in cryoSPARC 62 . Rosenthal-Henderson plots were derived from the data utilized in the ResLog plot, following the method described by Rosenthal and Henderson 57 . The per-particle spectral signal-to-noise ratio (ppSSNR) plots were produced using the FSC_noisesub data from the ResLog Analysis job in cryoSPARC. Particles were segmented into stacks of 30,000, 60,000, 90,000, 120,000, and 150,000 for analysis. The ppSSNR calculations are performed as described by ref. 66. Cryo-EM map sphericity values are calculated using the 3DFSC server 14 . The conical FSC area ratio (cFAR) and sampling compensation factor (SCF) 56,67 were computed using CryoSPARC 62 . Tilt-series collection Tilt series were collected on a Titan Krios (Thermo Fisher Scientific, USA) operating at 300 kV, equipped with a K3 summit direct electron detector and a Quantum energy filter (Gatan, USA), controlled by SerialEM 61 . Images were collected with an exposure of 8 e-/pixel/s on the detector, with the camera operating in CDS mode, with a calibrated pixel size of 1.1 Å per pixel. Tilt series were collected using a dose-symmetric tilt scheme from -45°to 45°with a tilt increment of 3°and nominal defocus between 2 and 4 μm 68 . Each tilt angle was collected as a five-frame movie, with an exposure of 5 e -/Å 2 per tilt, and, therefore, a total exposure of 150 e -/Å 2 per tilt series. Tilt-series data processing Each movie was whole frame aligned using the Unblur package in cisTEM 69 . Tilt series were aligned and reconstructed at a binning factor 4 using AreTomo 70 . To further enhance the contrast of protein parti-cles for better localization, the reconstructed tomograms were denoised using IsoNet 71 . The reconstructions are shown in Supple-mentary Movies 1, 2. These movies were created using 3dmod from the IMOD package 72 and ImageJ 73 . Particle localization and ice surface estimation Particles in the tomograms were picked manually with Dynamo 74 . The surfaces of vitrified ice were determined via three markers: crystalline ice contaminations above the ice, carbon edges, and the protein layers, which are assumed to be close to the surface. + +
Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
+ +
Data availability The described cryo-EM maps and coordinate files have been deposited in the Electron Microscopy Data Bank and the Protein Data Bank (PDB) under the following accession codes: Polymerase alpha-primase (PP)-AavLEA1, 1:8 molar ratio under code EMD-43619, PP-AavLEA1, 1:40 molar ratio under codes PDB-ID 8VY3 and EMD-43628, PP-RvLEAM short , 1:6 molar ratio under code EMD-43626, PP-CHAPSO 4 mM under codes PDB-ID 9C8V and EMD-43627, Polycomb repressive complex 2 (PRC2)-AavLEA1, 1:40 molar ratio under code EMD-43620, PRC2-RvLEAM short , 1:6 molar ratio under code EMD-43621, PRC2-RvLEAM short , 1:6 molar ratio, 10 mM MgCl 2 under code EMD-43622, PRC2-RvLEAM short , 1:6 molar ratio, 2 min crosslink under code EMD-43623, PRC2-RvLEAM short , 1:6 molar ratio, 10 min crosslink under codes PDB-ID 9C8U and EMD-43625, and PRC2, 10 min crosslink under code EMD-45273 [https://www.ebi.ac.uk/emdb/EMD-45723]. Raw datasets (movies) and their respective gain references were deposited in the Electron Microscopy Public Image Archive (EMPIAR): PP-AavLEA1, 1:8 molar ratio under accession code EMPIAR-11963, PP-AavLEA1, 1:40 molar ratio under accession code EMPIAR-11964, PP-RvLEAM short , 1:6 molar ratio under accession code EMPIAR-11965,
+ + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 8 + +
PP-CHAPSO 4 mM under accession code EMPIAR-11966, PRC2-AavLEA1, 1:40 molar ratio under accession code EMPIAR-11975, PRC2-RvLEAM short , 1:6 molar ratio under accession code EMPIAR-11976, PRC2-RvLEAM short , 1:6 molar ratio, 2 min crosslink under accession code EMPIAR-11978, PRC2-RvLEAM short , 1:6 molar ratio, 10 min crosslink under accession code EMPIAR-11979, and PRC2, 10 min crosslink under accession code EMPIAR-12125. The PRC2-RvLEAM short , 1:6 molar ratio with 10 mM MgCl 2 dataset is uploaded as aligned micrographs, under accession code EMPIAR-12140. Reconstructed tomograms for PP-AavLEA1, 1:8 molar ratio are included in EMD-43619 and PRC2-RvLEAM short , 1:6 molar ratio in EMD-43621. The following previously published PDB depositions were used in this study: PDB-ID 8FYH and PDB-ID 5EXR. Source data are provided with this paper.
+ + References 1. Kühlbrandt, W. The resolution revolution. Science 343, 1443-1444 (2014). 2. Han, B.-G., Avila-Sakar, A., Remis, J. & Glaeser, R. M. Challenges in making ideal cryo-EM samples. Curr. Opin. Struct. Biol. 81, 102646 (2023). 3. Xu, Y. & Dang, S. Recent technical advances in sample preparation for single-particle cryo-EM. Front. Mol. Biosci. 9, 892459 (2022). 4. D'Imprima, E. et al. Protein denaturation at the air-water interface and how to prevent it. Elife 8, e42747 (2019). 5. Noble, A. J. et al. Reducing effects of particle adsorption to the air-water interface in cryo-EM. Nat. Methods 15, 793-795 (2018). 6. Noble, A. J. et al. Routine single particle CryoEM sample and grid characterization by tomography. Elife 7, e34257 (2018). 7. Glaeser, R. M. Proteins, interfaces, and cryo-EM grids. Curr. Opin. Colloid Interface Sci. 34, 1-8 (2018). 8. Glaeser, R. M. & Han, B.-G. Opinion: hazards faced by macro-molecules when confined to thin aqueous films. Biophys. Rep. 3, 1-7 (2017). 9. Taylor, K. A. & Glaeser, R. M. Retrospective on the early develop-ment of cryoelectron microscopy of macromolecules and a pro-spective on opportunities for the future. J. Struct. Biol. 163, 214-223 (2008). 10. Kim, L. Y. et al. Benchmarking cryo-EM single particle analysis workflow. Front. Mol. Biosci. 5, 50 (2018). 11. Adrian, M., Dubochet, J., Lepault, J. & McDowall, A. W. Cryo-electron microscopy of viruses. Nature 308, 32-36 (1984). 12. Dubochet, J., Chang, J.-J., Freeman, R., Lepault, J. & McDowall, A. W. Frozen aqueous suspensions. Ultramicroscopy 10, 55-61 (1982). 13. Glaeser, R. M. Preparing better samples for cryo-electron micro-scopy: biochemical challenges do not end with isolation and pur-ification. Ann. Rev. Biochem. 90, 451-474 (2021). 14. Tan, Y. Z. et al. Addressing preferred specimen orientation in single-particle cryo-EM through tilting. Nat. Methods 14, 793-796 (2017). 15. Naydenova, K. & Russo, C. J. Measuring the effects of particle orientation to improve the efficiency of electron cryomicroscopy. Nat. Commun. 8, 629 (2017). 16. Liu, N. & Wang, H.-W. Better cryo-EM specimen preparation: how to deal with the air-water interface? J. Mol. Biol. https://doi.org/10. 1016/j.jmb.2022.167926 (2022). 17. Chen, J., Noble, A. J., Kang, J. Y. & Darst, S. A. Eliminating effects of particle adsorption to the air/water interface in single-particle cryo-electron microscopy: bacterial RNA polymerase and CHAPSO. J. Struct. Biol. X 1, 100005 (2019). 18. Stark, H. GraFix: stabilization of fragile macromolecular complexes for single particle cryo-EM. Methods Enzymol. 481, 109-126 (2010). 19. Kastner, B. et al. GraFix: sample preparation for single-particle electron cryomicroscopy. Nat. Methods 5, 53-55 (2008). 20. Kasinath, V. et al. Structures of human PRC2 with its cofactors AEBP2 and JARID2. Science 359, 940-944 (2018). 21. Adamus, K., Le, S. N., Elmlund, H., Boudes, M. & Elmlund, D. AgarFix: simple and accessible stabilization of challenging single-particle cryo-EM specimens through crosslinking in a matrix of agar. J. Struct. Biol. 207, 327-331 (2019). 22. Wang, F. et al. General and robust covalently linked graphene oxide affinity grids for high-resolution cryo-EM. Proc. Natl Acad. Sci. USA 117, 24269-24273 (2020). 23. Wang, F. et al. Amino and PEG-amino graphene oxide grids enrich and protect samples for high-resolution single particle cryo-electron microscopy. J. Struct. Biol. 209, 107437 (2020). 24. Liu, N. et al. Bioactive functionalized monolayer graphene for high-resolution cryo-electron microscopy. J. Am. Chem. Soc. 141, 4016-4025 (2019). 25. Glaeser, R. M. & Han, B.-G. Streptavidin affinity grids for single-particle cryo-EM. Microsc. Microanal. 25, 990-991 (2019). 26. Palovcak, E. et al. A simple and robust procedure for preparing graphene-oxide cryo-EM grids. J. Struct. Biol. 204, 80-84 (2018). 27. Lu, Y. et al. Functionalized graphene grids with various charges for single-particle cryo-EM. Nat. Commun. 13, 6718 (2022). 28. Zheng, L. et al. Uniform thin ice on ultraflat graphene for high-resolution cryo-EM. Nat. Methods 20, 123-130 (2023). 29. Han, Y. et al. High-yield monolayer graphene grids for near-atomic resolution cryoelectron microscopy. Proc. Natl Acad. Sci. USA 117, 1009-1014 (2020). 30. Esfahani, B. G. et al. SPOT-RASTR-a cryo-EM specimen preparation technique that overcomes problems with preferred orientation and the air/water interface. Biophys. J. 123 (2024). 31. Jain, T., Sheehan, P., Crum, J., Carragher, B. & Potter, C. S. Spotiton: a prototype for an integrated inkjet dispense and vitrification sys-tem for cryo-TEM. J. Struct. Biol. 179, 68-75 (2012). 32. Darrow, M. C., Moore, J. P., Walker, R. J., Doering, K. & King, R. S. Chameleon: next generation sample preparation for cryoEM based on Spotiton. Microsc. Microanal. 25, 994-995 (2019). 33. Dandey, V. P. et al. Time-resolved cryo-EM using Spotiton. Nat. Methods 17, 897-900 (2020). 34. Rubinstein, J. L. et al. Shake-it-off: a simple ultrasonic cryo-EM specimen-preparation device. Acta Crystallogr. D. Struct. Biol. 75, 1063-1070 (2019). 35. Tan, Y. Z. & Rubinstein, J. L. Through-grid wicking enables high-speed cryoEM specimen preparation. Acta Crystallogr. D. Struct. Biol. 76, 1092-1103 (2020). 36. Hernández-Sánchez, I. E. et al. LEAfing through literature: late embryogenesis abundant proteins coming of age -achievements and perspectives. J. Exp. Bot. 73, 6525-6546 (2022). 37. Hibshman, J. D. & Goldstein, B. LEA motifs promote desiccation tolerance in vivo. BMC Biol. 19, 263 (2021). 38. Hibshman, J. D., Clegg, J. S. & Goldstein, B. Mechanisms of desic-cation tolerance: themes and variations in brine shrimp, round-worms, and tardigrades. Front. Physiol. 11, 592016 (2020). 39. Goyal, K., Walton, L. J. & Tunnacliffe, A. LEA proteins prevent protein aggregation due to water stress. Biochem. J. 388, 151-157 (2005). 40. He, Q. et al. Structures of human primosome elongation com-plexes. Nat. Struct. Mol. Biol. 30, 579-583 (2023). 41. Yin, Z., Kilkenny, M. L., Ker, D. S. & Pellegrini, L. CryoEM insights into RNA primer synthesis by the human primosome. FEBS J. 291, 1813-1829 (2024). 42. Kilkenny, M. L. et al. Structural basis for the interaction of SARS-CoV-2 virulence factor nsp1 with DNA polymerase α-primase. Pro-tein Sci. 31, 333-344 (2022). 43. Kasinath, V. et al. JARID2 and AEBP2 regulate PRC2 in the presence of H2AK119ub1 and other histone modifications. Science 371, eabc3393 (2021). + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 9 + + 44. Song, J. et al. Structural basis for inactivation of PRC2 by G-quadruplex RNA. Science 381, 1331-1337 (2023). 45. Grau, D. et al. Structures of monomeric and dimeric PRC2:EZH1 reveal flexible modules involved in chromatin compaction. Nat. Commun. 12, 714 (2021). 46. Baranovskiy, A. G. et al. Mechanism of concerted RNA-DNA primer synthesis by the human primosome. J. Biol. Chem. 291, 10006-10020 (2016). 47. Lipscomb, D. M. Electron Microscopy Methods to Overcome the Challenges of Structural Heterogeneity and Preferred Orientations in Small (sub-500 kDa) Macromolecular Complexes. Ph.D thesis, California Univ. (2017). 48. Møbjerg, N. et al. Survival in extreme environments -on the current knowledge of adaptations in tardigrades. Acta Physiol. 202, 409-420 (2011). 49. Tanaka, S. et al. Novel mitochondria-targeted heat-soluble proteins identified in the anhydrobiotic tardigrade improve osmotic toler-ance of human cells. PLoS ONE 10, e0118272 (2015). 50. Li, D. & He, X. Desiccation dependent structure and stability of an anhydrobiotic nematode late embryogenesis abundant (LEA) pro-tein. In ASME 2009 Summer Bioengineering Conference, Parts A and B 213-214 (American Society of Mechanical Engineers, 2009). 51. Li, B., Zhu, D., Shi, H. & Zhang, X. Effect of charge on protein pre-ferred orientation at the air-water interface in cryo-electron microscopy. J. Struct. Biol. 213, 107783 (2021). 52. Patel, A. B. et al. Structure of human TFIID and mechanism of TBP loading onto promoter DNA. Science 362, eaau8872 (2018). 53. Chen, S., Li, J., Vinothkumar, K. R. & Henderson, R. Interaction of human erythrocyte catalase with air -water interface in cryoEM. Microscopy 71, i51-i59 (2022). 54. He, Q. et al. Structures of the human CST-Polα-primase complex bound to telomere templates. Nature 608, 826-832 (2022). 55. Stagg, S. M., Noble, A. J., Spilman, M. & Chapman, M. S. ResLog plots as an empirical metric of the quality of cryo-EM reconstruc-tions. J. Struct. Biol. 185, 418-426 (2014). 56. Baldwin, P. R. & Lyumkis, D. Non-uniformity of projection distribu-tions attenuates resolution in Cryo-EM. Prog. Biophys. Mol. Biol. 150, 160-183 (2020). 57. Rosenthal, P. B. & Henderson, R. Optimal determination of particle orientation, absolute hand, and contrast loss in single-particle electron cryomicroscopy. J. Mol. Biol. 333, 721-745 (2003). 58. Snijder, J. et al. Vitrification after multiple rounds of sample appli-cation and blotting improves particle density on cryo-electron microscopy grids. J. Struct. Biol. 198, 38-42 (2017). 59. Kampjut, D., Steiner, J. & Sazanov, L. A. Cryo-EM grid optimization for membrane proteins. iScience 24, 102139 (2021). 60. Tripathi, R., Benz, N., Culleton, B., Trouvé, P. & Férec, C. Biophysical characterisation of calumenin as a charged F508del-CFTR folding modulator. PLoS ONE 9, e104970 (2014). 61. Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36-51 (2005). 62. Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoS-PARC: algorithms for rapid unsupervised cryo-EM structure deter-mination. Nat. Methods 14, 290-296 (2017). 63. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D. Biol. Crystallogr. 66, 213-221 (2010). 64. Meng, E. C. et al. UCSF ChimeraX: tools for structure building and analysis. Protein Sci. 32, e4792 (2023). 65. Pintilie, G. et al. Measurement of atom resolvability in cryo-EM maps with Q-scores. Nat. Methods 17, 328-334 (2020). 66. Chan, L. M. et al. High-resolution single-particle imaging at 100-200 keV with the Gatan Alpine direct electron detector. J. Struct. Biol. 216, 108108 (2024). 67. Baldwin, P. R. & Lyumkis, D. Tools for visualizing and analyzing Fourier space sampling in Cryo-EM. Prog. Biophys. Mol. Biol. 160, 53-65 (2021). 68. Hagen, W. J. H., Wan, W. & Briggs, J. A. G. Implementation of a cryo-electron tomography tilt-scheme optimized for high resolution subtomogram averaging. J. Struct. Biol. 197, 191-198 (2017). 69. Grant, T., Rohou, A. & Grigorieff, N. CisTEM, user-friendly software for single-particle image processing. Elife 7, e35383 (2018). 70. Zheng, S. et al. AreTomo: an integrated software package for automated marker-free, motion-corrected cryo-electron tomo-graphic alignment and reconstruction. J. Struct. Biol. X 6, 100068 (2022). 71. Liu, Y. T. et al. Isotropic reconstruction for electron tomography with deep learning. Nat. Commun. 13, 6482 (2022). 72. Kremer, J. R., Mastronarde, D. N. & McIntosh, J. R. Computer visualization of three-dimensional image data using IMOD. J. Struct. Biol. 116, 71-76 (1996). 73. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671-675 (2012). 74. Castaño-Díez, D., Kudryashev, M., Arheit, M. & Stahlberg, H. Dynamo: a flexible, user-friendly development tool for sub-tomogram averaging of cryo-EM data in high-performance com-puting environments. J. Struct. Biol. 178, 139-151 (2012). + +
Acknowledgements We are grateful to Tom Cech, Anne Gooding, and Jiarui Song at the University of Colorado Boulder for their generous gift of purified recombinant human PRC2. We also extend our thanks to members of the Lim and Grant laboratories for their valuable suggestions. Our appreciation goes to Kliment Verba and his lab members at the Uni-versity of California San Francisco for their assistance with our ppSSNR calculations. We thank Lori Passmore and her lab members at MRC LMB for providing insightful feedback on our preprint. We also like to thank Tom Terwilliger at the Los Alamos National Lab for his help in model refinement using the Phenix software. Lastly, we are thankful to our colleagues Elizabeth Wright and Robert Kirchdoerfer for their helpful feedback and suggestions. Some of this work was performed in the Cryo-EM Research Center (CEMRC) in the Depart-ment of Biochemistry at the University of Wisconsin-Madison. We thank the staff at CEMRC for their support and assistance in cryo-EM data collection. The Lim lab is a member of the SBGrid consortium (www.sbgrid.org) and some of the analyses were performed using software compiled by SBGrid. Support for this research was provided to C.L. by the National Institutes of Health (NIH), the National Institute of General Medical Sciences (R00GM131023 and DP2GM150023), and the University of Wisconsin-Madison, Office of the Vice-Chancellor for Research and Graduate Education with funding from the Wisconsin Alumni Research Foundation and the Department of Biochemistry. In addition, K.M.A. is supported by an NIH T32 pre-doctoral fellowship (T32GM130550). T.G. is an Investigator of The Morgridge Institute for Research.
+ +
Author contributions C.L. conceived the study. K.M.A. and Q.H. made the recombinant pro-teins. K.M.A made the cryo-EM grids, and performed data collection and image processing with C.L. in support. C.L. and K.M.A. collected the cryo-EM tilt-series datasets with T.G. in support. G.L. and T.G. recon-structed the cryo-EM tomograms and performed related analyses. K.M.A. performed the crosslinking experiments and analysis. K.M.A., G.L., T.G., and C.L. wrote the manuscript and prepared the figures. Competing interests A provisional patent has been filed by C.L. for this technology with the Wisconsin Alumni Research Foundation (WARF). The remaining authors declare no competing interests. Article https://doi.org/10.1038/s41467-024-52091-1 Nature Communications | (2024) 15:7705
+ + 10 + +
Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-52091-1. Correspondence and requests for materials should be addressed to Ci Ji Lim. Peer review information Nature Communications thanks Alex Noble and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher's note Springer Nature remains neutral with regard to jur-isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creativecommons.org/licenses/by-nc-nd/4.0/.
+ + © The Author(s) 2024 + + Article https://doi.org/10.1038/s41467-024-52091-1 + + Nature Communications | (2024) 15:7705 + + 11 + + + + diff --git a/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41588-024-01785-9.training.segmentation.tei.xml b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41588-024-01785-9.training.segmentation.tei.xml new file mode 100644 index 0000000000..f96b2ed5ba --- /dev/null +++ b/grobid-trainer/resources/dataset/segmentation/corpus/tei/s41588-024-01785-9.training.segmentation.tei.xml @@ -0,0 +1,183 @@ + + + + + + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 1868 nature genetics Article https://doi.org/10.1038/s41588-024-01785-9 Analysis of 10,478 cancer genomes identifies candidate driver genes and opportunities for precision oncology Ben Kinnersley 1,2,11 , Amit Sud 1,3,4,5,6,11 , Andrew Everall 1,11 , Alex J. Cornish 1 , Daniel Chubb 1 , Richard Culliford 1 , Andreas J. Gruber 7 , Adrian Lärkeryd 8 , Costas Mitsopoulos 9 , David Wedge 10 & Richard Houlston 1 Tumor genomic profiling is increasingly seen as a prerequisite to guide the treatment of patients with cancer. To explore the value of whole-genome sequencing (WGS) in broadening the scope of cancers potentially amenable to a precision therapy, we analysed whole-genome sequencing data on 10,478 patients spanning 35 cancer types recruited to the UK 100,000 Genomes Project. We identified 330 candidate driver genes, including 74 that are new to any cancer. We estimate that approximately 55% of patients studied harbor at least one clinically relevant mutation, predicting either sensitivity or resistance to certain treatments or clinical trial eligibility. By performing computational chemogenomic analysis of cancer mutations we identify additional targets for compounds that represent attractive candidates for future clinical trials. This study represents one of the most comprehensive efforts thus far to identify cancer driver genes in the real world setting and assess their impact on informing precision oncology. + + Precision oncology aims to tailor therapy to the unique biology of the patient's cancer, thereby optimizing treatment efficacy and minimizing toxicity 1,2 . Underpinning precision oncology is the concept of somatic driver mutations as the foundation of cancer biology 3,4 . The expansion in the number of therapeutically actionable genes has exposed the limitations of single-analyte genomic assays in cancer 5 . The modest incremental cost of adding additional can-cer genes to high-throughput sequencing-based panels has made the development of drugs targeting increasingly smaller subsets of molecularly defined patients with cancer financially and logistically feasible 6 . The development of inhibitors effective in cancers driven by rare genomic mutations has required the concurrent development of clinical trial designs, such as basket trials, in which eligibility is based on mutational status instead of organ site, cancer stage and histology 7 . With the advent of basket studies, many oncologists now consider that tumor genomic profiling should be offered to all patients with cancer who are not candidates for curative-intent local or systemic therapy 8 . At present, several standalone tests or a panel are typically used to capture a set of genomic, transcriptomic or epigenomic features in a tumor to inform patient treatment 9 . However, falling costs are making whole-genome sequencing (WGS) a potentially attractive proposition as a single all-encompassing test to identify cancer drivers and other genomic features, which may not be captured by standard testing but are clinically actionable 10 . This approach is being explored in the UK by the 100,000 Genomes Project (100kGP), which is seeking to deliver the + + Received: 25 September 2023 Accepted: 1 May 2024 Published online: 18 June 2024 Check for updates 1 Division of Genetics and Epidemiology, The Institute of Cancer Research, London, UK. 2 University College London Cancer Institute, University College London, London, UK. 3 Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA. 4 Broad Institute of MIT and Harvard, Cambridge, MA, USA. 5 Harvard Medical School, Boston, MA, USA. 6 Centre for Immuno-Oncology, Nuffield Department of Medicine, University of Oxford, Oxford, UK. 7 Systems Biology & Biomedical Data Science Laboratory, University of Konstanz, Konstanz, Germany. 8 Division of Molecular Pathology, The Institute of Cancer Research, London, UK. 9 Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK. 10 Manchester Cancer Research Centre, University of Manchester, Manchester, UK. 11 These authors contributed equally: Ben Kinnersley, Amit Sud, Andrew Everall. e-mail: richard.houlston@icr.ac.uk + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1869 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + Mutation rates varied across the different cancer types with cuta-neous melanoma having the highest single nucleotide variant mutation count and meningioma the lowest (Extended Data Fig. 2). A total of 945 samples, notably colorectal and uterine cancers, were hypermutated, either as result of defective mismatch repair (dMMR) or POLE mutation. Invasive ductal carcinoma of the breast had the highest power for driver gene detection (>90% power for a mutation rate of at least 2% higher than background) and large cell lung cancer had the lowest power (Fig. 2 and Supplementary Table 4). Compared with the recent Pan-Cancer Analysis of Whole Genomes analysis 12 , the 100kGP cohort was better powered to identify a driver mutation for 19 cancers, notably for breast, colorectal, esophageal and uterine cancer, lung adenocarcinoma and bladder transitional cell carcinoma where the sample sizes were more than tenfold higher. Spectrum of cancer driver genes Across all cancer types we identified 770 unique tumor-driver gene pairs corresponding to 330 unique candidate cancer driver genes (Fig. 3, Extended Data Fig. 3 and Supplementary Table 5). When vision of precision oncology through WGS to National Health Service (NHS) patients as part of their routine care 11 . Here, we report an analysis of WGS data on 10,478 patients span-ning 35 cancer types recruited to the 100kGP (Fig. 1a). Across all cancer types we identify 330 candidate driver genes, including 74 which are new to any cancer. We relate these to their actionability both in terms of currently approved therapeutic agents and through computational chemogenomic analysis to predict candidacy for future clinical trials. Results We analysed 10,478 cancer genomes spanning 35 different cancer types (Fig. 1b and Supplementary Tables 1 and 2). While broadly reflecting the spectrum and frequencies of cancers diagnosed in the UK popula-tion, there were differences, with an over-representation of colorectal and kidney cancers and a paucity of prostate and pancreatic cancers (Extended Data Fig. 1). Additionally, for the main cancer types, the patients recruited to 100kGP tended to be younger and had earlier stage tumors compared to patients in the general UK population (Sup-plementary Table 3). + + a b Sequencing of 14,129 tumor-normal whole genomes Essential and selective driver genes New druggable cancer targets Patients with cancer Sample and sequencing quality control 35 cancer types 10,478 tumor-normal whole genomes Actionable driver genes FDA approved therapies and clinical trials Multilayered cancer gene druggability Driver gene identification 330 cancer driver genes (74 new drivers) dMMR, HRD Clinically informative mutational signatures Breast-DuctalCA Kidney-CCRCC Lung-AdenoCA Uterus-AdenoCA Ovary-AdenoCA Lung-SCC Prost-AdenoCA Breast-LobularCA Bladder-TCC Skin-Melanoma CNS-GBM-IDHwt HeadNeck-SCC Connective-Myxofibro Connective-Chondro Connective-Liposarc Kidney-PRCC Connective-Leiomyo Tumor type Panc-AdenoCA Eso-AdenoCA Stomach-AdenoCA Kidney-ChRCC Connective-SCS CNS-Astro Connective-Osteosarc CNS-Menin CNS-Oligo Testis-GCT Mes-Mesothelioma Connective-SS BileDuct-AdenoCA CNS-GBM-IDHmut Lung-SmaliCell Lung-LargeCell Liver-HCC ColoRect-AdenoCA 0 500 1,000 1,500 2,000 Number Fig. 1 | Study design and number of samples per tumor type included in the analysis. a, Study design. b, Number of samples per tumor type. BileDuct-AdenoCA, bile duct adenocarcinoma; Bladder-TCC, bladder transitional cell carcinoma; Breast-DuctalCA, breast ductal carcinoma; Breast-LobularCA, breast lobular carcinoma; CNS-Astro, astrocytoma; CNS-GBM-IDHmut, IDH mutated glioblastoma; CNS-GBM-IDHwt, IDH wild-type glioblastoma; CNS-Menin, meningioma; CNS-Oligo, oligodendroglioma; ColoRect-AdenoCA, colorectal adenocarcinoma; Connective-Chondro, chondrosarcoma; Connective-Leiomyo, leiomyosarcoma; Connective-Liposarc, liposarcoma; Connective-Myxofibro, myxofibrosarcoma; Connective-Osteosarc, osteosarcoma; Connective-SCS, spindle cell sarcoma; Connective-SS, synovial sarcoma; Eso-AdenoCA, esophageal adenocarcinoma; HeadNeck-SCC, squamous cell carcinoma of the head and neck; Kidney-CCRCC, clear cell renal cell carcinoma; Kidney-ChRCC, chromophobe renal cell carcinoma; Kidney-PRCC, papillary renal cell carcinoma; Liver-HCC, hepatocellular carcinoma; Lung-AdenoCA, lung adenocarcinoma; Lung-LargeCell, large cell lung cancer; Lung-SCC, squamous cell carcinoma of the lung; Lung-SmallCell, small cell carcinoma of the lung; Mes-Mesothelioma, mesothelioma; Ovary-AdenoCA, ovarian adenocarcinoma; Panc-AdenoCA, pancreatic adenocarcinoma; Prost-AdenoCA, prostate adenocarcinom; Skin-Melanoma, melanoma of the skin; Stomach-AdenoCA, gastric adenocarcinoma; Testis-GCT, testicular germ cell tumor; Uterus-AdenoCA, uterine adenocarcinoma. Fig. 1a created with BioRender.com. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1870 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + compared to the largest pan-cancer driver analysis, in 21 of 31 cancer types where tumor histologies could be matched, we recovered 61% of all cancer drivers reported by the Catalogue of Somatic Mutations in Cancer (COSMIC), the Integrative OncoGenomics (IntOGen) 4 and The Cancer Genome Atlas (TCGA) Program pan-cancer analysis reported by ref. 13 (Supplementary Table 5). We were able to detect 80% of drivers reported for colorectal, breast, lung and ovarian cancers but only <20% of drivers reported for hepatocellular and stomach cancers, which may be a result of differing sample size or intertumour heterogeneity 14 . The number of identified cancer driver genes varied between cancer types, with colorectal and uterine cancers having the most (60 genes) and spindle cell carcinoma having the fewest (4 genes). Across the 35 cancers, we found no correlation between average mutation bur-den and the number of driver genes in each cancer (Pearson's r = 0.19, P = 0.27). The consensus list also includes 326 tumor-driver pairs that have not previously been reported by the Cancer Gene Census, IntOGen or the pan-cancer analysis of TCGA 4,13 (Supplementary Table 5) and 74 that have not previously been associated with any specific tissue. Almost all of the candidate drivers identified were uncommon, with 88% (65 of 74) having a mutation frequency <10% in the respective cancer type. The highest numbers of new cancer driver genes were found for uterine (n = 42), bladder (n = 40) and colorectal (n = 37) can-cers. Furthermore, we identified drivers in tumor types which have not been cataloged by IntOGen 4 and ref. 13. These include breast lobular carcinoma, meningioma and myxofibrosarcoma. Predictions of known cancer driver genes in new cancer types include SPTA1, CHD4 and ASXL1 in colorectal cancer, FOXO3, MUC16 and ZFPM1 in breast cancers and CNTNAP2, CTNND2 and TRRAP in lung adenocarcinoma. Entirely new predictions include MAP3K21 (encoding a mixed-lineage kinase) in colorectal cancer, USP17L22 (encoding a deubiquitinating enzyme) in breast ductal carcinoma and TPTE (encoding a tyrosine phosphatase) in lung adenocarcinoma (Supplementary Table 5). Eighty-five genes were identified as a driver in more than two tumor types, with 26 genes functioning as drivers in more than five tumor types (Fig. 4a). As expected, TP53 was identified as a driver gene in the most tumor types, followed by PIK3CA, ARID1A and PTEN, acting as cancer driver genes in 29, 18, 16 and 14 different tumor types, respec-tively. While many genes function as drivers in several cancer types, some drivers are mutated at high frequencies only in specific tumors, such as VHL in clear cell renal cell carcinoma and FGFR3 in bladder cancer (Fig. 4a). Across drivers operating in several cancer types, the clearest examples of domain-specific driver mutations were in EGFR, where protein tyrosine and serine/threonine kinase domain mutations predominated in lung adenocarcinoma, in contrast to extracellular furin-like cysteine-rich region domain mutations in IDH wild-type glioblastoma (Supplementary Table 6 and Extended Data Fig. 4a). PIK3CA also showed a preference for p85-binding domain mutations in uterine adenocarcinoma compared to other cancer types, such as breast ductal carcinoma, which are enriched for mutations in the PIK family domain (Supplementary Table 6 and Extended Data Fig. 4b). Hierarchical clustering of cancers based on the presence of identified driver mutations and their respective q value demonstrated clustering of cancer types by cell of origin (for example, head and neck and lung squamous cell carcinoma) and by organ (for example, breast ductal and lobular carcinomas; Extended Data Fig. 5). The ratio of predicted activating versus tumor suppressor driver genes varied across tumor types with meningioma and myxofibrosarcoma possessing the highest and lowest ratios, respectively (Fig. 4b and Supplementary Table 5). Across the 35 different tumor types in 9,070 unique samples we identified 12,606 distinct oncogenic mutations in tumor-relevant cancer driver genes. The median number of oncogenic mutations in cancer driver genes per sample was two, across all tumors. The highest median number of oncogenic mutations in driver genes per sample was seen in uterine cancer (n = 6; Extended Data Fig. 6). We observed significant differences (P binomial < 3.5 × 10 -3 ) in oncogenic mutation frequency in cancer driver genes across different tumor histologies arising from the same organ. Examples include CDH1, TBX3 and TP53 in breast cancers, ATRX, CIC, IDH1, PTEN and TP53 in central nervous system tumors, IDH1 and TP53 in connective tissue tumors, PBRM1 and VHL in renal cancers and EGFR, KMT2D, KRAS, NFE2L2, PTEN, STK11 and TP53 in lung cancers (Fig. 5). Considering all 330 cancer driver genes, 217 featured at least one clonal oncogenic mutation (214 clonal, 167 clonal early and 114 clonal late events (Supplementary Table 7). APC, TP53 and PIK3CA possessed the most clonal oncogenic mutations (Fig. 6a and Extended Data Fig. 7). Of the 162 driver genes that harbored at least one subclonal oncogenic mutation, ARID1A, TP53 and PIK3CA possessed the most (Fig. 6b and Extended Data Fig. 7). Consistent with published work, a high propor-tion (55%) of all early clonal driver mutations occur in just four genes (TP53, APC, KRAS and PIK3CA) whereas the equivalent percentage of late and subclonal oncogenic mutations was observed in 19 different genes (Supplementary Table 7) 15-18 . This finding supports a model in which early events in cancer evolution tend to occur in a restricted set of driver genes and a wider range of drivers feature late in tumor evolution. In tumors with more than ten oncogenic mutations, menin-gioma exhibited the greatest proportion of clonal oncogenic mutations (Extended Data Fig. 8a). Large cell lung, testicular germ cell tumor and oligodendroglioma carried the highest proportion of early clonal, late clonal and subclonal oncogenic mutations, respectively (Extended Data Fig. 8b-d). Sensitivity of WGS mutation detection compared to panels We initially investigated the performance of WGS to detect clinically relevant mutations compared to conventional panel-based testing through comparison of mutation calls with Memorial Sloan Kettering (MSK) Cancer Center cohorts at 43 established drivers (Supplemen-tary Note 1). For primary tumors represented in the MSK and 100kGP cohorts, the rate of mutations called for each driver gene was com-parable (Supplementary Figs. 1 and 2). Thereafter, we estimated the sensitivity of mutation detection in the 100kGP cohort by extracting CNS-Oligo CNS-Astro CNS-GBM-IDHmut CNS-GBM-IDHwt CNS-GBM-Menin Testis-GCT BileDuct-AdenoCA Bladder-TCC Breast-DuctalCA Breast-LobularCA ColoRect-AdenoCA Connective-Chondro Connective-Leiomyo Connective-Liposarc Connective-Myxofibro Connective-Osteosarc Connective-SCS Connective-SS Eso-AdenoCA HeadNeck-SCC Kidney-CCRCC Kidney-ChRCC Kidney-PRCC Liver-HCC Lung-AdenoCA Lung-LargeCell Lung-SCC Lung-SmallCell Mes-Mesothelioma Ovary-AdenoCA Panc-AdenoCA Prost-AdenoCA Skin-Melanoma Stomach-AdenoCA Uterus-AdenoCA 100 1,000 10,000 0.1 1 10 100 Mutation rate (per Mb) Sample size Effect size above background 0.01 0.02 0.05 0.1 Fig. 2 | Power estimates for driver gene identification per tumor type. The number of samples needed to achieve 90% power for 90% of genes (y axis). Gray vertical lines indicate exome-wide background mutation rates (x axis). Black dots indicate sample sizes and mutation rates in the current study. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1871 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + per-tumor coverage across the panel of 43 driver genes (Supplemen-tary Note 1). Specifically, for 88% of cancer driver genes, the expected sensitivity for mutation detection was >99% in the 100kGP cohort. Fur-thermore, for 90% of cancer driver genes, >98% of the coding sequence had sufficient coverage such that more than six reads could be used for mutation detection after accounting for tumor purity (Supplementary Figs. 3-7). These findings are in agreement with published data on the diagnostic accuracy of 100kGP WGS compared to panel sequencing conducted by Genomics England (sensitivity of 99% for variant allele frequency >5% and coverage >70×). Actionability of driver gene mutations We next sought to evaluate the landscape of clinically actionable driver alterations through reference to the COSMIC and Precision Oncol-ogy Knowledge Base (OncoKB). We observed that both the fraction of samples and proportion of alteration types varied across tissue types. Data from COSMIC indicated that 85% of all samples (8,880 of 10,478) possessed at least one putatively actionable alteration being targeted in a clinical setting (Fig. 7a and Supplementary Table 8), while 55% of samples (5,805 of 10,478) had at least one putatively actionable or biologically relevant alteration from OncoKB (Fig. 7b and Supplemen-tary Tables 9 and 10). Across all cancer types, 15% (1,560 of 10,470) of the patients would be eligible for a currently approved therapy as defined by OncoKB. Of the actionable mutations defined by OncoKB (n = 9,639), 5,823 were clonal, 2,632 were early clonal, 229 were late clonal and 852 were subclonal. The most common putatively actionable alterations across all of the 35 cancer types were mutations in PIK3CA, KRAS and PTEN (Supple-mentary Fig. 8). PIK3CA encodes the p110α protein, which is a catalytic subunit of phosphatidylinositol 3-kinase (PI3K). Specific oncogenic missense mutations in PIK3CA were present in 50% of lobular breast can-cers and 38% of ductal breast cancers and their presence is an indication for the use of PI3Kα inhibitor alpelisib 19 . These mutations are present in a number of cancers including colorectal (20%) and uterine cancers (47%) and in these tumor types are subject to early clinical studies with an allosteric inhibitor of PI3Kα 20 . We found high fractions of patients with pancreatic cancer, colorectal cancer and lung adenocarcinoma with actionable KRAS mutations (39-64% of all cases). The KRAS G12C mutation was present in 17% of lung adenocarcinoma cases and is tar-geted by mutation-specific selective covalent inhibition with adagrasib C>A C>G C>T T>A T>C T>G a AKT1 ANK1 APC ARID1A ATM ATRX BAP1 BRAF CDKN2A CIC CSMD3 CTNNB1 EGFR ERBB2 FAT1 FBXW7 FGFR3 FUBP1 IDH1 KIT KMT2C KMT2D KRAS LRP1B MGAM MTOR NF1 NF2 NOTCH1 NRAS PDGFRA PIK3CA PKHD1L1 PTEN RB1 SMAD4 SYNE1 TP53 TRAF7 TSC1 VHL 0 25 50 75 0 10 20 30 Number of tumor types Maximum mutation prevalence in a tumor type (%) b Connective-Myxofibro Panc-AdenoCA Lung-SCC HeadNeck-SCC Prost-AdenoCA Connective-Leiomyo ColoRect-AdenoCA Lung-AdenoCA Breast-LobularCA Breast-DuctalCA CNS-GBM-IDHwt Bladder-TCC Eso-AdenoCA Skin-Melanoma Stomach-AdenoCA CNS-Oligo Lung-SmallCell Kidney-CCRCC Uterus-AdenoCA CNS-GBM-IDHmut Connective-SS Kidney-ChRCC Connective-Osteosarc Lung-LargeCell Mes-Mesothelioma Ovary-AdenoCA CNS-Astro Connective-SCS Connective-Liposarc Testis-GCT Kidney-PRCC Liver-HCC Connective-Chondro BileDuct-AdenoCA CNS-Menin 75 50 25 0 25 50 75 Percentage of tumor-specific driver genes Tumor group Activating Ambiguous Loss of function Predicted driver role Fig. 4 | Distribution and predicted function of candidate cancer driver genes across tumor types. a, Distribution of driver genes across different types of cancer: y axis, maximal mutational prevalence in a tumor type; x axis, number of tumor types in which the driver gene is identified. Genes labeled are candidate drivers in at least six tumor types or have a maximum mutation prevalence in a tumor type of >17%. b, Distribution of cancer driver gene function associated with each cancer type: y axis, tumor group; x axis, percentage of tumor-specific driver genes. ColoRect-AdenoCA Uterus-AdenoCA Breast-DuctalCA Breast-LobularCA Bladder-TCC Lung-SCC HeadNeck-SCC Lung-AdenoCA Ovary-AdenoCA CNS-GBM-IDHwt Skin-Melanoma Kidney-CCRCC Prost-AdenoCA Panc-AdenoCA BileDuct-AdenoCA Connective-Myxofibro Stomach-AdenoCA Eso-AdenoCA Connective-Leiomyo Connective-Liposarc Connective-SCS Kidney-ChRCC Lung-SmallCell Lung-LargeCell CNS-Menin Kidney-PRCC Testis-GCT Mes-Mesothelioma Connective-Osteosarc Liver-HCC Connective-SS CNS-Astro CNS-GBM-IDHmut Connective-Chondro CNS-Oligo TP53 PIK3CA PTEN ARID1A KRAS BRAF NRAS FBXW7 APC SMAD4 ATM ERBB3 MTOR DUSP16 ACVR2A RNF43 IDH1 ATRX CDKN2A NF1 EGFR AKT1 KMT2C FOXA1 MAP3K1 MAP2K4 RUNX1 NCOR1 ZFPM1 SPEN GATA3 SF3B1 ERBB2 CDH1 TBX3 CBFB RB1 KMT2D TSC1 KDM6A CREBBP STAG2 ELF3 EP300 KMT2A RHOA CTNNB1 PPP2R1A PIK3R1 FGFR2 CHD4 BCOR SPOP CIC FAT1 NOTCH1 NFE2L2 SETD2 BAP1 VHL PBRM1 MGA RBM10 STK11 KEAP1 ARID2 RAC1 IDH2 CASP8 MAX ARHGAP35 CTCF ESR1 NF2 KLF4 TRAF7 ARID1B SIN3A GNAS HLA-A MAP2K1 PSPC1 ZFHX3 MED12 ZMYM3 CDK12 HRAS CDKN1A ASXL1 MUC4 ZNF98 ZSCAN5A MUC20 CDKN1B FOXO3 USP17L22 SEC22B SMARCA4 PRPF8 TET2 CUL3 SMARCB1 ROCK1 PRAMEF15 AGAP6 BRCA2 CSMD3 HLA-B MYH9 SETD1B PDGFRA LRP1B FAT3 NCOR2 CDH10 NBEA PDGFRB EPHA3 NSD1 ATR BIRC6 ROBO2 PTPRB MUC16 PDE4DIP FAT4 TRRAP SLC35G5 DCTN1 AKAP9 CNTNAP2 N4BP2 DDX3X MET PTPN11 KIT -log10q >6 4 2 0 Fig. 3 | Heatmap of candidate cancer driver genes identified in at least two different cancer types. Heatmap intensity proportional to q value. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1872 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + or sotorasib 21,22 . PI3Kβ inhibition is of significant biological interest in patients with oncogenic inactivating PTEN mutations, as PI3Kβ is thought to drive cellular proliferation in these tumors. Inactivating PTEN mutations were prevalent in melanoma (10%), hepatocellular carcinoma (13%), squamous cell carcinoma of the lung (15%), glioblas-toma multiforme (29%) and uterine carcinoma (66%) and their presence would result in eligibility for early studies of PI3Kβ inhibition 23 . Landscape of clinical actionability In addition to actionable mutations in single genes, other classes of molecular alterations are recognized as tumor-agnostic biomark-ers of drug response. These include mutational profiles caused by dMMR/POLE mutations and homologous recombination deficiency (HRD), which represent phenotypic markers for response to immu-notherapy and PARP inhibition respectively. A total of 319 tumors (3%) exhibited a mutational signature for HRD, which provides an indica-tion for PARP inhibition therapy and potential sensitivity to platinum chemotherapy 24-28 . As demonstrated in our companion paper, the etio-logical basis of HRD was, however, only identifiable in 16% of these cases based on biallelic inactivation of BRCA1, BRCA2, PALB2, BRIP1 or RAD51B through germline and somatic mutations 29 . While other cases may be caused by promoter methylation, which could not be assessed because these data are not available for 100kGP samples, the findings provide a strong rationale for extending the number of patients potentially eligible for PARP inhibitors rather than solely relying on BRCA-testing. A total of 1,309 tumors possessed a high coding tumor mutational burden (more than ten mutations per megabase, Mb) and 144 cancers had evidence of dMMR. Considering these collectively would suggest that 1,312 patients may be eligible for checkpoint inhibition 30,31 . To explore the prospect of several targeted therapies being used in the same patient, we combined the OncoKB clinical actionability annota-tions with that of TMB, dMMR and HRD clinical actionability annota-tions. In total, 11,503 independent unique gene targets were present in 6,151 samples with 34% (3,577 of 10,478) of tumors possessing one, 13% (1,361 of 10,478) two and 12% (1,213 of 10,478) possessing at least three clinically actionable driver mutations. Expanding the druggable cancer genome An opportunity emerging from the systematic analysis of cancer genomes is the identification of new therapeutic intervention strate-gies. Of the 330 candidate cancer driver genes identified in this study, 261 (79%) are not currently identified as therapeutic targets in either COSMIC or OncoKB databases. As a means of triaging these genes as candidates for therapeutic intervention, we assessed the essential-ity and selectivity of driver genes and their druggability using RNAi/ CRISPR DepMap data and the integrative cancer-focused knowledge-base, canSAR, respectively 32,33 . We found 96 of 261 (37%) of these genes are predicted to be commonly essential and of these 12 of 96 (13%) have a chemical probe available and 35 of 96 (36%) have a ligandable three-dimensional (3D) structure (Supplementary Table 11). Motivated by the observation that targeting proteins which inter-act with cancer driver genes can result in successful precision oncology strategies, we sought to expand the network of druggable targets in cancer 34,35 . To this end, we used canSAR to map and pharmacologically annotate networks of the cancer genes identified for each tumor type. Specifically, we seeded networks with driver genes identified in each tumor group and used transcriptional and curated protein-protein interactions to recover a refined cancer-specific network of proteins, Breast_DuctalCA Breast_LobularCA P value P value Expected mutation rate Expected mutation rate 10 -4 10 -10 10 0 10 -1 10 -2 10 -3 10 -4 10 -10 10 0 10 -1 10 -2 10 -3 CNS_Astro CNS_GBM_IDHmut CNS_GBM_IDHwt CNS_Menin CNS_Oligo Kidney_CCRCC Kidney_ChRCC Breast Kidney CNS Connective Lung Connective_Chondro Connective_Leiomyo Connective_Liposarc Connective_Myxofibro Connective_Osteosarc Connective_SCS Connective_SS Lung_AdenoCA Lung_LargeCell Lung_SCC Lung_SmallCell Kidney_PRCC AKT1 ARID1A BRCA2 CBFB CDH1 CDKN1B CTCF ERBB2 GATA3 FOXA1 KMT2C KMT2D SPEN SF3B1 RUNX1 RB1 PTEN PIK3R1 PIK3CA NF1 NCOR1 MAP3K1 MAP2K4 PTEN PIK3CA NF1 IDH1 EGFR CIC ATRX ZFPM1 TP53 TBX3 RB1 TP53 IDH1 ATRX RB1 TP53 TERT ARID1A BAP1 KDM5C MTOR PBRM1 PTEN SETD2 TET2 TP53 VHL ARID1A ARID2 ATM BRAF CDH10 CDKN2A CMTR2 EGFR FAT1 FBXW7 KEAP1 KMT2D TP53 RB1 KRAS LRP1B MGA NF1 NFE2L2 NOTCH1 PIK3CA PTEN PKHD1L1 RASA1 RBM10 SETD2 SMAD4 SMARCA4 STK11 Fig. 5 | Comparison of driver gene somatic mutation rates between tumor histologies. Expected mutation rate and 95% confidence intervals of each driver in the cohort (2,306 breast, 440 central nervous system (CNS), 1,045 kidney, 1,110 lung and 607 connective tissue tumors in the 100kGP cohort) based on the number of samples in which the driver gene is mutated for the given tumor histology. Binomial P values are shown. The dashed red line corresponds to a false discovery rate of 0.01. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1873 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + each protein being annotated on the basis of several assessments of 'druggability', that is the likelihood of the protein being amenable to small molecule drug intervention. After seeding each cancer-specific network with their respective drivers, we yielded a total of 631 distinct proteins across all cancers (Supplementary Table 12). The median num-ber of unique proteins in each network across all cohorts was 57, with colorectal cancer possessing the largest network (n = 231; Extended Data Fig. 9) and spindle cell carcinoma possessing the smallest net-work (n = 10). As expected there was a correlation between network size and number of identified drivers for each cancer type (Pearson's r = 0.9, P = 1.23 × 10 -9 ). Of these 631 proteins, 58% (n = 369) were retrieved solely through network analysis, of which most (n = 323) were not formally identified as candidate driver genes in any cancer type (hereafter referred to as cancer-network proteins). Notable examples include HDAC1, CDK2 and CDK1, which were present in 31, 29 and 28 cohorts, respectively. We observed 70% (n = 225) of these cancer-network proteins as being targetable by existing approved or investigational therapies, with notable examples including BCL2 and BTK. Of the remaining 97 genes, 34 are commonly essential, 11 possess concordant lineage specificity, 48 are ligandable by 3D structure and 11 have an existing high-quality probe available (Supplementary Table 13). Collectively these data provide potential future opportunities for therapy for several cancers. For example, CDC5L, a core component of the Prp19 (hPrp19)/Cdc5L pre-RNA splicing complex, is part of the melanoma cancer protein network 36 . This protein is predicted to be commonly essential with lineage specificity and has a 3D ligandable structure. Discussion Clinical and laboratory observations have led to the recognition that genomic profiling of tumors is increasingly important for the management of patients with cancers 37 . To explore the value of WGS to precision oncology we have analysed WGS data on 10,470 patients recruited to the 100kGP study. Across all cancers, we identified 330 cancer driver genes, 74 of which are new to any cancer type. The candidate driver gene list is limited by focusing on point mutations and small indels without consideration of copy-number alterations, genomic fusions or meth-ylation events. Nevertheless, we believe it represents one of the most comprehensive efforts thus far to identify cancer driver genes and serves as an important research asset. The similarities and differences in driver mutation frequencies in cancers arising from the same organ imply both shared and divergent pathways in oncogenesis. Notably, however, many driver mutations are common across several differ-ent tumor types. If clinically translated, these observations suggest that currently 55% of patients' tumors harbor a potentially actionable mutation, either in terms of predicting sensitivity to certain treat-ments or clinical trial eligibility. This contrasts with 22% achievable if based on the current small variant testing panels in widespread use 38 . Although our assumption is predicated on approved drugs as a proxy for effective cancer therapies, a recent study of cancer drug approvals by the Food and Drug Administration (FDA) concluded that new cancer drug approvals reduce the risk of death and tumor progression 39 . To inform potential future therapeutic opportunities, we applied established chemogenomic technologies to map and pharmacologically annotate the cellular network of cancer genes identified by WGS. Through annotation of cellular networks with measures of essentiality and selectivity, we were able to highlight additional potential therapeutic targets in cancer. It is likely that such endeavors will be improved by exploiting emergent high-throughput reporter assays to assess the functional consequences of somatic driver mutations in greater detail 40 . a b ARID1A ATM BCL9L CREBBP CTNNB1 FBXW7 INPPL1 KMT2C MGA NF1 PIK3CA PIK3R1 PSPC1 PTEN RB1 RNF43 SMAD4 ZFHX3 ZFP36L2 TP53 0 25 50 75 100 0 50 100 150 Total number of subclonal oncogenic mutations in a cancer driver gene Proportion of oncogenic mutations in a cancer driver gene that are subclonal (%) APC KRAS APC ARID1A ATM BRAF KRAS NF1 PIK3CA PIK3R1 PTEN TP53 VHL 0 25 50 75 100 0 1,000 2,000 3,000 Total number of clonal oncogenic mutations in a cancer driver gene Proportion of oncogenic mutations in a cancer driver gene that are clonal (%) Fig. 6 | Distribution of clonal and subclonal oncogenic mutations in candidate cancer driver genes. a, Distribution of clonal oncogenic mutations in candidate cancer driver genes across all cancer types: y axis, percentage of all clonal oncogenic mutations of all oncogenic mutations; x axis, total number of clonal oncogenic mutations. Clonal oncogenic mutations include clonal mutations that occurred before duplications involving the relevant chromosome (early), clonal mutations that occurred after such duplications (late), and mutations that occurred when no duplication was observed. Genes labeled are those with >250 clonal oncogenic mutations or clonal oncogenic mutations represent >95% of all oncogenic mutations. b, Distribution of all subclonal oncogenic mutations in candidate cancer driver genes across all cancer types: y axis, percentage of all subclonal oncogenic mutations of all oncogenic mutations; x axis, total number of subclonal oncogenic mutations. Genes labeled are those with >50 subclonal oncogenic mutations and >5% of all oncogenic mutations as subclonal. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1874 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + The strengths of this study not only include the cohort size but the combination of systematic processing of samples and data aris-ing from several treatment centers across England. These strengths minimize the impact of between-center sequencing effects while ensuring a representative cohort of cancers are captured 41 . We do, however, acknowledge that while the spectrum of cancers included in our analysis is largely representative of those diagnosed in the United Kingdom, patients recruited to 100kGP are younger and predominantly have early-stage disease. Furthermore, characteristics such as patient ancestry and geography can affect the mutagenic profile of tumors, a Supported by compelling biological evidence None Clinical evidence in the cancer type or standard of care in a di erent cancer type FDA approved drug in the cancer type 3 4 0 b OncoKB actionability 1 2 Standard of care in the cancer type COSMIC actionability 3 Approved marketed drug with demonstrated e icacy at the mutation Phase 2/3 clinical results meet primary outcome measures Drug in ongoing clinical trials None 1 2 0 Tumor type 2,000 1,500 1,000 500 0 Number 2,000 1,500 1,000 500 0 Number BileDuct-AdenoCA Connective-SCS Connective-Liposarc Connective-Myxofibro Connective-Osteosarc Connective-Leiomyo CNS-Oligo Connective-Chondro Breast-DuctalCA Bladder-TCC Eso-AdenoCA HeadNeck-SCC Kidney-CCRCC Kidney-ChRCC Kidney-PRCC Liver-HCC Lung-AdenoCA Lung-SCC Lung-SmallCell Ovary-AdenoCA Panc-AdenoCA Prost-AdenoCA Skin-Melanoma Testis-GCT Uterus-AdenoCA Stomach-AdenoCA Mes-Mesothelioma Connective-SS Breast-LobularCA CNS-GBM-IDHmut CNS-GBM-IDHwt CNS-Astro CNS-Menin ColoRect-AdenoCA Lung-LargeCell BileDuct-AdenoCA Connective-SCS Connective-Liposarc Connective-Myxofibro Connective-Osteosarc Connective-Leiomyo CNS-Oligo Connective-Chondro Breast-DuctalCA Bladder-TCC Eso-AdenoCA HeadNeck-SCC Kidney-CCRCC Kidney-ChRCC Kidney-PRCC Liver-HCC Lung-AdenoCA Lung-SCC Lung-SmallCell Ovary-AdenoCA Panc-AdenoCA Prost-AdenoCA Skin-Melanoma Testis-GCT Uterus-AdenoCA Stomach-AdenoCA Mes-Mesothelioma Connective-SS Breast-LobularCA CNS-GBM-IDHmut CNS-GBM-IDHwt CNS-Astro CNS-Menin ColoRect-AdenoCA Lung-LargeCell Tumor type Fig. 7 | Clinical actionability ascribable to each candidate cancer driver gene. a, Clinical actionability ascribable to each candidate cancer driver gene according to COSMIC by cancer type. Tumors were annotated by the highest scoring gene mutation-indication pairing, with 'None' indicating no actionable mutations were detected in the tumor. b, Clinical actionability ascribable to each candidate cancer driver gene according to OncoKB by cancer type. Tumors were annotated by the highest scoring gene mutation-indication pairing, with 'None' indicating no actionable mutations were detected in the tumor. + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1875 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + which potentially impacts on the generalizability of our findings to worldwide populations 42,43 . Accepting these limitations, our observations indicate that, depending on cancer type, approximately 15% of patients are poten-tially eligible for a currently approved therapy targeting an oncogenic driver. Our discovery analysis, however, implies that far more patients may potentially be candidates for a therapy targeting a driver mutation or pathway. A long-standing criticism of precision oncology is that often its proponents overstate the clinical actionability of individual genes or genomic variants 44 . Mutations that are clinically validated and FDA-recognized as predictive biomarkers of drug response are often grouped together as clinically actionable, with such mutations poten-tially erroneously identified as the putative basis for outlier exceptional responses. To better communicate the strength of evidence support-ing the clinical actionability of individual mutant alleles, many variant knowledge bases stratify genomic alterations on the basis of the level of clinical and/or biological data supporting their use as a predictive biomarker of drug response or resistance. Here, we have sought to address such concerns by making use of well-curated resources to assign actionability to driver mutations. Specifically, we have queried knowledge databases which are regularly curated by an expert panel and are therefore recognized to reflect the current state of knowledge 31 . While the 100kGP was predicated on delivering diagnostic tests for well-established actionable mutations in NHS cancer patients with high sensitivity, concern has been raised over missing well-recognized clinically actionable mutations 45 . In our analysis the frequency of estab-lished cancer-specific oncogenic drivers recovered was, however, comparable to MSK-IMPACT and MSK-MET 6,9 . Moreover, the sensitivity of 100× WGS to identify mutations was high even for samples with low tumor purity (Supplementary Note 1 and Supplementary Figs. 3-7). A barrier to the broader success of precision oncology paradigms may be the many 'undruggable' oncogenic mutations coupled with the fact that targeting downstream effectors typically fails to demonstrate the levels of clinical efficacy of drugs that directly inhibit the mutated oncoprotein. Recent developments in protein structure prediction, new degraders, covalent inhibition and allosteric protein domain maps seek to unlock these 'undruggable' proteins 46-49 . Furthermore, WGS allows for the extension of analyses beyond the consideration of individual genetic alterations, thereby affording a clinically significant benefit over targeted panel sequencing assays. Mutational signatures associated with dMMR and HRD are increasingly being shown to be clinically relevant to defining responsiveness to immunotherapy and PARP inhibition, respectively 24,30 . Additionally, there is increasing evidence that other signatures reflecting the DNA repair capacity of cancer cells are predictive of drug responsiveness to other agents 5,50 . A more detailed discussion and comprehensive description of all classes of mutational signatures observed across the 100kGP are reported in our companion paper 29 . The ability to robustly characterize mutational signatures may therefore prove to be a major clinically significant incremental benefit of WGS over targeted panel sequencing assays. Moreover, the provision of WGS is likely to play a greater role in patient management given that T cell-based therapies are of increasing impor-tance and in silico approaches are now used to predict the presence of immunogenic tumor-specific neoantigens from WGS 51-54 . Despite the merits of WGS as a one-stop clinical assay, its wider adoption outside selected academic and commercial centers has been limited 37 . A great hurdle is that the tumor material available for many patients is of insufficient quantity, quality or purity for these broader sequencing platforms. Indeed, in the 100kGP the lack of access to fresh frozen samples (and/or those of sufficient quantity) precluded the analysis of tumors from many patients 11 . In designing clinical assays, the limitations imposed by cost and sequencing capacity require the balancing of sequencing breadth and depth 41 . At present, the higher coverage of targeted assays represents an advantage over WGS for detection of alterations in genes clinically validated as biomarkers of drug response, especially in samples with poor DNA quality or high stro-mal contamination. A wider adoption of WGS will require further reduc-tions in sequencing costs and technological improvements to enable the use of lower-quality, archival formalin-fixed, paraffin-embedded tumor tissue 55 . Any such developments will have to address the issue that formalin fixation adversely affects DNA quality and the ability to reliably call variants from WGS data, even when using bioinformatic correction 41,56,57 . Aside from such technical issues there are also inher-ent limitations to short-read WGS. Notably, structural variants cannot be robustly called, with low concordance being a feature of present implemented algorithms 58,59 . It is likely that this limitation will only be addressed by adoption of long-read sequencing, albeit presently this incurs a high requirement for DNA and further cost, thus restricting its use in the diagnostic setting 60 . The continued decline in sequencing costs and the identification of new genomic biomarkers predictive of drug response have driven the rapid adoption of multigene profiling of patients as a component of routine cancer care. As our analysis indi-cates, the future adoption of WGS or broader panels has the potential to enable more accurate assessments of the driver mutational landscape predictive of drug response. Online content Any methods, additional references, Nature Portfolio reporting sum-maries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contri-butions and competing interests; and statements of data and code avail-ability are available at https://doi.org/10.1038/s41588-024-01785-9. + + References 1. Topol, E. J. Individualized medicine from pre-womb to tomb. Cell 157, 241-253 (2014). 2. Schwartzberg, L., Kim, E. S., Liu, D. & Schrag, D. Precision oncology: who, how, what, when and when not? Am. Soc. Clin. Oncol. Educ. Book 37, 160-169 (2017). 3. Stratton, M. R., Campbell, P. J. & Futreal, P. A. The cancer genome. Nature 458, 719-724 (2009). 4. Martínez-Jiménez, F. et al. A compendium of mutational cancer driver genes. Nat. Rev. Cancer 20, 555-572 (2020). 5. Chakravarty, D. & Solit, D. B. Clinical cancer genomic profiling. Nat. Rev. Genet. 22, 483-501 (2021). 6. Cheng, D. T. et al. Memorial Sloan Kettering-integrated mutation profiling of actionable cancer targets (MSK-IMPACT): a hybridization capture-based next-generation sequencing clinical assay for solid tumor molecular oncology. J. Mol. Diagn. 17, 251-264 (2015). 7. Redig, A. J. & Jänne, P. A. Basket trials and the evolution of clinical trial design in an era of genomic medicine. J. Clin. Oncol. 33, 975-977 (2015). 8. Hyman, D. M., Taylor, B. S. & Baselga, J. Implementing genome-driven oncology. Cell 168, 584-599 (2017). 9. Zehir, A. et al. Mutational landscape of metastatic cancer revealed from prospective clinical sequencing of 10,000 patients. Nat. Med. 23, 703-713 (2017). 10. Cuppen, E. et al. Implementation of whole-genome and transcriptome sequencing into clinical cancer care. JCO Precis Oncol. 6, e2200245 (2022). 11. Turnbull, C. et al. The 100 000 Genomes Project: bringing whole genome sequencing to the NHS. Br. Med. J. 361, k1687 (2018). 12. ICGC/TCGA Pan-Cancer Analysis of Whole Genomes Consortium. Pan-cancer analysis of whole genomes. Nature 578, 82-93 (2020). 13. Bailey, M. H. et al. Comprehensive characterization of cancer driver genes and mutations. Cell 173, 371-385 (2018). 14. Wang, K. et al. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer. Nat. Genet. 46, 573-582 (2014). + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1876 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + 15. Gerstung, M. et al. The evolutionary history of 2,658 cancers. Nature 578, 122-128 (2020). 16. Gerlinger, M. et al. Genomic architecture and evolution of clear cell renal cell carcinomas defined by multiregion sequencing. Nat. Genet. 46, 225-233 (2014). 17. Gibson, W. J. et al. The genomic landscape and evolution of endometrial carcinoma progression and abdominopelvic metastasis. Nat. Genet. 48, 848-855 (2016). 18. Yates, L. R. et al. Genomic evolution of breast cancer metastasis and relapse. Cancer Cell 32, 169-184 (2017). 19. André, F. et al. Alpelisib for PIK3CA-mutated, hormone receptor-positive advanced breast cancer. N. Engl. J. Med. 380, 1929-1940 (2019). 20. Varkaris, A. et al. Allosteric PI3K-alpha inhibition overcomes on-target resistance to orthosteric inhibitors mediated by secondary PIK3CA mutations. Cancer Discov. 14, 227-239 (2024). 21. Fell, J. B. et al. Identification of the clinical development candidate, a covalent KRAS inhibitor for the treatment of cancer. J. Med. Chem. 63, 6679-6693 (2020). 22. Canon, J. et al. The clinical KRAS(G12C) inhibitor AMG 510 drives anti-tumour immunity. Nature 575, 217-223 (2019). 23. Mateo, J. et al. A first-time-in-human study of GSK2636771, a phosphoinositide 3 kinase beta-selective inhibitor, in patients with advanced solid tumors. Clin. Cancer Res. 23, 5981-5992 (2017). 24. Chopra, N. et al. Homologous recombination DNA repair deficiency and PARP inhibition activity in primary triple negative breast cancer. Nat. Commun. 11, 2662 (2020). 25. Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005). 26. Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009). 27. Konstantinopoulos, P. A. et al. Gene expression profile of BRCAness that correlates with responsiveness to chemotherapy and with outcome in patients with epithelial ovarian cancer. J. Clin. Oncol. 28, 3555-3561 (2010). 28. Purwar, R. et al. Role of PARP inhibitors beyond BRCA mutation and platinum sensitivity in epithelial ovarian cancer: a meta-analysis of hazard ratios from randomized clinical trials. World J. Surg. Oncol. 21, 157 (2023). 29. Everall, A. et al. Comprehensive repertoire of the chromosomal alteration and mutational signatures across 16 cancer types from 10,983 cancer patients. Preprint at medRxiv https://doi. org/10.1101/2023.06.07.23290970 (2023). 30. Marabelle, A. et al. Association of tumour mutational burden with outcomes in patients with advanced solid tumours treated with pembrolizumab: prospective biomarker analysis of the multicohort, open-label, phase 2 KEYNOTE-158 study. Lancet Oncol. 21, 1353-1365 (2020). 31. Chakravarty, D. et al. OncoKB: a precision oncology knowledge base. JCO Precis. Oncol. https://doi.org/10.1200/po.17.00011 (2017). 32. Shimada, K., Bachman, J. A., Muhlich, J. L. & Mitchison, T. J. shinyDepMap, a tool to identify targetable cancer genes and their functional connections from Cancer Dependency Map data. eLife 10, e57116 (2021). 33. Mitsopoulos, C. et al. canSAR: update to the cancer translational research and drug discovery knowledgebase. Nucleic Acids Res. 49, D1074-D1082 (2020). 34. Filippakopoulos, P. et al. Selective inhibition of BET bromodomains. Nature 468, 1067-1073 (2010). 35. Zhao, Y., Aguilar, A., Bernard, D. & Wang, S. Small-molecule inhibitors of the MDM2-p53 protein-protein interaction (MDM2 inhibitors) in clinical trials for cancer treatment. J. Med. Chem. 58, 1038-1052 (2015). 36. Burns, C. G., Ohi, R., Krainer, A. R. & Gould, K. L. Evidence that Myb-related CDC5 proteins are required for pre-mRNA splicing. Proc. Natl Acad. Sci. USA 96, 13789-13794 (1999). 37. Freedman, A. N. et al. Use of next-generation sequencing tests to guide cancer treatment: results from a nationally representative survey of oncologists in the United States. JCO Precis. Oncol. https://doi.org/10.1200/PO.18.00169 (2018). 38. National Genomic Test Directory (NHS England, accessed 7 February 2023); https://www.england.nhs.uk/publication/ national-genomic-test-directories/ 39. Michaeli, D. T. & Michaeli, T. Overall survival, progression-free survival and tumor response benefit supporting initial US Food and Drug Administration approval and indication extension of new cancer drugs, 2003-2021. J. Clin. Oncol. 40, 4095-4106 (2022). 40. Kim, Y. et al. High-throughput functional evaluation of human cancer-associated mutations using base editors. Nat. Biotechnol. 40, 874-884 (2022). 41. Xiao, W. et al. Toward best practice in cancer mutation detection with whole-genome and whole-exome sequencing. Nat. Biotechnol. 39, 1141-1150 (2021). 42. Ansari-Pour, N. et al. Whole-genome analysis of Nigerian patients with breast cancer reveals ethnic-driven somatic evolution and distinct genomic subtypes. Nat. Commun. 12, 6946 (2021). 43. Hoang, M. L. et al. Mutational signature of aristolochic acid exposure as revealed by whole-exome sequencing. Sci. Transl. Med. 5, 197ra102 (2013). 44. Prasad, V. Perspective: the precision-oncology illusion. Nature 537, S63 (2016). 45. Cibulskis, K. et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 31, 213-219 (2013). 46. Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021). 47. Faure, A. J. et al. Mapping the energetic and allosteric landscapes of protein binding domains. Nature 604, 175-183 (2022). 48. Singh, J., Petter, R. C., Baillie, T. A. & Whitty, A. The resurgence of covalent drugs. Nat. Rev. Drug Discov. 10, 307-317 (2011). 49. Sakamoto, K. M. et al. Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Proc. Natl Acad. Sci. USA 98, 8554-8559 (2001). 50. Brady, S. W., Gout, A. M. & Zhang, J. Therapeutic and prognostic insights from the analysis of cancer mutational signatures. Trends Genet. 38, 194-208 (2022). 51. Gross, G., Waks, T. & Eshhar, Z. Expression of immunoglobulin-T-cell receptor chimeric molecules as functional receptors with antibody-type specificity. Proc. Natl Acad. Sci. USA 86, 10024-10028 (1989). 52. June, C. H., O'Connor, R. S., Kawalekar, O. U., Ghassemi, S. & Milone, M. C. CAR T cell immunotherapy for human cancer. Science 359, 1361-1365 (2018). 53. Hundal, J. et al. pVAC-Seq: a genome-guided in silico approach to identifying tumor neoantigens. Genome Med. 8, 11 (2016). 54. Sarkizova, S. et al. A large peptidome dataset improves HLA class I epitope prediction across most of the human population. Nat. Biotechnol. 38, 199-209 (2020). 55. Schwarze, K. et al. The complete costs of genome sequencing: a microcosting study in cancer and rare diseases from a single center in the United Kingdom. Genet. Med. 22, 85-94 (2019). 56. Do, H. & Dobrovic, A. Sequence artifacts in DNA from formalin-fixed tissues: causes and strategies for minimization. Clin. Chem. 61, 64-71 (2015). + + Nature Genetics | Volume 56 | September 2024 | 1868-1877 + + 1877 + + Article https://doi.org/10.1038/s41588-024-01785-9 + + 57. Wong, S. Q. et al. Sequence artefacts in a prospective series of formalin-fixed tumours tested for mutations in hotspot regions by massively parallel sequencing. BMC Med. Genomics 7, 23 (2014). 58. Li, Y. et al. Patterns of somatic structural variation in human cancer genomes. Nature 578, 112-121 (2020). 59. Kosugi, S. et al. Comprehensive evaluation of structural variation detection algorithms for whole genome sequencing. Genome Biol. 20, 117 (2019). 60. Amarasinghe, S. L. et al. Opportunities and challenges in long-read sequencing data analysis. Genome Biol. 21, 30 (2020). + + Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons. org/licenses/by/4.0/. © The Author(s) 2024 + + Nature Genetics Article https://doi.org/10.1038/s41588-024-01785-9 + +
Methods The 100kGP cohort The analysed cohort comprised tumor-normal sample pairs from patients with primary cancers recruited to 100kGP (v.11 release) through 13 Genomic Medicine Centers across England (Supplementary Fig. 9). Genomics England has obtained written informed consent from all participants. We restricted our analysis to high-quality sequencing data derived from PCR-free, flash-frozen primary solid tumor samples from 10,470 adults (34 bile duct, 305 bladder, 2,306 breast, 2,324 colo-rectal, 440 central nervous system, 91 esophageal, 201 head and neck, 1,045 renal cell, 24 liver, 1,110 lung, 35 mesothelioma, 607 soft tissue, 454 ovarian, 94 pancreas, 366 prostate, 270 melanoma, 72 gastric, 51 testicular and 649 uterus) (Supplementary Tables 1-3). Comprehensive clinicopathology information on the patients is provided in Supple-mentary Table 3 and complete details on sample curation, tumor purity per cancer type (Extended Data Fig. 10), WGS, somatic variant calling, mutation annotation and power calculations are provided in Supple-mentary Note 1. We identified mutational signatures associated with dMMR and HRD in tumors using SigProfilerExtractor complemented by mSINGS and HRDetect (Supplementary Note 1) 29,61,62 . Identification and timing of driver genes Cancer driver genes for each of the tumor types were identified using the IntOGen pipeline (Supplementary Note 1) 4 . We examined the sensitivity of WGS in the 100kGP cohort to detect mutations in well-established driver genes based on sample purity and gene cover-age and by comparing the call rates of panel sequencing reported in the Integrated Mutation Profiling of Actionable Cancer Targets and Metastatic Events and Tropisms studies of cancer conducted by the MSK Cancer Center (Supplementary Note 1) 6,63 . The relative evolu-tionary timings of candidate driver mutations were obtained using MutationTimeR (Supplementary Note 1) 15 . Actionability of driver gene mutations and networks We first queried the OncoKB and COSMIC Mutation Actionability in Precision Oncology Product databases to evaluate the therapeutic implications of genetic events 31,64 . Both databases catalog approved marketed drugs having demonstrated efficacy in tumors with specified driver gene mutations, based on clinical trials and published clinical evidence. OncoKB also provides compelling biological evidence sup-porting the cancer driver gene as being predictive of a response to a given drug. To undertake a chemogenic analysis of cancer networks for each cancer type, we used protein products of the cancer driver genes to seed a search for all interacting proteins in the canSAR interactome 33 , which is based on information from eight databases, including the IMeX consortium 65 , Phosphosite 66 and key publications. We annotated proteins with pharmacological and druggability data using canSAR's Cancer Protein Annotation Tool. Essential and selective genes including lineage specificity were ascertained from the ShinyDepMap analysis server (Supplementary Note 1) 32 . Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
+ +
Data availability Summary statistics for each tumor group are provided in the Supplemen-tary Tables where such data do not enable identification of participants. All sample-specific WGS data and processed files from the 100,000 Genomes Project can be accessed by joining the Pan Cancer Genomics England Clinical Interpretation Partnership (GeCIP) Domain once an individual's data access has been approved (https://www.genomicseng-land.co.uk/research/pan-cancer-and-molecular-oncology-communit y). The link to becoming a member of the Genomics England research network and obtaining access can be found at https://www.genomic-sengland.co.uk/research/academic/join-gecip. The process involves an online application, verification by the applicant's institution, com-pletion of a short information governance training course and veri-fication of approval by Genomics England. Please see https://www. genomicsengland.co.uk/research/academic for more information. The Genomics England data access agreement can be obtained from figshare at https://doi.org/10.6084/m9.figshare.4530893.v7 (ref. 67). All analysis of Genomics England data must take place within the Genom-ics England Research Environment (https://www.genomicsengland. co.uk/understanding-genomics/data). The 100,000 Genomes Pro-ject publication policies can be obtained from https://www.genom-icsengland.co.uk/about-gecip/publications. Samples and results used in this study are provided in Genomics England under /re_gecip/ shared_allGeCIPs/pancancer_drivers/results/. A MAF-like file detailing coding mutations across all 100kGP tumors analysed is available at / re_gecip/shared_allGeCIPs/pancancer_drivers/results/. The COSMIC and OncoKB clinical actionability data are available from https://cancer. sanger.ac.uk/actionability and https://www.oncokb.org/actionable Genes#sections=Tx, respectively. The canSAR chemogenomics data are available from https://cansar.ai/. The NHS Genomic Test Directory for Cancer is available from https://www.england.nhs.uk/publication/ national-genomic-test-directories/. Lists of drivers from previous stud-ies were obtained from COSMIC (https://cancer.sanger.ac.uk/cmc/ home), IntOGen (https://www.intogen.org/search) and the The Cancer Genome Atlas (TCGA) Program pan-cancer analysis reported by ref. 13. Somatic mutations were annotated to the cached version of GRCh38 in VEP v.101.
+ +
Code availability Details and code for using the IntOGen framework are available at https://intogen.readthedocs.io/en/latest/index.html. The specific code to perform this analysis is available in the Genomics England research environment (https://re-docs.genomicsengland.co.uk/ access/) under /re_gecip/shared_allGeCIPs/pancancer_drivers/code/. The link to becoming a member of the Genomics England research network and obtaining access can be found at https://www.genomic-sengland.co.uk/research/academic/join-gecip. The code to perform the canSAR chemogenomics analysis is available through Zenodo (https://doi.org/10.5281/zenodo.8329054) (ref. 68).
+ + References 61. Davies, H. et al. HRDetect is a predictor of BRCA1 and BRCA2 deficiency based on mutational signatures. Nat. Med. 23, 517-525 (2017). 62. Salipante, S. J., Scroggins, S. M., Hampel, H. L., Turner, E. H. & Pritchard, C. C. Microsatellite instability detection by next generation sequencing. Clin. Chem. 60, 1192-1199 (2014). 63. Nguyen, B. et al. Genomic characterization of metastatic patterns from prospective clinical sequencing of 25,000 patients. Cell 185, 563-575 (2022). 64. Tate, J. G. et al. COSMIC: the catalogue of somatic mutations in cancer. Nucleic Acids Res. 47, D941-D947 (2019). 65. Orchard, S. et al. The MIntAct project-IntAct as a common curation platform for 11 molecular interaction databases. Nucleic Acids Res. 42, D358-D363 (2014). 66. Hornbeck, P. V. et al. PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res. 43, D512-D520 (2015). 67. Caulfield, M. et al. National Genomic Research Library [Dataset]. figshare https://doi.org/10.6084/m9.figshare.4530893.v7 (2017). 68. Lärkeryd, A. instituteofcancerresearch/cansar-ddn: v0.1.0 (v0.1.0). Zenodo https://doi.org/10.5281/zenodo.8329054 (2023). 69. Shannon, P. et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498-2504 (2003). + + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
Acknowledgements Funding was provided by the Wellcome Trust (214388), Cancer Research UK (C1298/A8362) and the Medical Research Council. A.S. is in receipt of a National Institute for Health Research (NIHR) Academic Clinical Lectureship, funding from the Royal Marsden Biomedical Research Centre, a starter grant for clinical lecturers from the Academy of Medical Sciences and a Wellcome Trust Early Career Award (227000/Z/23/Z). This is a summary of independent research supported by the NIHR Biomedical Research Centre at the Royal Marsden NHS Foundation Trust and the Institute of Cancer Research. This research was made possible through access to the data and findings generated by the 100,000 Genomes Project. The 100,000 Genomes Project is managed by Genomics England Limited (a wholly owned company of the Department of Health and Social Care). The 100,000 Genomes Project is funded by the National Institute for Health Research and NHS England. The Wellcome Trust, Cancer Research UK and the Medical Research Council also funded research infrastructure. The 100,000 Genomes Project uses data provided by patients and collected by the NHS as part of their care and support. We thank Genomics England for the communication regarding the sensitivity of WGS for detection of well-established cancer driver mutations.
+ +
Author contributions B.K., A.S. and R.H. designed the study. B.K., A.S., A.J.C. and D.C. performed sample curation. B.K., A.S., A.E., A.J.C., D.C., R.C., A.J.G., A.L., C.M. and D.W. performed bioinformatic and statistical analysis. B.K., A.S., A.E. and R.H. drafted the manuscript; all authors reviewed, read and approved the final manuscript. Competing interests The authors declare no competing interests. Additional information Extended data is available for this paper at https://doi.org/10.1038/s41588-024-01785-9. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41588-024-01785-9. Correspondence and requests for materials should be addressed to Richard Houlston. Peer review information Nature Genetics thanks Stephen J. Chanock and Jo Lynne Rokita for their contribution to the peer review of this work. Peer reviewer reports are available. Reprints and permissions information is available at www.nature.com/reprints.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
0 500 1000 1500 2000 Bladder Breast Colorectum Kidney Lung Melanoma Oesophagus Ovary Pancreas Prostate Testis Uterus Site Number 0 10000 20000 30000 40000 50000 Bladder Breast Colorectum Kidney Lung Melanoma Oesophagus Ovary Pancreas Prostate Testis Uterus Site Number Genomics England NHS England Extended Data Fig. 1 | Comparison of number of samples per tumour type in the pan-cancer cohort compared to all cancer diagnosed in England in 2019. Upper panel: the 100kGP cohort; lower panel: incidence of the different cancer types reported in the general population.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
55 61 27 241 56 51 34 305 2001 305 2324 117 95 111 126 60 64 34 91 52 133 157 49 61 53 201 872 68 105 24 677 25 382 26 35 10 100 1000 10000 100000 1000000 10000000 CNS-Oligo CNS-Astro CNS-GBM-IDHmut CNS-GBM-IDHwt CNS-Menin Testis-GCT BileDuct-AdenoCA Bladder-TCC Breast-DuctalCA Breast-LobularCA ColoRect-AdenoCA Connective-Chondro Connective-Leiomyo Connective-Liposarc Connective-Myxofibro Connective-Osteosarc Connective-SCS Connective-SS Eso-AdenoCA HeadNeck-SCC Kidney-CCRCC Kidney-ChRCC Kidney-PRCC Liver-HCC Lung-AdenoCA Lung-LargeCell Lung-SCC Lung-SmallCell Mes-Mesothelioma Ovary-AdenoCA Panc-AdenoCA Prost-AdenoCA Skin-Melanoma Stomach-AdenoCA Uterus-AdenoCA SNV Mutation Count Extended Data Fig. 2 | Mutation burden of tumours by each tumour type. The number of samples contributing to each tumour type are shown above the plot. SNV, single nucleotide variant.
+ + Nature Genetics Article + + https://doi.org/10.1038/s41588-024-01785-9 + + Extended Data Fig. 3 | Circos heatmap of candidate cancer driver genes identified. Heatmap intensity proportional to the q value. + + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
Recep_L_domain Furin-like GF_recep_IV PK_Tyr_Ser-Thr 0 150 300 450 600 750 900 1050 1200 0 5 10 15 20 25 30 p .G lu 7 0 9 A la p .G lu 7 0 9 _ T h r7 1 0 d e li n s A s p p .G ly 7 1 9 A la p .G ly 7 1 9 S e r p .G ly 7 1 9 C y s p .G ly 7 1 9 A s p p .G lu 7 4 6 _ T h r7 5 1 d e li n s Il e p .G lu 7 4 6 _ A la 7 5 0 d e l p .G lu 7 4 6 _ A la 7 5 0 d e l p .G lu 7 4 6 _ S e r7 5 2 d e li n s V a l p .L e u 7 4 7 _ S e r7 5 2 d e l p .L e u 7 4 7 _ P ro 7 5 3 d e li n s S e r p .L e u 7 4 7 _ T h r7 5 1 d e l p .L e u 7 4 7 _ A la 7 5 0 d e l p .L e u 7 4 7 _ T h r7 5 1 d e li n s P ro p .L e u 7 4 7 _ A la 7 5 0 d e li n s P ro p .A la 7 6 7 _ S e r7 6 8 in s C y s V a l p .A la 7 6 7 _ V a l7 6 9 d u p p .S e r7 6 8 C y s p .S e r7 6 8 Il e p .S e r7 6 8 _ A s p 7 7 0 d u p p .P ro 7 7 2 _ H is 7 7 3 in s T h rG ln P ro A s n P ro p .P ro 7 7 2 _ H is 7 7 3 in s G ly H is P ro p .H is 7 7 3 d e li n s A s n P ro A s n P ro T y r p .H is 7 7 3 L e u p .T h r7 9 0 M e t p .L e u 8 3 3 V a l p .L e u 8 3 3 P h e p .H is 8 3 5 L e u p .L e u 8 5 8 A rg p .L e u 8 5 8 A rg p .L e u 8 6 1 G ln Inframe deletion Inframe insertion Missense Nonsynonymous VUS Mutation count AA position EGFR (ENST00000275493) Recep_L_domain Furin-like GF_recep_IV PK_Tyr_Ser-Thr 0 150 300 450 600 750 900 1050 1200 0 2 4 6 8 10 12 p .L e u 6 2 A rg p .A rg 1 0 8 T h r p .A rg 1 0 8 L y s p .A rg 2 2 2 C y s p .T h r2 6 3 P ro p .A la 2 8 9 V a l p .A la 2 8 9 T h r p .A la 2 8 9 A s p p .H is 3 0 4 T y r p .T h r3 6 3 S e r p .T h r3 6 3 Il e p .P ro 5 9 6 L e u p .G ly 5 9 8 V a l p .S e r6 4 5 C y s p .H is 7 7 3 d u p p .G lu 9 3 1 G ly Missense VUS Inframe insertion Mutation count AA position EGFR (ENST00000275493) Lung adenocarcinoma GBM, IDH wildtype PI3K_rbd PI3_PI4_kinase PI3K_C2 PI3K_p85B PI3Ka 0 125 250 375 500 625 750 875 1000 1068 0 10 20 30 40 p .A rg 8 8 G ln p .A rg 9 3 T r p p .L y s 1 1 1 G lu p .G lu 5 4 2 L y s p .G lu 5 4 5 L y s p .G ln 5 4 6 A rg p .T h r1 0 2 5 A la p .H is 1 0 4 7 A rg Missense VUS Inframe deletion Frameshift Inframe insertion Mutation count AA position PIK3CA (ENST00000263967) Uterine adenocarcinoma PI3K_rbd PI3_PI4_kinase PI3K_C2 PI3K_p85B PI3Ka 0 125 250 375 500 625 750 875 1000 1068 0 50 100 150 200 250 p .A s n 3 4 5 L y s p .C y s 4 2 0 A rg p .G lu 5 4 2 L y s p .G lu 5 4 5 L y s p .G ln 5 4 6 A rg p .H is 1 0 4 7 A rg Missense VUS Inframe deletion Frameshift Nonsynonymous Mutation count AA position PIK3CA (ENST00000263967) Breast ductal carcinoma a b Extended Data Fig. 4 | Mutation plots and pfam domain overlap for: (a) EGFR mutations in lung adenocarcinoma and GBM IDH wildtype; (b) PIK3CA mutations in uterine adenocarcinoma and breast ductal carcinoma. Domain specific mutations were assessed by considering the cancer drivers where smRegions is a significant bidder (Q-value < 0.1) and the driver is annotated in multiple cancer types.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
ColoRect-AdenoCA Uterus-AdenoCA Bladder-TCC Breast-DuctalCA Breast-LobularCA Lung-AdenoCA HeadNeck-SCC Lung-SCC Kidney-CCRCC Skin-Melanoma CNS-GBM-IDHwt Ovary-AdenoCA CNS-Oligo Prost-AdenoCA Connective-Myxofibro Panc-AdenoCA Stomach-AdenoCA BileDuct-AdenoCA Connective-Leiomyo Eso-AdenoCA Lung-LargeCell Lung-SmallCell Connective-Liposarc Connective-SCS Kidney-ChRCC CNS-Menin Kidney-PRCC Testis-GCT Mes-Mesothelioma Connective-Osteosarc Connective-SS Liver-HCC Connective-Chondro CNS-Astro CNS-GBM-IDHmut Extended Data Fig. 5 | Hierarchical clustering of tumour types based on P-value of candidate driver genes across the 35 different tumour types. Clustering performed using the hclust function in R.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
0 5 10 15 20 BileDuct-AdenoCA Bladder-TCC Breast-DuctalCA Breast-LobularCA CNS-Astro CNS-GBM-IDHmut CNS-GBM-IDHwt CNS-Menin CNS-Oligo ColoRect-AdenoCA Connective-Chondro Connective-Leiomyo Connective-Liposarc Connective-Myxofibro Connective-Osteosarc Connective-SCS Connective-SS Eso-AdenoCA HeadNeck-SCC Kidney-CCRCC Kidney-ChRCC Kidney-PRCC Liver-HCC Lung-AdenoCA Lung-LargeCell Lung-SCC Lung-SmallCell Mes-Mesothelioma Ovary-AdenoCA Panc-AdenoCA Prost-AdenoCA Skin-Melanoma Stomach-AdenoCA Testis-GCT Uterus-AdenoCA Tumour type Number Extended Data Fig. 6 | Per-tumour distribution of oncogenic mutations in tumour specific candidate cancer driver genes, across the 35 cancer types. Analysis restricted to driver genes as predicted by IntOGen in the given cancer type. Oncogenicity predicted using OncoKB. The line within the box shows the median number of oncogenic mutations per sample in the cancer type. The box represents the interquartile range and whiskers represent the range.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
TP53 APC PIK3CA KRAS PTEN ARID1A KMT2C VHL ACVR2A RNF43 BRAF PBRM1 FBXW7 PIK3R1 NF1 ATM MAP3K1 TCF7L2 TGFBR2 RB1 SETD2 CDH1 SOX9 GATA3 SMAD4 CDKN2A FAT1 CTNNB1 SPEN NRAS CASP8 IDH1 AKT1 EP300 EGFR NOTCH1 TET2 STK11 BCOR SMARCA4 ARID1B FGFR3 BAP1 HLA-A HLA-B ERBB3 SF3B1 NFE2L2 ELF3 MTOR BRCA1 SMAD2 CBFB FGFR2 KDM6A PPP2R1A AMER1 KEAP1 STAG2 PDE4DIP SMAD3 ESR1 MUC20 XPO1 KIT FCGR3A ACVR1 XCL2 ANKRD36 CNTNAP3 IGSF3 PCBP1 PNRC2 SEC22B SLC35G5 CHD4 PANCANCER (Oncogenic) 0 1000 2000 3000 Clonal (NA) Clonal (early) Clonal (late) Subclonal NA Extended Data Fig. 7 | Oncogenic clonal and subclonal mutations across candidate driver genes across all tumor types. Oncogenic clonal and subclonal mutations across candidate driver genes pan-cancer.
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + + a) c) b) d) TP53 RB1 KRAS LRRC4C AKAP9 PKHD1L1 ANK1 BCL7A CDH10 PDGFRA PREX2 Lung-LargeCell (Oncogenic) 0 5 10 15 Clonal (NA) Clonal (early) Clonal (late) Subclonal NA NF2 AKT1 KLF4 PIK3CA SMARCB1 SMO USP17L22 ATM TRAF7 ZSCAN5A CNS-Menin (Oncogenic) 0 5 10 15 Clonal (NA) Clonal (early) Clonal (late) Subclonal NA KIT KRAS MUC20 NRAS RAC1 BIRC6 KLF4 EP300 SPEN Testis-GCT (Oncogenic) 0 2 4 6 8 10 Clonal (NA) Clonal (early) Clonal (late) Subclonal NA IDH1 CIC FUBP1 NIPBL NOTCH1 IDH2 TCF12 ARID1A PIK3CA SMARCA4 ZBTB20 ATRX BCOR PBRM1 CNS-Oligo (Oncogenic) 0 10 20 30 40 Clonal (NA) Clonal (early) Clonal (late) Subclonal NA Extended Data Fig. 8 | Oncogenic clonal and subclonal mutations across candidate driver genes. Oncogenic clonal and subclonal mutations across candidate driver genes in: a) Meningioma; b) Large cell lung cancer; c) Testicular germ cell tumour; d) Oligodendroglioma. + + Nature Genetics Article + +
https://doi.org/10.1038/s41588-024-01785-9 RUNX1 IFNG PRKCD ASXL1 APC HNF4A PRKCI HDAC6 CDK1 HLA-B BTK BCL2 MT-ND4 ERBB4 PLG ALK BCL9 SPTA1 EP300 KIT AMER1 PIK3CB MC4R TNRC6B CDK2 ESR1 MAPK11 THRB PSMA3 RPS27 TOP2B ARID1A ERBB2 MAPK14 BCR RPL13 FRK MAP3K21 AKT1 MTOR SMG1 TOP1 NTRK1 PTGIR PPARD CHEK1 MAP3K1 HDAC9 TOP2A INSR GLP1R ACVR2A ATM MMP1 CYP17A1 VDR RET SYK PPARA SRC CTNNB1 CYP11A1 CDK4 PDGFRA MAP3K11 ITK CTNND1 TCF7L2 IL6 RARG KDR GCGR SMAD1 PRKCA RAF1 RPLP0 EEF2 FLT3 ZFP36L2 OLIG2 CSNK1A1 NR3C1 RARB ADRB3 TGFBR1 ROCK1 HDAC1 CSNK1E HLA-A HDAC4 MGAM EPHA2 MTNR1B CHD4 PRKCE JAK2 PRKD1 NCF1 WEE1 HTR6 PABPC1 ABL1 TYMS ESR2 IL1R1 AVPR2 IDH1 PCBP1 EGFR FYN LCK PAK1 AXL PEX5 EZH2 TP53 YES1 PGR VEGFA ADORA1 BLK DDB1 JUN CYP19A1 CSF1R EPCAM OXTR SMARCA4 DUSP16 CREBBP IKBKB GNAS TSHR SSTR2 TUBB SMN1 NRAS XPO1 ADRB2 FLT1 GNRHR LYN SMN2 AR HDAC3 HSP90AA1 ALOX12 PDPK1 RPL14 FAM83B MAP2K2 ZBTB7A IGF1R MAP2K4 PIK3CG IL2 RNF43 MAP2K1 PAK4 ABCB1 RXRA ACVR1 RPS20 RRM2B FNTA PARP1 MME TGIF1 PTK6 UBE2N BCL9L FNTB DNMT1 MET DRD1 FGFR2 RPS6 MGA PRKCQ PPARG SMAD2 TBXA2R FGFR3 RPS26 ARID1B TGFB1 GSK3B HCK FGFR1 JAK3 RPS27A PSPC1 BRAF CDK9 MMP7 RPS3 CDK6 ADORA2A HDAC2 KRAS SMAD3 PLK1 PDGFRB PIK3CA PRKCZ PTGER4 FBXW7 PIK3CD SMAD4 CSNK2A1 PTEN RPS6KB1 PARP2 PTGER2 SIN3A ERBB3 TNF PRKDC SOX9 JAK1 PTGS2 TNNC1 EPAS1 PIK3R1 RBM10 CDK5 RARA CCND1 ELF3 TUBA1B PNRC2 Extended Data Fig. 9 | Example druggability network for colorectal cancer. Nodes acting as cancer-specific drivers are shaded purple. Edge visual properties are as follows: OncoKB interactions, red contiguous arrow; Signor interactions, green contiguous arrow; Signor inhibitors, black vertical slash; complex, black zigzag; direct interaction, red solid line; direct X-ray interaction, green solid line; direct non-protein data bank interaction, blue solid line; reaction, blue contiguous arrow; transcriptional interaction, black sinewave. Figure generated using Cytoscape 69 .
+ + Nature Genetics + + Article https://doi.org/10.1038/s41588-024-01785-9 + +
Connective-SS CNS-GBM-IDHmut Connective-Leiomyo CNS-Oligo CNS-Astro Lung-SmallCell Kidney-ChRCC CNS-GBM-IDHwt Bladder-TCC CNS-Menin Lung-LargeCell Kidney-PRCC Liver-HCC Connective-Osteosarc Uterus-AdenoCA Connective-Liposarc Ovary-AdenoCA Connective-SCS Connective-Chondro Connective-Myxofibro Skin-Melanoma Prost-AdenoCA Kidney-CCRCC Breast-DuctalCA ColoRect-AdenoCA Testis-GCT Breast-LobularCA Eso-AdenoCA Mes-Mesothelioma Stomach-AdenoCA Lung-SCC HeadNeck-SCC BileDuct-AdenoCA Lung-AdenoCA Panc-AdenoCA 0.00 0.25 0.50 0.75 1.00 Tumour Purity Tumour Group Extended Data Fig. 10 | Violin plot of estimated tumour purity per cancer type. Black square within each violin corresponds to the median value. Violin trimmed to the lowest and highest tumour purity estimate per cancer group. Purity estimates from Battenberg or Ccube.
+ + 1 + +
nature portfolio | reporting summary April 2023 Corresponding author(s): Richard Houlston Last updated by author(s): Mar 30, 2024 Reporting Summary Nature Portfolio wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Portfolio policies, see our Editorial Policies and the Editorial Policy Checklist. Statistics For all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section. n/a Confirmed The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly The statistical test(s) used AND whether they are one-or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section. A description of all covariates tested A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals) For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted Give P values as exact values whenever suitable. For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated Our web collection on statistics for biologists contains articles on many of the points above. Software and code Policy information about availability of computer code Data collection Samples were collected and processed by Genomics England. The code used for curation of samples is available inside the Genomics England Research Environment under /re_gecip/shared_allGeCIPs/pancancer_signatures/code/processClinicalData. Data analysis Details and code for using the Intogen framework are available here (https://intogen.readthedocs.io/en/latest/index.html). The specific code to perform this analysis is available in the Genomics England research environment under /re_gecip/shared_allGeCIPs/pancancer_drivers/ code/. The link to becoming a member of the Genomics England research network and obtaining access can be found here https:// www.genomicsengland.co.uk/research/academic/join-gecip. The code to perform the canSAR chemogenomics analysis is available through Zenodo (https://zenodo.org/record/8329054). Additional packages/softwware used: VerifyBamID v1.1.3 = https://github.com/statgen/verifyBamID Ccube v1 = https://github.com/keyuan/ccube Isaac aligner v03.16.02.19 = https://github.com/Illumina/Isaac3 Strelka v2.4.7 = https://github.com/Illumina/strelka bcftools v1.9 = https://samtools.github.io/bcftools/bcftools.html alleleCount-FixVAF v4.1.0 = https://github.com/danchubb/alleleCount-FixVAF VEP v101 = https://github.com/Ensembl/ensembl-vep CADD v1.6 = https://github.com/kircherlab/CADD-scripts/ OncoKb v3.11 = https://www.oncokb.org/api-access trackViewer v1.38.2 = https://github.com/jianhong/trackViewer mSINGS = https://bitbucket.org/uwlabmed/msings/src/master/ HRDetect = https://github.com/eyzhao/hrdetect-pipeline
+ + 2 + + nature portfolio | reporting summary + +
April 2023 Battenberg v2.2.8 =https://github.com/Wedge-lab/battenberg Delly v0.7.9= https://github.com/dellytools/delly Lumpy v0.2.13 = https://github.com/arq5x/lumpy-sv/releases Manta v1.5.0 = https://github.com/Illumina/manta GATK v.4.4.0 = https://github.com/broadinstitute/gatk BEDOPS v2.4.2 = https://github.com/bedops/bedops bedtools v2.3.0 = https://bedtools.readthedocs.io/en/latest/index.html MutationTimeR v0.99.2 = https://github.com/gerstung-lab/MutationTimeR For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors and reviewers. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Portfolio guidelines for submitting code & software for further information. Data Policy information about availability of data All manuscripts must include a data availability statement. This statement should provide the following information, where applicable: -Accession codes, unique identifiers, or web links for publicly available datasets -A description of any restrictions on data availability -For clinical datasets or third party data, please ensure that the statement adheres to our policy Summary statistics for each tumour group are provided in the supplementary tables where such data does not enable identification of participants. All sample-specific WGS data and processed files from the 100,000 Genomes Project can be accessed by joining the Pan Cancer Genomics England Clinical Interpretation Partnership (GeCIP) Domain once an individual's data access has been approved (https://www.genomicsengland.co.uk/research/pan-cancer). The link to becoming a member of the genomics england research network and having access can be found here https://www.genomicsengland.co.uk/research/academic/join-gecip. The process involves an online application, verification by the applicant's institution, completion of a short information governance training course, and verification of approval by Genomics England. Please see https://www.genomicsengland.co.uk/research/academic for more information. The Genomics England data access agreement can be obtained from https://figshare.com/articles/dataset/GenomicEnglandProtocol_pdf/4530893/7. All analysis of Genomics England data must take place within the Genomics England Research Environment (https://www.genomicsengland.co.uk/understanding-genomics/data). The 100,000 Genomes Project publication policies can be obtained from https://www. genomicsengland.co.uk/about-gecip/publications. Samples and used in this study are provided in Genomics England under /re_gecip/shared_allGeCIPs/pancancer_drivers/results/. A MAF-like file detailing coding mutations across all 100kGP tumours analysed is available at /re_gecip/shared_allGeCIPs/pancancer_drivers/results/. The COSMIC and OncoKB clinical actionability data are available from https:// cancer.sanger.ac.uk/actionability and https://www.oncokb.org/actionableGenes#sections=Tx, respectively. The canSAR chemogenomics data are available from https://cansar.ai/. The NHS Genomic Test Directory for Cancer is available from https://www.england.nhs.uk/publication/national-genomic-test-directories/. List of drivers from prior studies obtained from COSMIC (https://cancer.sanger.ac.uk/cmc/home), Intogen (https://www.intogen.org/search) and and the The Cancer Genome Atlas (TCGA) Program pan-cancer analysis reported by Bailey et al. Somatic mutations were annotated to the cached version of GRCh38 in VEP v101. Research involving human participants, their data, or biological material Policy information about studies with human participants or human data. See also policy information about sex, gender (identity/presentation), and sexual orientation and race, ethnicity and racism. Reporting on sex and gender Sex was used as reported by NHSD, PHE/NCRAS and the GMCs where this matched the inferred sex from genomic sequencing. Where they do not match the sample was excluded. Reporting on race, ethnicity, or other socially relevant groupings Reported race, ethnicity, or other socially relevant groupings were not used in this study. Population characteristics Information relating to the cohort in this analysis are provided in supplementary table 3. The collection and processing of treatment information is described in detail in the methods. Recruitment Clinical and demographic data were obtained from NHS Digital (NHSD), Public Health England's National Cancer Registration and Analysis Service (PHE-NCRAS) and the Genomic Medicine Centres (GMCs) through the Genomics England Research Environment. Ethics oversight The 100,000 Genomes Project protocol was approved by the East of England and South Cambridge Research Ethics Committee on 20 February 2015, REC reference 14/EE/1112 Note that full information on the approval of the study protocol must also be provided in the manuscript. Field-specific reporting Please select the one below that is the best fit for your research. If you are not sure, read the appropriate sections before making your selection. Life sciences Behavioural & social sciences Ecological, evolutionary & environmental sciences For a reference copy of the document with all sections, see nature.com/documents/nr-reporting-summary-flat.pdf
+ + 3 + +
nature portfolio | reporting summary April 2023 Life sciences study design All studies must disclose on these points even when the disclosure is negative. Sample size 10,478 samples were included in the full cohort. Exact sample sizes for tumour groups are provided in supplementary table 2. Sample size was chosen based on the availability of whole genome sequencing of tumour/normal pairs in the Genomics England research environment. Data exclusions A detailed description of the sample quality control is provided in the methods. Supplementary table 1 provides information on how many samples were excluded. Sequenced tumour samples were excluded if clinical data were missing or if unresolvable conflicts existed between the clinical data sources (GMCs, NHSD, PHE-NCRAS, histology reports). In total 2,251/14,129 (15.9%) of tumour samples were excluded based on availability and consistency of reported sex, tumour histology, tumour type, sampling date or if the participant was recorded as less than 18 years old at the time of sampling. 267/11878 (2.2%) of tumour samples with required clinical data available were excluded based on tumour sample purity and sequencing data quality. Duplicate tumour samples were also removed, to ensure that no individual was represented more than once in a tumour group. If multiple sequenced tumour samples from the same tumour group were available for an individual, we preferentially kept primary tumour samples with highest purity. Non-solid tumours were removed from this analysis. Based on these criteria, 10,478 tumour samples were suitable for analysis. Replication This study has an observational rather than an experimental study design, and only one sample was sequenced from each participant, in the great majority of cases. We replicate many of the findings from previously published studies of somatic cancer driver genes. Randomization This study has an observational rather than an experimental study design hence randomisation of study participants is not relevant. Blinding This study used real-world observation data collected from NHS trusts. The investigators did not have control over sample selection, collection and processing and as such blinding is not relevant to this study. Reporting for specific materials, systems and methods We require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material, system or method listed is relevant to your study. If you are not sure if a list item applies to your research, read the appropriate section before selecting a response. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Novel plant genotypes Describe the methods by which all novel plant genotypes were produced. This includes those generated by transgenic approaches, gene editing, chemical/radiation-based mutagenesis and hybridization. For transgenic lines, describe the transformation method, the number of independent lines analyzed and the generation upon which experiments were performed. For gene-edited lines, describe the editor used, the endogenous sequence targeted for editing, the targeting guide RNA sequence (if applicable) and how the editor was applied. Seed stocks Report on the source of all seed stocks or other plant material used. If applicable, state the seed stock centre and catalogue number. If plant specimens were collected from the field, describe the collection location, date and sampling procedures. Authentication Describe any authentication procedures for each seed stock used or novel genotype generated. Describe any experiments used to assess the effect of a mutation and, where applicable, how potential secondary effects (e.g. second site T-DNA insertions, mosiacism, off-target gene editing) were examined. Plants
+ + + +